miRTarBase - #MIRT104782


—
pre-miRNA Information
pre-miRNA hsa-mir-3529   
Genomic Coordinates chr15: 88611847 - 88611924
Description Homo sapiens miR-3529 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3529-3p
Sequence 46| AACAACAAAAUCACUAGUCUUCCA |69
Evidence Not_experimental
Experiments
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1196555927 1 dbSNP
rs1215541761 2 dbSNP
rs761252497 3 dbSNP
rs1263337637 4 dbSNP
rs868026301 6 dbSNP
rs762762175 9 dbSNP
rs751269230 14 dbSNP
rs1257397051 16 dbSNP
Putative Targets

Gene Information
Gene Symbol FZD6   
Synonyms FZ-6, FZ6, HFZ6, NDNC10
Description frizzled class receptor 6
Transcript NM_001164615   
Other Transcripts NM_001164616 , NM_003506   
Expression
Putative miRNA Targets on FZD6
3'UTR of FZD6
(miRNA target sites are highlighted)		 
>FZD6|NM_001164615|3'UTR
   1 AGAACATTTTCTCTCGTTACTCAGAAGCAAATTTGTGTTACACTGGAAGTGACCTATGCACTGTTTTGTAAGAATCACTG
  81 TTACATTCTTCTTTTGCACTTAAAGTTGCATTGCCTACTGTTATACTGGAAAAAATAGAGTTCAAGAATAATATGACTCA
 161 TTTCACACAAAGGTTAATGACAACAATATACCTGAAAACAGAAATGTGCAGGTTAATAATATTTTTTTAATAGTGTGGGA
 241 GGACAGAGTTAGAGGAATCTTCCTTTTCTATTTATGAAGATTCTACTCTTGGTAAGAGTATTTTAAGATGTACTATGCTA
 321 TTTTACTTTTTTGATATAAAATCAAGATATTTCTTTGCTGAAGTATTTAAATCTTATCCTTGTATCTTTTTATACATATT
 401 TGAAAATAAGCTTATATGTATTTGAACTTTTTTGAAATCCTATTCAAGTATTTTTATCATGCTATTGTGATATTTTAGCA
 481 CTTTGGTAGCTTTTACACTGAATTTCTAAGAAAATTGTAAAATAGTCTTCTTTTATACTGTAAAAAAAGATATACCAAAA
 561 AGTCTTATAATAGGAATTTAACTTTAAAAACCCACTTATTGATACCTTACCATCTAAAATGTGTGATTTTTATAGTCTCG
 641 TTTTAGGAATTTCACAGATCTAAATTATGTAACTGAAATAAGGTGCTTACTCAAAGAGTGTCCACTATTGATTGTATTAT
 721 GCTGCTCACTGATCCTTCTGCATATTTAAAATAAAATGTCCTAAAGGGTTAGTAGACAAAATGTTAGTCTTTTGTATATT
 801 AGGCCAAGTGCAATTGACTTCCCTTTTTTAATGTTTCATGACCACCCATTGATTGTATTATAACCACTTACAGTTGCTTA
 881 TATTTTTTGTTTTAACTTTTGTTTTTTAACATTTAGAATATTACATTTTGTATTATACAGTACCTTTCTCAGACATTTTG
 961 TAGAATTCATTTCGGCAGCTCACTAGGATTTTGCTGAACATTAAAAAGTGTGATAGCGATATTAGTGCCAATCAAATGGA
1041 AAAAAGGTAGTTTTAATAAACAAGACACAACGTTTTTATACAACATACTTTAAAATATTAAGGAGTTTTCTTAATTTTGT
1121 TTCCTATTAAGTATTATTCTTTGGGCAAGATTTTCTGATGCTTTTGATTTTCTCTCAATTTAGCATTTGCTTTTGGTTTT
1201 TTTCTCTATTTAGCATTCTGTTAAGGCACAAAAACTATGTACTGTATGGGAAATGTTGTAAATATTACCTTTTCCACATT
1281 TTAAACAGACAACTTTGAATACAAAAACTTTGTTTTGTGTGATCTTTTCATTAATAAAATTATCTTTGTATAAGAAAAAA
1361 AAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' accuucUGAUCACUAAAACAACaa 5'
                ||||| ||||||| ||  
Target 5' cagctcACTAG-GATTTTGCTGaa 3'
 976 - 998 125.00 -11.90
2 
miRNA  3' acCUUCUGAUCACUAAAACAAcaa 5'
