miRTarBase - #MIRT107595


—
pre-miRNA Information
pre-miRNA hsa-mir-921   
Genomic Coordinates chr1: 166154743 - 166154798
Synonyms MIRN921, hsa-mir-921, MIR921
Description Homo sapiens miR-921 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-921
Sequence 2| CUAGUGAGGGACAGAACCAGGAUUC |26
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN31549221 11 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1464259216 3 dbSNP
rs768428855 8 dbSNP
rs746970999 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol DNAJA1   
Synonyms DJ-2, DjA1, HDJ2, HSDJ, HSJ-2, HSJ2, HSPF4, NEDD7, hDJ-2
Description DnaJ heat shock protein family (Hsp40) member A1
Transcript NM_001539   
Expression
Putative miRNA Targets on DNAJA1
3'UTR of DNAJA1
(miRNA target sites are highlighted)		 
>DNAJA1|NM_001539|3'UTR
   1 TGGGCCAGTGAATAACACTCACTGCTGGCATTTAATGTGCAGTAGTGAATGAGTGAAGGACTGTAATCATAATATGCTCA
  81 CTACTTGCTCTTGTTTTTGTTTTAATAAACTATAGTAGTGTTTTAAAAAGTTAAATGAAGAATAAACGCAAATATAAAAG
 161 CTCTGATTTTGCCCTGTATGTATGATGACTTCAGTGTGCAAGATGAAGTTTAATACCTGTAAAAACTACAAAGAAGTTCC
 241 CCTAGCATTTCTAGGCCAAACCTTGTAATTGACTTCAGCTATGTACGTGGACAAGCTTAGACTGAAATGCTAGGTATATG
 321 TATTGGCTTCAGTGTATGACCCTTCATTGTTAAGCTATGAAAGTAAAACTCTGTATTTAACTGGCAATGAGGAAAAAAAA
 401 ATTTTGTAGAGAAGTGTTGGTCTGTATAGTTCTTTATATTAAGTGGGATTCATTGTAATGCCTCTGCATTTATTCTGTTG
 481 CCTCAGCTGTTACTTGAAGATGGCGTAATATATAATTTATCCTGTGGTATCAGTGATAAAAATGATACCTTTCTGTAGGA
 561 GGGGTTTATCATAATATGCTGCTTCTTGAAGGCTTGCACTTCCAGAATTGTGTTTCCTTCTGCTGTGCCATTCATATATA
 641 TATACATATATATATATAATCTTGACCAGTCCTGGTCATTTGCTCCCCTCCTTGTCTGTGGACCATGATAAGCCCAAGTA
 721 GTGACTTCAGAGCTGGGTAACAGAAATTAAAGTGAAAAGACCTTTACGTGGAGAATTTGCATGCGTAATATAGGAAGGTG
 801 TTCTTTAGGTATGTTACAGGATTACTTTAAACCATTTGACTTTCGCTCCAAAGTTATGTTGGTAGTATAGCAAATTATGA
 881 TGAATAGCTTTAATTGTATGTTTAAAAGTCTCATATGTTCACATGCTTAAATCTGGGTATCAGAATTTAAGCAATTCTTG
 961 AAATGTATTGTCTCCTTAATATACTAATTACAAAGCATCTCCAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cuUAGGACCAAGACAGGGAGUGAUc 5'
            ||| |   | ||   ||||||| 
Target 5' taATCAT-AATATG---CTCACTAc 3'
 64 - 84 143.00 -9.30
2 
miRNA  3' cuuaggACCAAGACA------GGGAGUGAUc 5'
                |||  | ||      | ||||||: 
Target 5' ------TGGGCCAGTGAATAACACTCACTGc 3'
 1 - 25 129.00 -10.00
3 
miRNA  3' cuuAGGAC----CAAGACAG-GGAGUGAUc 5'
             ||:||    || :|||| |||:| || 
Target 5' aatTCTTGAAATGTATTGTCTCCTTAATAt 3'
 953 - 982 124.00 -13.06
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31482200 21 COSMIC
COSN6389584 26 COSMIC
COSN31581448 73 COSMIC
COSN28875445 127 COSMIC
COSN23629191 410 COSMIC
COSN17021155 646 COSMIC
COSN21313385 760 COSMIC
COSN21485422 788 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1375108142 1 dbSNP
rs770904664 2 dbSNP
rs1304746476 3 dbSNP
rs776768067 7 dbSNP
rs781143779 10 dbSNP
rs745449469 12 dbSNP
rs1275915125 13 dbSNP
rs1311169512 15 dbSNP
rs747015712 17 dbSNP
rs769521508 19 dbSNP
rs774816290 20 dbSNP
rs1183968380 21 dbSNP
rs762575235 23 dbSNP
rs1456257632 33 dbSNP
rs1004514057 34 dbSNP
rs1234672839 35 dbSNP
rs1177794678 36 dbSNP
rs1330186885 38 dbSNP
rs1247171442 40 dbSNP
rs772428402 47 dbSNP
rs1170834464 51 dbSNP
rs773775893 56 dbSNP
rs1321123173 58 dbSNP
rs1466245286 60 dbSNP
rs1161559011 62 dbSNP
rs755505219 62 dbSNP
rs1385041317 64 dbSNP
rs1413215585 69 dbSNP
rs1398406414 70 dbSNP
rs1446457620 71 dbSNP
rs761015443 72 dbSNP
rs766672756 73 dbSNP
rs754232780 75 dbSNP
rs759627222 76 dbSNP
rs765543456 80 dbSNP
rs1343627660 82 dbSNP
rs752685836 83 dbSNP
rs1386719761 85 dbSNP
rs1259531668 91 dbSNP
rs1376182287 91 dbSNP
rs1477876197 91 dbSNP
rs758568855 93 dbSNP
rs374511744 95 dbSNP
rs1337735657 103 dbSNP
rs759112229 104 dbSNP
rs11542818 115 dbSNP
rs990381230 122 dbSNP
rs7296 124 dbSNP
rs1211363540 128 dbSNP
rs1373584184 132 dbSNP
rs945405184 134 dbSNP
rs114496815 141 dbSNP
rs1277020589 148 dbSNP
rs1397544630 149 dbSNP
rs1300604073 155 dbSNP
rs1313997421 158 dbSNP
rs1414298151 161 dbSNP
rs1346535318 172 dbSNP
rs1400513759 175 dbSNP
rs1169928352 176 dbSNP
rs1211421197 180 dbSNP
rs534448067 181 dbSNP
rs1475872695 183 dbSNP
rs554132326 185 dbSNP
rs1423101434 190 dbSNP
rs1191644135 191 dbSNP
rs1476201856 197 dbSNP
rs1469864602 205 dbSNP
rs911868218 209 dbSNP
rs577470498 226 dbSNP
rs1435813321 229 dbSNP
rs1441686706 240 dbSNP
rs1276257349 243 dbSNP
rs1339696084 245 dbSNP
rs944691471 247 dbSNP
rs1042345 252 dbSNP
rs900750633 253 dbSNP
rs539421217 265 dbSNP
rs1447930084 274 dbSNP
rs1339166591 282 dbSNP
rs556610012 287 dbSNP
rs1192052048 288 dbSNP
rs1049187204 294 dbSNP
rs1463117678 296 dbSNP
rs1394498307 297 dbSNP
rs1454768367 298 dbSNP
rs1472427031 303 dbSNP
rs886206422 311 dbSNP
rs1183751617 317 dbSNP
rs1004558138 319 dbSNP
rs1196360296 327 dbSNP
rs1023992639 330 dbSNP
rs971107715 337 dbSNP
rs767886244 342 dbSNP
rs1227182436 351 dbSNP
rs1354903006 369 dbSNP
rs1281737045 370 dbSNP
rs1001605446 372 dbSNP
rs1376589749 374 dbSNP
rs759928022 376 dbSNP
rs1443392478 379 dbSNP
rs1329931014 391 dbSNP
rs1323003368 393 dbSNP
rs1356698609 393 dbSNP
rs1443848379 396 dbSNP
rs1403628419 399 dbSNP
rs1411598344 401 dbSNP
rs576537888 402 dbSNP
rs757519062 402 dbSNP
rs957480914 402 dbSNP
rs542317825 403 dbSNP
rs1469538433 412 dbSNP
rs966799090 416 dbSNP
rs1220219950 417 dbSNP
rs978200512 422 dbSNP
rs911961620 425 dbSNP
rs1241505227 427 dbSNP
rs944766159 428 dbSNP
rs1305053866 437 dbSNP
rs778814654 441 dbSNP
rs1236895172 454 dbSNP
rs1368596492 463 dbSNP
rs758807285 468 dbSNP
rs975144598 468 dbSNP
rs1347033975 469 dbSNP
rs1320273309 474 dbSNP
rs1420247447 474 dbSNP
rs1213983538 476 dbSNP
rs1359748553 477 dbSNP
rs1156647387 478 dbSNP
rs1455383374 483 dbSNP
rs1273430348 496 dbSNP
rs1425494519 499 dbSNP
rs1190244605 505 dbSNP
rs922217104 506 dbSNP
rs1216613192 512 dbSNP
rs930852886 513 dbSNP
rs1213527668 515 dbSNP
rs1284436936 515 dbSNP
rs1211986839 523 dbSNP
rs190382879 534 dbSNP
rs1252646744 537 dbSNP
rs1468932651 541 dbSNP
rs1195562099 544 dbSNP
rs1240475587 545 dbSNP
rs1475364194 546 dbSNP
rs1169007505 549 dbSNP
rs1422009564 550 dbSNP
rs1460231220 551 dbSNP
rs1162284279 553 dbSNP
rs1421150238 562 dbSNP
rs1193776149 566 dbSNP
rs1477195000 571 dbSNP
rs1261704989 574 dbSNP
rs1049230870 577 dbSNP
rs796515746 582 dbSNP
rs574675150 585 dbSNP
rs1441231581 591 dbSNP
rs1327326226 598 dbSNP
rs1309519491 603 dbSNP
rs780530305 604 dbSNP
rs534901083 609 dbSNP
rs146021760 611 dbSNP
rs1270704379 613 dbSNP
rs1341165197 615 dbSNP
rs1231255824 618 dbSNP
rs1272375390 620 dbSNP
rs1335694585 626 dbSNP
rs1302075856 632 dbSNP
rs1445475698 632 dbSNP
rs906938513 632 dbSNP
rs537309585 633 dbSNP
rs1245559024 634 dbSNP
rs1275145216 634 dbSNP
rs1322277608 634 dbSNP