            ||:  :|  | ||||||||   
Target 5' agGAGTTTTCTTAATTTTGTTtcc 3'
 1101 - 1124 122.00 -6.92
3 
miRNA  3' accuucugaucacuaaaACAACAa 5'
                           |||||| 
Target 5' atgtactgtatgggaaaTGTTGTa 3'
 1237 - 1260 120.00 -7.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31532865 11 COSMIC
COSN30162732 14 COSMIC
COSN30165907 14 COSMIC
COSN26976932 23 COSMIC
COSN30538389 72 COSMIC
COSN17748687 89 COSMIC
COSN31558759 170 COSMIC
COSN30115185 187 COSMIC
COSN20105763 206 COSMIC
COSN27883597 415 COSMIC
COSN22187457 572 COSMIC
COSN24896780 659 COSMIC
COSN32057825 884 COSMIC
COSN29044457 1055 COSMIC
COSN21623381 1072 COSMIC
COSN17591425 1074 COSMIC
COSN28670831 1102 COSMIC
COSN26561826 1168 COSMIC
COSN5668764 1222 COSMIC
COSN31548689 1308 COSMIC
COSN21123903 1324 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs771707817 1 dbSNP
rs774893848 4 dbSNP
rs746461796 6 dbSNP
rs762772045 7 dbSNP
rs772994829 10 dbSNP
rs375233715 16 dbSNP
rs202151037 17 dbSNP
rs745515674 21 dbSNP
rs200202095 23 dbSNP
rs200403554 25 dbSNP
rs767708228 36 dbSNP
rs752732617 43 dbSNP
rs375750148 44 dbSNP
rs1390776903 45 dbSNP
rs1164501314 50 dbSNP
rs1459849574 55 dbSNP
rs1367299383 56 dbSNP
rs910955567 57 dbSNP
rs1478378328 61 dbSNP
rs1265578240 64 dbSNP
rs1191714488 67 dbSNP
rs775079407 76 dbSNP
rs1158430924 83 dbSNP
rs1211727466 84 dbSNP
rs1361553343 85 dbSNP
rs2934725 86 dbSNP
rs1299621945 89 dbSNP
rs970247879 101 dbSNP
rs1226157251 102 dbSNP
rs1331342054 103 dbSNP
rs1435160261 104 dbSNP
rs1384643717 106 dbSNP
rs980323449 110 dbSNP
rs1392883634 118 dbSNP
rs1274883789 119 dbSNP
rs922727017 124 dbSNP
rs765805800 125 dbSNP
rs1166518560 136 dbSNP
rs1475174470 137 dbSNP
rs773807060 162 dbSNP
rs1201083977 169 dbSNP
rs1431551303 170 dbSNP
rs768464864 185 dbSNP
rs35421828 202 dbSNP
rs796231490 202 dbSNP
rs763463112 203 dbSNP
rs202183884 206 dbSNP
rs550526662 213 dbSNP
rs766822353 223 dbSNP
rs893840152 244 dbSNP
rs1010847488 248 dbSNP
rs1345282590 252 dbSNP
rs984051667 270 dbSNP
rs190945010 271 dbSNP
rs1230412862 272 dbSNP
rs907614162 298 dbSNP
rs1369543930 300 dbSNP
rs1309390274 307 dbSNP
rs1045582849 311 dbSNP
rs1326120997 332 dbSNP
rs1403098424 336 dbSNP
rs1288019235 339 dbSNP
rs944488552 342 dbSNP
rs1409818865 343 dbSNP
rs1403141086 348 dbSNP
rs751902079 349 dbSNP
rs1040006453 354 dbSNP
rs905297334 358 dbSNP
rs1248468032 379 dbSNP
rs1179354230 381 dbSNP
rs1441453598 385 dbSNP
rs1438447006 409 dbSNP
rs1236355893 413 dbSNP
rs1004009565 420 dbSNP
rs900172400 425 dbSNP
rs931861615 441 dbSNP
rs755218973 442 dbSNP