rs201643498 634 dbSNP
rs1311886323 636 dbSNP
rs541836605 636 dbSNP
rs1378830124 638 dbSNP
rs1446502180 638 dbSNP
rs893072377 640 dbSNP
rs1294807798 642 dbSNP
rs768269278 642 dbSNP
rs1457927891 644 dbSNP
rs146004118 644 dbSNP
rs560140690 645 dbSNP
rs1042376 646 dbSNP
rs1165577892 646 dbSNP
rs1255062311 647 dbSNP
rs1419115000 647 dbSNP
rs1488178886 650 dbSNP
rs552224366 650 dbSNP
rs1264862009 651 dbSNP
rs1238670765 653 dbSNP
rs562122994 653 dbSNP
rs1309719717 654 dbSNP
rs1355694485 654 dbSNP
rs1239111291 655 dbSNP
rs755027166 656 dbSNP
rs1019065931 658 dbSNP
rs1215783765 658 dbSNP
rs1389386518 659 dbSNP
rs74178844 659 dbSNP
rs1292355535 660 dbSNP
rs1361662317 661 dbSNP
rs1197371387 662 dbSNP
rs1158438972 668 dbSNP
rs1461627512 670 dbSNP
rs1379627887 672 dbSNP
rs1164651009 676 dbSNP
rs1432732872 686 dbSNP
rs1265374624 692 dbSNP
rs1382060895 697 dbSNP
rs1206904681 706 dbSNP
rs1489247968 716 dbSNP
rs1399649043 717 dbSNP
rs112767677 721 dbSNP
rs974775828 722 dbSNP
rs1257463424 726 dbSNP
rs1342273158 731 dbSNP
rs553570205 736 dbSNP
rs1292448530 742 dbSNP
rs547875231 743 dbSNP
rs568639901 749 dbSNP
rs1355865850 750 dbSNP
rs1298568394 762 dbSNP
rs1401264163 763 dbSNP
rs921897474 768 dbSNP
rs1259214171 769 dbSNP
rs1418325564 773 dbSNP
rs756709286 779 dbSNP
rs567827643 785 dbSNP
rs534088291 786 dbSNP
rs985028850 790 dbSNP
rs1376091600 792 dbSNP
rs908130383 795 dbSNP
rs1478176527 799 dbSNP
rs529924885 807 dbSNP
rs1192851866 808 dbSNP
rs1445128251 809 dbSNP
rs1280493806 816 dbSNP
rs1200756873 818 dbSNP
rs1343897754 819 dbSNP
rs1253858749 822 dbSNP
rs1219974022 826 dbSNP
rs1317993343 827 dbSNP
rs1210867978 829 dbSNP
rs369360190 837 dbSNP
rs1398708442 840 dbSNP
rs940895707 844 dbSNP
rs540399833 845 dbSNP
rs1400397349 849 dbSNP
rs571019678 858 dbSNP
rs1466271838 863 dbSNP
rs1168556505 865 dbSNP
rs1422995865 865 dbSNP
rs1474389854 867 dbSNP
rs1361729687 870 dbSNP
rs937062634 874 dbSNP
rs1441597813 877 dbSNP
rs1240956208 878 dbSNP
rs1055478202 883 dbSNP
rs892823425 897 dbSNP
rs1256872865 907 dbSNP
rs1011228545 913 dbSNP
rs1361984658 917 dbSNP
rs1436983857 917 dbSNP
rs540106753 919 dbSNP
rs1285280336 924 dbSNP
rs1339075588 925 dbSNP
rs560649342 925 dbSNP
rs1333686063 933 dbSNP
rs1375791057 936 dbSNP
rs1399750097 937 dbSNP
rs903095933 946 dbSNP
rs138583305 958 dbSNP
rs1415920931 959 dbSNP
rs1163764240 961 dbSNP
rs1472375717 961 dbSNP
rs1383167765 964 dbSNP
rs1019829157 967 dbSNP
rs1457956681 975 dbSNP
rs1397583636 980 dbSNP
rs1304660316 983 dbSNP
rs1452804735 994 dbSNP
rs1291309090 999 dbSNP
rs1209756023 1005 dbSNP
rs1357853103 1005 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cuUAGGACCAAGACAGGGAGUGAUc 5'
            ||| |   | ||   ||||||| 
Target 5' uaAUCAU-AAUAUG---CUCACUAc 3'
 		5 - 25
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 3301.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 3301.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000330899.4 | 3UTR | ACUGUAAUCAUAAUAUGCUCACUACUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000330899.4 | 3UTR | ACUGUAAUCAUAAUAUGCUCACUACUUGCUCUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000330899.4 | 3UTR | UAAUCAUAAUAUGCUCACUACUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000330899.4 | 3UTR | AGUGAAGGACUGUAAUCAUAAUAUGCUCACUACUUGCUCUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000330899.4 | 3UTR | UAAUCAUAAUAUGCUCACUACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000330899.4 | 3UTR | UAAUCAUAAUAUGCUCACUACUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21687 Ependynoma primary tumors -0.252 2.2e-2 -0.268 1.6e-2 64 Click to see details
GSE42095 Differentiated embryonic stem cells 0.337 5.8e-2 0.268 1.1e-1 23 Click to see details
GSE38226 Liver fibrosis -0.337 6.8e-2 -0.213 1.8e-1 21 Click to see details
GSE28544 Breast cancer -0.301 7.6e-2 -0.338 5.3e-2 24 Click to see details
GSE19783 ER+ ER+ breast cancer -0.293 1.0e-1 -0.343 6.9e-2 20 Click to see details
GSE19536 Breast cancer -0.125 1.1e-1 -0.073 2.4e-1 100 Click to see details
GSE19783 ER- ER- breast cancer -0.135 1.2e-1 -0.034 3.8e-1 79 Click to see details
GSE26953 Aortic valvular endothelial cells 0.248 1.2e-1 0.307 7.2e-2 24 Click to see details
GSE19350 CNS germ cell tumors -0.323 1.5e-1 -0.231 2.4e-1 12 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.142 2.8e-1 -0.289 1.1e-1 20 Click to see details
GSE17498 Multiple myeloma 0.094 2.8e-1 0.104 2.6e-1 40 Click to see details
GSE32688 Pancreatic cancer -0.075 3.4e-1 -0.032 4.3e-1 32 Click to see details
GSE28260 Renal cortex and medulla -0.044 4.4e-1 -0.022 4.7e-1 13 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.008 4.8e-1 -0.053 4.0e-1 25 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.008 4.8e-1 -0.053 4.0e-1 25 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.008 4.8e-1 -0.053 4.0e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
63 hsa-miR-921 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT054764 ANGPTL1 angiopoietin like 1 3 1
MIRT066171 PIP4K2C phosphatidylinositol-5-phosphate 4-kinase type 2 gamma 2 2
MIRT069409 ZFYVE21 zinc finger FYVE-type containing 21 2 8
MIRT102284 DNAJB9 DnaJ heat shock protein family (Hsp40) member B9 2 4
MIRT107595 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 6
MIRT178618 HIAT1 major facilitator superfamily domain containing 14A 2 2
MIRT182407 TIPRL TOR signaling pathway regulator 2 4
MIRT186552 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT273662 HOXC8 homeobox C8 2 2
MIRT283191 C16ORF52 chromosome 16 open reading frame 52 2 2
MIRT284890 NFAT5 nuclear factor of activated T-cells 5 2 2
MIRT347670 LSM14A LSM14A, mRNA processing body assembly factor 2 2
MIRT400222 SLC35F6 solute carrier family 35 member F6 2 2
MIRT403517 ASPH aspartate beta-hydroxylase 2 2
MIRT442251 DCTN5 dynactin subunit 5 2 2
MIRT443023 SDR39U1 short chain dehydrogenase/reductase family 39U member 1 2 2
MIRT443097 RNF20 ring finger protein 20 2 2
MIRT444560 TRA2B transformer 2 beta homolog 2 2
MIRT445696 PRKG1 protein kinase, cGMP-dependent, type I 2 2
MIRT454084 TMEM209 transmembrane protein 209 2 2
MIRT455463 LYPLA2 lysophospholipase II 2 2
MIRT456653 TIFA TRAF interacting protein with forkhead associated domain 2 2
MIRT458147 LYRM4 LYR motif containing 4 2 6
MIRT467073 SRRD SRR1 domain containing 2 4
MIRT467245 SPPL2A signal peptide peptidase like 2A 2 2
MIRT468246 SFXN4 sideroflexin 4 2 2
MIRT471589 PAQR5 progestin and adipoQ receptor family member 5 2 19
MIRT476639 G2E3 G2/M-phase specific E3 ubiquitin protein ligase 2 2
MIRT482433 ADM adrenomedullin 2 10
MIRT486848 PERP PERP, TP53 apoptosis effector 2 6