rs1280504260 444 dbSNP
rs529787313 446 dbSNP
rs13273192 454 dbSNP
rs1346707039 458 dbSNP
rs566177819 461 dbSNP
rs999347514 466 dbSNP
rs1379754537 471 dbSNP
rs1278336752 472 dbSNP
rs960105698 480 dbSNP
rs1052734716 492 dbSNP
rs1404324410 500 dbSNP
rs1323662604 502 dbSNP
rs1433032434 519 dbSNP
rs1375132202 524 dbSNP
rs868069211 529 dbSNP
rs1159326309 536 dbSNP
rs1332307634 537 dbSNP
rs533546531 542 dbSNP
rs1308412762 543 dbSNP
rs983806856 555 dbSNP
rs567339455 557 dbSNP
rs1185545894 567 dbSNP
rs963835877 568 dbSNP
rs1355924623 587 dbSNP
rs1024268610 592 dbSNP
rs535316523 593 dbSNP
rs1350927706 602 dbSNP
rs1001520161 605 dbSNP
rs1357690412 612 dbSNP
rs147114928 612 dbSNP
rs1286310749 613 dbSNP
rs1456477348 614 dbSNP
rs1198627181 616 dbSNP
rs1239347824 621 dbSNP
rs1402108934 623 dbSNP
rs1442045688 626 dbSNP
rs922832875 632 dbSNP
rs570823999 641 dbSNP
rs983630462 642 dbSNP
rs538405054 646 dbSNP
rs1415942543 672 dbSNP
rs908044261 675 dbSNP
rs1474780290 688 dbSNP
rs965785669 692 dbSNP
rs1423866886 698 dbSNP
rs1052662948 700 dbSNP
rs976257128 709 dbSNP
rs1484692445 712 dbSNP
rs1185873472 715 dbSNP
rs921568266 716 dbSNP
rs931622687 727 dbSNP
rs1221740080 729 dbSNP
rs965219331 736 dbSNP
rs1368201862 740 dbSNP
rs1472295400 741 dbSNP
rs1043435776 744 dbSNP
rs925188304 754 dbSNP
rs915477348 763 dbSNP
rs1463626497 765 dbSNP
rs1334562340 767 dbSNP
rs946948227 769 dbSNP
rs1220621206 773 dbSNP
rs1360145853 774 dbSNP
rs1045087955 776 dbSNP
rs905161064 793 dbSNP
rs935277362 796 dbSNP
rs1052239513 798 dbSNP
rs1310383000 800 dbSNP
rs1339648182 801 dbSNP
rs756095977 804 dbSNP
rs1323862466 812 dbSNP
rs1245854135 817 dbSNP
rs1400706841 821 dbSNP
rs1286158299 825 dbSNP
rs1316246248 833 dbSNP
rs1426355529 835 dbSNP
rs556506602 847 dbSNP
rs1418438150 849 dbSNP
rs1191239268 862 dbSNP
rs1478754993 871 dbSNP
rs1250627087 873 dbSNP
rs1468434623 879 dbSNP
rs1259037341 882 dbSNP
rs1207131380 883 dbSNP
rs7827146 884 dbSNP
rs1295174108 899 dbSNP
rs895687169 906 dbSNP
rs993989464 912 dbSNP
rs1025458388 918 dbSNP
rs1199234004 921 dbSNP
rs79043564 922 dbSNP
rs1266018961 927 dbSNP
rs1005847263 934 dbSNP
rs1460311381 937 dbSNP
rs757109658 947 dbSNP
rs1017942388 949 dbSNP
rs1443330071 956 dbSNP
rs768441390 959 dbSNP
rs1045781451 961 dbSNP
rs905982766 968 dbSNP
rs1189990470 972 dbSNP
rs1001490410 973 dbSNP
rs184082629 975 dbSNP
rs572419216 976 dbSNP
rs1029812384 978 dbSNP
rs956890732 980 dbSNP
rs1479890739 981 dbSNP
rs952296491 982 dbSNP
rs1251127040 998 dbSNP
rs186924860 1002 dbSNP
rs1423701306 1013 dbSNP
rs915382635 1018 dbSNP
rs778777161 1019 dbSNP
rs76714224 1020 dbSNP
rs1377514935 1021 dbSNP
rs1309125265 1026 dbSNP
rs1389630220 1028 dbSNP
rs976305760 1031 dbSNP
rs1300976804 1034 dbSNP
rs1401296016 1035 dbSNP
rs1396416100 1039 dbSNP
rs1335898440 1040 dbSNP
rs1338724240 1041 dbSNP
rs1372297369 1041 dbSNP
rs1218185847 1049 dbSNP
rs2687355 1054 dbSNP
rs1373294496 1056 dbSNP
rs771760919 1068 dbSNP
rs939340612 1068 dbSNP
rs544382326 1073 dbSNP
rs897894611 1074 dbSNP
rs191610713 1076 dbSNP
rs1250173042 1078 dbSNP
rs1346276667 1090 dbSNP
rs1202548005 1094 dbSNP
rs1058130 1102 dbSNP
rs1487135833 1106 dbSNP
rs1255724796 1109 dbSNP
rs1192472063 1115 dbSNP
rs1046938550 1119 dbSNP
rs1263320256 1121 dbSNP
rs888241477 1128 dbSNP
rs1316287644 1132 dbSNP
rs771844178 1133 dbSNP
rs1173286021 1135 dbSNP
rs1005506493 1136 dbSNP
rs529794479 1141 dbSNP
rs1018598874 1146 dbSNP
rs899524179 1147 dbSNP
rs1400248133 1148 dbSNP
rs1466430767 1151 dbSNP
rs1286615311 1176 dbSNP
rs1175298083 1194 dbSNP
rs935221220 1196 dbSNP
rs183064316 1198 dbSNP
rs1399702900 1199 dbSNP
rs143515079 1208 dbSNP
rs956470244 1212 dbSNP
rs917870942 1227 dbSNP
rs187081989 1230 dbSNP
rs1187447834 1231 dbSNP
rs746553277 1241 dbSNP
rs968620326 1243 dbSNP
rs1332192574 1246 dbSNP
rs1236048931 1255 dbSNP
rs1485498092 1257 dbSNP
rs905948665 1271 dbSNP
rs768030117 1289 dbSNP
rs1265999042 1292 dbSNP
rs1234877970 1302 dbSNP
rs981081323 1310 dbSNP
rs1215504424 1319 dbSNP
rs926856315 1326 dbSNP
rs1218789314 1332 dbSNP
rs527259038 1335 dbSNP
rs1327844788 1339 dbSNP
rs1292818825 1350 dbSNP
rs1384845453 1352 dbSNP
rs191837768 1355 dbSNP
rs1463506628 1356 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 8323.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000358755.4 | 3UTR | AAGGCACAAAAACUAUGUACUGUAUGGGAAAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
101 hsa-miR-3529-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT061395 WEE1 WEE1 G2 checkpoint kinase 2 2
MIRT066530 HMGA2 high mobility group AT-hook 2 2 6
MIRT072699 SMAD3 SMAD family member 3 2 2
MIRT080963 LRRC8B leucine rich repeat containing 8 VRAC subunit B 2 2
MIRT095081 SAR1B secretion associated Ras related GTPase 1B 2 2
MIRT104782 FZD6 frizzled class receptor 6 2 2
MIRT161286 U2SURP U2 snRNP associated SURP domain containing 2 2
MIRT176138 ATP7A ATPase copper transporting alpha 2 2
MIRT221376 DNAJB6 DnaJ heat shock protein family (Hsp40) member B6 2 2
MIRT260611 SOX4 SRY-box 4 2 4
MIRT269640 MDM4 MDM4, p53 regulator 2 4
MIRT306853 FYTTD1 forty-two-three domain containing 1 2 2
MIRT315027 TFAP2A transcription factor AP-2 alpha 2 2
MIRT367278 CRKL CRK like proto-oncogene, adaptor protein 2 2
MIRT444211 TMPRSS4 transmembrane protease, serine 4 2 2
MIRT455829 ZSWIM1 zinc finger SWIM-type containing 1 2 2
MIRT466299 TM4SF1 transmembrane 4 L six family member 1 2 2
MIRT467332 SPATA13 spermatogenesis associated 13 2 4
MIRT469830 RAB14 RAB14, member RAS oncogene family 2 2
MIRT470571 POU2F1 POU class 2 homeobox 1 2 2
MIRT472094 NOLC1 nucleolar and coiled-body phosphoprotein 1 2 2
MIRT482529 ACTB actin beta 2 4
MIRT495009 KRTAP4-9 keratin associated protein 4-9 2 4
MIRT495562 ZNF169 zinc finger protein 169 2 2
MIRT496742 PBX2P1 PBX homeobox 2 pseudogene 1 2 4
MIRT500811 THBS1 thrombospondin 1 2 2
MIRT500846 SYPL1 synaptophysin like 1 2 4
MIRT504267 C1orf147 chromosome 1 open reading frame 147 2 4
MIRT504320 TUSC1 tumor suppressor candidate 1 2 6
MIRT505533 SPATA2 spermatogenesis associated 2 2 4
MIRT505799 RSBN1 round spermatid basic protein 1 2 4
MIRT518201 CLEC4E C-type lectin domain family 4 member E 2 2
MIRT520019 YTHDF1 YTH N6-methyladenosine RNA binding protein 1 2 4
MIRT527321 NCAM2 neural cell adhesion molecule 2 2 2
MIRT529005 SIGLEC14 sialic acid binding Ig like lectin 14 2 4
MIRT530312 TNFRSF10D TNF receptor superfamily member 10d 2 2
MIRT532324 DUSP4 dual specificity phosphatase 4 2 2
MIRT532497 HOXA13 homeobox A13 2 2
MIRT533203 WASF3 WAS protein family member 3 2 4
MIRT533376 UBE2D4 ubiquitin conjugating enzyme E2 D4 (putative) 2 4
MIRT534107 SOWAHC sosondowah ankyrin repeat domain family member C 2 2
MIRT537381 FGF2 fibroblast growth factor 2 2 2
MIRT537487 FAM169A family with sequence similarity 169 member A 2 2
MIRT539210 ANTXR2 anthrax toxin receptor 2 2 4
MIRT540299 GFPT1 glutamine--fructose-6-phosphate transaminase 1 2 2
MIRT544610 FCF1 FCF1, rRNA-processing protein 2 2
MIRT547382 MPRIP myosin phosphatase Rho interacting protein 2 2
MIRT551195 GAB2 GRB2 associated binding protein 2 2 2
MIRT554193 SLC35D1 solute carrier family 35 member D1 2 2
MIRT554998 RAB39B RAB39B, member RAS oncogene family 2 2
MIRT557252 CRAMP1L cramped chromatin regulator homolog 1 2 2
MIRT558440 DDIT4 DNA damage inducible transcript 4 2 3
MIRT558687 CMIP c-Maf inducing protein 2 2
MIRT562111 ITGB1 integrin subunit beta 1 2 2
MIRT562312 GATAD2A GATA zinc finger domain containing 2A 2 2
MIRT564781 ZDHHC7 zinc finger DHHC-type containing 7 2 2
MIRT565536 SON SON DNA binding protein 2 2
MIRT567294 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT572337 SOX5 SRY-box 5 2 2
MIRT572389 MTX3 metaxin 3 2 2
MIRT575082 Ddit4 DNA-damage-inducible transcript 4 2 3
MIRT576838 Tgfbr3 transforming growth factor, beta receptor III 2 2
MIRT607441 SEMA6D semaphorin 6D 2 4
MIRT609555 TCEAL4 transcription elongation factor A like 4 2 2
MIRT612890 HOOK3 hook microtubule tethering protein 3 2 2
MIRT613611 TP53 tumor protein p53 2 2
MIRT614708 TNFRSF21 TNF receptor superfamily member 21 2 2
MIRT616823 HERC5 HECT and RLD domain containing E3 ubiquitin protein ligase 5 2 2
MIRT620652 CXCL5 C-X-C motif chemokine ligand 5 2 2
MIRT626770 CDC14B cell division cycle 14B 2 2
MIRT633598 IBA57 IBA57 homolog, iron-sulfur cluster assembly 2 2
MIRT634853 PTP4A2 protein tyrosine phosphatase type IVA, member 2 2 2
MIRT638138 TTC26 tetratricopeptide repeat domain 26 2 2
MIRT639574 GORASP1 golgi reassembly stacking protein 1 2 2
MIRT643710 ZNF736 zinc finger protein 736 2 2
MIRT644969 STEAP4 STEAP4 metalloreductase 2 2
MIRT645427 NINJ1 ninjurin 1 2 2
MIRT645939 HIPK1 homeodomain interacting protein kinase 1 2 2
MIRT646142 INTS7 integrator complex subunit 7 2 2
MIRT658015 GABRA4 gamma-aminobutyric acid type A receptor alpha4 subunit 2 2
MIRT658995 DIP2C disco interacting protein 2 homolog C 2 2
MIRT675003 SLC22A17 solute carrier family 22 member 17 2 2
MIRT675553 SIK1 salt inducible kinase 1 2 2
MIRT675621 CSE1L chromosome segregation 1 like 2 2
MIRT675952 IDE insulin degrading enzyme 2 2
MIRT692250 POLR3F RNA polymerase III subunit F 2 2
MIRT698738 STX12 syntaxin 12 2 2
MIRT699001 SPAG9 sperm associated antigen 9 2 2
MIRT703275 GNG12 G protein subunit gamma 12 2 2
MIRT706268 MKLN1 muskelin 1 2 2
MIRT707633 TARDBP TAR DNA binding protein 2 2
MIRT709622 KBTBD6 kelch repeat and BTB domain containing 6 2 2
MIRT712931 RPF2 ribosome production factor 2 homolog 2 2
MIRT713807 KCNK5 potassium two pore domain channel subfamily K member 5 2 2
MIRT714036 SYDE2 synapse defective Rho GTPase homolog 2 2 2
MIRT714388 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT714404 FBXO31 F-box protein 31 2 2
MIRT714599 HSPA4L heat shock protein family A (Hsp70) member 4 like 2 2
MIRT714663 TPCN2 two pore segment channel 2 2 2
MIRT714882 GOLPH3 golgi phosphoprotein 3 2 2
MIRT725043 NDUFAF7 NADH:ubiquinone oxidoreductase complex assembly factor 7 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-3529-3p Erlotinib 176870 NSC718781 approved sensitive High Head And Neck Squamous Cell Carcinoma cell line (HN6)
hsa-miR-3529-3p Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)

Error report submission