MIRT489656 SHMT1 serine hydroxymethyltransferase 1 2 2
MIRT493441 KANSL1 KAT8 regulatory NSL complex subunit 1 2 6
MIRT493841 FOXN3 forkhead box N3 2 4
MIRT501378 RBFOX2 RNA binding protein, fox-1 homolog 2 2 10
MIRT509679 ATAD5 ATPase family, AAA domain containing 5 2 4
MIRT510280 MED28 mediator complex subunit 28 2 2
MIRT512221 ATXN3 ataxin 3 2 6
MIRT514030 BNIP2 BCL2 interacting protein 2 2 2
MIRT521375 RDX radixin 2 4
MIRT521444 RAD51 RAD51 recombinase 2 2
MIRT526055 CBR1 carbonyl reductase 1 2 2
MIRT528658 FUNDC2 FUN14 domain containing 2 2 2
MIRT529975 TNFAIP8L1 TNF alpha induced protein 8 like 1 2 2
MIRT544098 IPMK inositol polyphosphate multikinase 2 2
MIRT545579 SNRPA1 small nuclear ribonucleoprotein polypeptide A' 2 2
MIRT547424 MED4 mediator complex subunit 4 2 2
MIRT548955 CD2AP CD2 associated protein 2 2
MIRT549537 NDUFA6 NADH:ubiquinone oxidoreductase subunit A6 2 4
MIRT552550 ZFP36L2 ZFP36 ring finger protein like 2 2 4
MIRT554640 ROBO1 roundabout guidance receptor 1 2 2
MIRT564904 YTHDF1 YTH N6-methyladenosine RNA binding protein 1 2 2
MIRT565578 SLC6A8 solute carrier family 6 member 8 2 2
MIRT568312 BAG4 BCL2 associated athanogene 4 2 2
MIRT617891 PTCHD3 patched domain containing 3 2 2
MIRT621892 TAF13 TATA-box binding protein associated factor 13 2 2
MIRT642850 RNF135 ring finger protein 135 2 2
MIRT665395 WEE1 WEE1 G2 checkpoint kinase 2 2
MIRT697879 UBE2B ubiquitin conjugating enzyme E2 B 2 2
MIRT698492 THOC2 THO complex 2 2 2
MIRT701227 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT701872 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT707045 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT715216 NPVF neuropeptide VF precursor 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-921 Progesterone approved 5994 Microarray Breast cancer 22330642 2012 up-regulated
miR-921 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-921 Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-921 Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-921 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-921 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-mir-921 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-921 Androstenedione+Anastrozole resistant cell line (MCF-7)
hsa-mir-921 Cisplatin 5460033 NSC119875 approved sensitive cell line (KYSE)
hsa-mir-921 Fluorouracil 3385 NSC19893 approved sensitive cell line (OE19)
hsa-miR-921 Temozolomide 5394 NSC362856 approved sensitive cell line (U251)
hsa-miR-921 Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-921 Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-921 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-miR-921 Ethanol+Tamoxifen resistant cell line (LY2)
hsa-miR-921 Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-921 Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-921 Pegylated interferon alpha+Ribavirin sensitive tissue (chronic hepatitis C)
hsa-miR-921 Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-921 Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-921 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-921 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-921 Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR1)
hsa-miR-921 Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission