miRTarBase - #MIRT112198


—
pre-miRNA Information
pre-miRNA hsa-mir-3179-1   
Genomic Coordinates chr16: 14901508 - 14901591
Description Homo sapiens miR-3179-1 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-3179-2   
Genomic Coordinates chr16: 16300159 - 16300242
Description Homo sapiens miR-3179-2 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-3179-3   
Genomic Coordinates chr16: 18411894 - 18411977
Description Homo sapiens miR-3179-3 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-3179-4   
Genomic Coordinates chr16: 18494493 - 18494576
Description Homo sapiens miR-3179-4 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-3179
Sequence 52| AGAAGGGGUGAAAUUUAAACGU |73
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1351100204 1 dbSNP
rs1398613616 4 dbSNP
rs1340262765 20 dbSNP
rs1229893475 21 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol BTG2   
Synonyms APRO1, PC3, TIS21
Description BTG anti-proliferation factor 2
Transcript NM_006763   
Expression
Putative miRNA Targets on BTG2
3'UTR of BTG2
(miRNA target sites are highlighted)		 
>BTG2|NM_006763|3'UTR
   1 GCCCTTCCGCCCCCGCCCTGGGCGCCGCCGTGCTCATGCTGCCGTGACAACAGGCCACCACATACCTCAACCTGGGGAAC
  81 TGTATTTTTAAATGAAGAGCTATTTATATATATTATTTTTTTTTAAGAAAGGAGGAAAAGAAACCAAAAGTTTTTTTTAA
 161 GAAAAAAAATCCTTCAAGGGAGCTGCTTGGAAGTGGCCTCCCCAGGTGCCTTTGGAGAGAACTGTTGCGTGCTTGAGTCT
 241 GTGAGCCAGTGTCTGCCTATAGGAGGGGGAGCTGTTAGGGGGTAGACCTAGCCAAGGAGAAGTGGGAGACGTTTGGCTAG
 321 CACCCCAGGAAGATGTGAGAGGGAGCAAGCAAGGTTAGCAACTGTGAACAGAGAGGTCGGGATTTGCCCTGGGGGAGGAA
 401 GAGAGGCCAAGTTCAGAGCTCTCTGTCTCCCCCAGCCAGACACCTGCATCCCTGGCTCCTCTATTACTCAGGGGCATTCA
 481 TGCCTGGACTTAAACAATACTATGTTATCTTTTCTTTTATTTTTCTAATGAGGTCCTGGGCAGAGAGTGAAAAGGCCTCT
 561 CCTGATTCCTACTGTCCTAAGCTGCTTTTCTTGAAATCATGACTTGTTTCTAATTCTACCCTCAGGGGCCTGTAGATGTT
 641 GCTTTCCAGCCAGGAATCTAAAGCTTTGGGTTTTCTGAGGGGGGGGAGGAGGGAACTGGAGGTTATTGGGGTTAGGATGG
 721 AAGGGAACTCTGCACAAAACCTTTGCTTTGCTAGTGCTGCTTTGTGTGTATGTGTGGCAAATAATTTGGGGGTGATTTGC
 801 AATGAAATTTTGGGACCCAAAGAGTATCCACTGGGGATGTTTTTTGGCCAAAACTCTTCCTTTTGGAACCACATGAAAGT
 881 CTTGATGCTGCTGCCATGATCCCTTTGAGAGGTGGCTCAAAAGCTACAGGGAACTCCAGGTCCTTTATTACTGCCTTCTT
 961 TTCAAAAGCACAACTCTCCTCTAACCCTCCCCTCCCCCTTCCCTTCTGGTCGGGTCATAGAGCTACCGTATTTTCTAGGA
1041 CAAGAGTTCTCAGTCACTGTGCAATATGCCCCCTGGGTCCCAGGAGGGTCTGGAGGAAAACTGGCTATCAGAACCTCCTG
1121 ATGCCCTGGTGGGCTTAGGGAACCATCTCTCCTGCTCTCCTTGGGATGATGGCTGGCTAGTCAGCCTTGCATGTATTCCT
1201 TGGCTGAATGGGAGAGTGCCCCATGTTCTGCAAGACTACTTGGTATTCTTGTAGGGCCGACACTAAATAAAAGCCAAACC
1281 TTGGGCACTGTTTTTTCTCCCTGGTGCTCAGAGCACCTGTGGGAAAGGTTGCTGTCTGTCTCAGTACAATCCAAATTTGT
1361 CGTAGACTTGTGCAATATATACTGTTGTGGGTTGGAGAAAAGTGGAAAGCTACACTGGGAAGAAACTCCCTTCCTTCAAT
1441 TTCTCAGTGACATTGATGAGGGGTCCTCAAAAGACCTCGAGTTTCCCAAACCGAATCACCTTAAGAAGGACAGGGCTAGG
1521 GCATTTGGCCAGGATGGCCACCCTCCTGCTGTTGCCCCTTAGTGAGGAATCTTCACCCCACTTCCTCTACCCCCAGGTTC
1601 TCCTCCCCACAGCCAGTCCCCTTTCCTGGATTTCTAAACTGCTCAATTTTGACTCAAAGGTGCTATTTACCAAACACTCT
1681 CCCTACCCATTCCTGCCAGCTCTGCCTCCTTTTCAACTCTCCACATTTTGTATTGCCTTCCCAGACCTGCTTCCAGTCTT
1761 TATTGCTTTAAAGTTCACTTTGGGCCCACAGACCCAAGAGCTAATTTTCTGGTTTGTGGGTTGAAACAAAGCTGTGAATC
1841 ACTGCAGGCTGTGTTCTTGCATCTTGTCTGCAAACAGGTCCCTGCCTTTTTAGAAGCAGCCTCATGGTCTCATGCTTAAT
1921 CTTGTCTCTCTTCTCTTCTTTATGATGTTCACTTTAAAAACAACAAAACCCCTGAGCTGGACTGTTGAGCAGGCCTGTCT
2001 CTCCTATTAAGTAAAAATAAATAGTAGTAGTATGTTTGTAAGCTATTCTGACAGAAAAGACAAAGGTTACTAATTGTATG
2081 ATAGTGTTTTTATATGGAAGAATGTACAGCTTATGGACAAATGTACACCTTTTTGTTACTTTAATAAAAATGTAGTAGGA
2161 TAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ugcaaauuuaaAGUGGGGAAGa 5'
                     || ||||||| 
Target 5' taaccctccccTC-CCCCTTCc 3'
 982 - 1002 142.00 -11.90
2 
miRNA  3' ugcaaauuuAAAGUGGGGAAga 5'
                   | |::||||||  
Target 5' ccctcctgcTGTTGCCCCTTag 3'
 1541 - 1562 129.00 -9.40
3 
miRNA  3' ugcaaaUUUA-AAGU-GGG-GAAGa 5'
                :||| |||| ||| |||| 
Target 5' agtgagGAATCTTCACCCCACTTCc 3'
 1561 - 1585 128.00 -13.80
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31521048 5 COSMIC
COSN30150327 14 COSMIC
COSN30529015 25 COSMIC
COSN30151598 27 COSMIC
COSN31505873 33 COSMIC
COSN30153261 69 COSMIC
COSN25480150 97 COSMIC
COSN25447161 101 COSMIC
COSN26504475 111 COSMIC
COSN31769502 112 COSMIC
COSN18724448 125 COSMIC
COSN31595827 178 COSMIC
COSN26504601 190 COSMIC
COSN31769503 344 COSMIC
COSN31543119 515 COSMIC
COSN9057026 527 COSMIC
COSN24520822 672 COSMIC
COSN20095823 687 COSMIC
COSN21469439 717 COSMIC
COSN26585385 733 COSMIC
COSN28363909 846 COSMIC
COSN21538062 863 COSMIC
COSN19405058 959 COSMIC
COSN31769505 1024 COSMIC
COSN31541478 1069 COSMIC
COSN26249695 1114 COSMIC
COSN18723901 1139 COSMIC
COSN31769506 1229 COSMIC
COSN30538366 1281 COSMIC
COSN31514034 1362 COSMIC
COSN31960380 1363 COSMIC
COSN31542781 1444 COSMIC
COSN31556057 1528 COSMIC
COSN31514401 1616 COSMIC
COSN1427020 1987 COSMIC
COSN17183007 2003 COSMIC
COSN31522292 2017 COSMIC
COSN22877916 2031 COSMIC
COSN28742730 2051 COSMIC
COSN28742953 2055 COSMIC
COSN30545449 2083 COSMIC
COSN25648869 2157 COSMIC
rs538260231 840 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1342422747 1 dbSNP
rs1415494436 3 dbSNP
rs1292812622 8 dbSNP
rs369785815 9 dbSNP
rs769970472 9 dbSNP
rs1208400964 10 dbSNP
rs756195828 10 dbSNP
rs766409214 11 dbSNP
rs755200538 12 dbSNP
rs1252949151 14 dbSNP
rs201462115 15 dbSNP
rs778326561 16 dbSNP
rs747522944 17 dbSNP
rs1486481294 18 dbSNP
rs770448408 19 dbSNP
rs776081022 23 dbSNP
rs745407928 27 dbSNP
rs1173193600 28 dbSNP
rs543409078 30 dbSNP
rs1461802405 31 dbSNP
rs762803619 33 dbSNP
rs763854059 36 dbSNP
rs936449734 37 dbSNP
rs774313207 42 dbSNP
rs767547740 44 dbSNP
rs563817102 45 dbSNP
rs755110487 46 dbSNP
rs773541040 47 dbSNP
rs765548346 52 dbSNP
rs906436597 55 dbSNP
rs1199712110 59 dbSNP
rs1247926585 67 dbSNP
rs532470883 71 dbSNP
rs933030925 78 dbSNP
rs1051849698 82 dbSNP
rs140561243 86 dbSNP
rs1457094179 87 dbSNP
rs565056217 93 dbSNP
rs1176380139 95 dbSNP
rs963203697 105 dbSNP
rs1004884523 108 dbSNP
rs569803446 115 dbSNP
rs762792320 116 dbSNP
rs954227723 116 dbSNP
rs985410906 116 dbSNP
rs912533319 121 dbSNP
rs1162613918 125 dbSNP
rs1413585176 136 dbSNP
rs965616805 145 dbSNP
rs1175971162 151 dbSNP
rs1454970746 151 dbSNP
rs1411600226 152 dbSNP
rs1476640311 162 dbSNP
rs978272725 162 dbSNP
rs145883516 165 dbSNP
rs936847166 169 dbSNP
rs1440961715 171 dbSNP
rs1399264379 174 dbSNP
rs1053984478 179 dbSNP
rs1348328691 181 dbSNP
rs1296526375 182 dbSNP
rs916313721 186 dbSNP
rs547719210 188 dbSNP
rs1444862686 194 dbSNP
rs1363940035 196 dbSNP
rs1336331419 201 dbSNP
rs898672572 208 dbSNP
rs947729519 214 dbSNP
rs1373298742 225 dbSNP
rs1046110576 228 dbSNP
rs995631283 229 dbSNP
rs1033761366 230 dbSNP
rs758798143 246 dbSNP
rs1004806296 247 dbSNP
rs959428702 261 dbSNP
rs1342974852 262 dbSNP
rs1036248225 269 dbSNP
rs1420823240 275 dbSNP
rs1013646072 279 dbSNP
rs1025406868 280 dbSNP
rs1259624705 312 dbSNP
rs994680486 313 dbSNP
rs1027510113 318 dbSNP
rs966699402 322 dbSNP
rs978416154 323 dbSNP
rs1202139199 325 dbSNP
rs1032258304 331 dbSNP
rs1309235641 336 dbSNP
rs954117248 342 dbSNP
rs1227308001 345 dbSNP
rs1006904171 349 dbSNP
rs1294529446 350 dbSNP
rs1415039233 370 dbSNP
rs957890041 372 dbSNP
rs1193720570 379 dbSNP
rs1444801008 380 dbSNP
rs1355701317 385 dbSNP
rs764489531 386 dbSNP
rs965313920 393 dbSNP
rs921705144 398 dbSNP
rs1420145246 399 dbSNP
rs776568889 404 dbSNP
rs933084594 415 dbSNP
rs567527162 422 dbSNP
rs12063729 433 dbSNP
rs907540815 434 dbSNP
rs1175323760 438 dbSNP
rs1478797289 441 dbSNP
rs1481490113 456 dbSNP
rs924214392 462 dbSNP
rs757491327 464 dbSNP
rs549485940 467 dbSNP
rs1274536514 468 dbSNP
rs1233343089 479 dbSNP
rs781339681 480 dbSNP
rs989650667 483 dbSNP
rs12085417 488 dbSNP
rs898744550 489 dbSNP
rs1374525331 500 dbSNP
rs1293254474 509 dbSNP
rs1403237512 520 dbSNP
rs931502952 520 dbSNP
rs1414087234 529 dbSNP
rs1326719417 533 dbSNP
rs538341532 541 dbSNP
rs1161560915 543 dbSNP
rs927622295 556 dbSNP
rs1408464372 557 dbSNP
rs1190368386 560 dbSNP
rs1467112679 561 dbSNP
rs1362524690 573 dbSNP
rs1213848868 574 dbSNP
rs1401156879 576 dbSNP
rs1258373861 578 dbSNP
rs375702332 580 dbSNP
rs1036729864 582 dbSNP
rs1317100154 583 dbSNP
rs1338934969 586 dbSNP
rs895285769 594 dbSNP
rs756202846 600 dbSNP
rs1014091948 601 dbSNP
rs138492634 603 dbSNP
rs1345362987 604 dbSNP
rs1382893444 617 dbSNP
rs902551369 621 dbSNP
rs1290654666 624 dbSNP
rs1006935143 637 dbSNP
rs888907302 637 dbSNP
rs572300436 643 dbSNP
rs1452338551 645 dbSNP
rs1488947959 647 dbSNP
rs778779331 652 dbSNP
rs1217290640 661 dbSNP
rs1427800104 666 dbSNP
rs1259095055 669 dbSNP
rs1206353731 673 dbSNP
rs202052540 678 dbSNP
rs957924099 678 dbSNP
rs1255035741 679 dbSNP
rs373717932 679 dbSNP
rs397736594 679 dbSNP
rs573875025 679 dbSNP
rs5780160 679 dbSNP
rs761729330 679 dbSNP
rs766982614 679 dbSNP
rs1491142379 680 dbSNP
rs56048832 680 dbSNP
rs1382823313 681 dbSNP
rs373538301 681 dbSNP
rs974635442 681 dbSNP
rs1491495525 682 dbSNP
rs3795582 682 dbSNP
rs114151974 683 dbSNP
rs1194770520 684 dbSNP
rs1377981147 685 dbSNP
rs1185363200 686 dbSNP
rs200299376 687 dbSNP
rs78869403 688 dbSNP
rs554848532 689 dbSNP
rs1281527839 702 dbSNP
rs1477855717 707 dbSNP
rs1195557237 719 dbSNP
rs990116670 724 dbSNP
rs907617206 726 dbSNP
rs1253594206 728 dbSNP
rs567587943 734 dbSNP
rs1023812316 745 dbSNP
rs752497704 747 dbSNP
rs574754503 752 dbSNP
rs1420339586 766 dbSNP
rs1297635051 771 dbSNP
rs113918784 781 dbSNP
rs367900254 782 dbSNP
rs1359232067 785 dbSNP
rs973031183 793 dbSNP
rs1416893655 800 dbSNP
rs543820952 810 dbSNP
rs1356307587 813 dbSNP
rs1313315239 826 dbSNP
rs1340452648 840 dbSNP
rs538260231 840 dbSNP
rs1394327930 842 dbSNP
rs931576651 854 dbSNP
rs1330830373 869 dbSNP
rs940363937 880 dbSNP
rs187962637 881 dbSNP
rs545970390 887 dbSNP
rs971745609 889 dbSNP
rs1162123158 897 dbSNP
rs771948296 909 dbSNP
rs1232088075 910 dbSNP
rs920227831 912 dbSNP
rs1181611565 917 dbSNP
rs1300759292 924 dbSNP
rs1436437516 926 dbSNP
rs930578614 927 dbSNP
rs1055268117 928 dbSNP
rs1355252536 929 dbSNP
rs1050734473 943 dbSNP
rs888980781 948 dbSNP
rs1235193012 952 dbSNP
rs1240299840 954 dbSNP
rs1335806105 955 dbSNP
rs944538045 957 dbSNP
rs1284643147 975 dbSNP
rs895305020 976 dbSNP
rs949576195 979 dbSNP
rs866232134 980 dbSNP
rs76519638 982 dbSNP
rs901252679 987 dbSNP
rs1391925783 990 dbSNP
rs1323365327 991 dbSNP
rs1046951321 994 dbSNP
rs1417870753 999 dbSNP
rs1157651073 1002 dbSNP
rs866825510 1003 dbSNP
rs141109235 1005 dbSNP
rs1365946027 1009 dbSNP
rs1211551500 1011 dbSNP
rs527493467 1012 dbSNP
rs547581235 1013 dbSNP
rs1215708551 1030 dbSNP
rs1468967361 1046 dbSNP
rs893760446 1049 dbSNP
rs1450755806 1050 dbSNP
rs1192018006 1051 dbSNP
rs1353060644 1059 dbSNP
rs1281110570 1061 dbSNP
rs1011165573 1062 dbSNP
rs372059695 1073 dbSNP
rs561189406 1082 dbSNP
rs868624412 1091 dbSNP
rs1032362748 1095 dbSNP
rs893784024 1096 dbSNP
rs1442941508 1097 dbSNP
rs1158196119 1107 dbSNP
rs1394611879 1108 dbSNP
rs1316971359 1115 dbSNP
rs1398635080 1124 dbSNP
rs1386661423 1125 dbSNP
rs1159570530 1127 dbSNP
rs1454106010 1128 dbSNP
rs746844675 1134 dbSNP
rs1196065370 1137 dbSNP
rs529927417 1140 dbSNP
rs556563281 1141 dbSNP
rs954744107 1144 dbSNP
rs756143754 1146 dbSNP
rs969586109 1146 dbSNP
rs1385407406 1155 dbSNP
rs1333757543 1163 dbSNP
rs191529784 1166 dbSNP
rs1285200870 1177 dbSNP
rs16851280 1178 dbSNP
rs1346902406 1181 dbSNP
rs1447052069 1187 dbSNP
rs1034798235 1192 dbSNP
rs1236446426 1194 dbSNP
rs1368175842 1199 dbSNP
rs1307966125 1200 dbSNP
rs1314552842 1203 dbSNP
rs374313138 1209 dbSNP
rs11586635 1212 dbSNP
rs961837311 1225 dbSNP
rs1327904585 1226 dbSNP
rs973096507 1232 dbSNP
rs920279956 1233 dbSNP
rs879162712 1240 dbSNP
rs1175874302 1244 dbSNP
rs989693507 1251 dbSNP
rs1419398419 1252 dbSNP
rs565394831 1259 dbSNP
rs1476429420 1260 dbSNP
rs910451465 1263 dbSNP
rs1187531171 1267 dbSNP
rs1239774023 1275 dbSNP
rs1458428748 1281 dbSNP
rs764873286 1288 dbSNP
rs1178198891 1297 dbSNP
rs534900693 1308 dbSNP
rs60342861 1310 dbSNP
rs916830474 1314 dbSNP
rs1212670162 1320 dbSNP
rs1340875696 1327 dbSNP
rs1166142148 1329 dbSNP
rs1278220051 1331 dbSNP
rs538887336 1332 dbSNP
rs1353142674 1333 dbSNP
rs949610709 1335 dbSNP
rs373141560 1337 dbSNP
rs1173352752 1348 dbSNP
rs1401460490 1362 dbSNP
rs1046540553 1363 dbSNP
rs924082329 1380 dbSNP
rs924422721 1398 dbSNP
rs780900419 1399 dbSNP
rs1164264463 1400 dbSNP
rs935433642 1403 dbSNP
rs935417653 1404 dbSNP
rs1189891303 1406 dbSNP
rs1483458733 1422 dbSNP
rs1330187720 1429 dbSNP
rs893841088 1432 dbSNP
rs1370577976 1439 dbSNP
rs1397216438 1440 dbSNP
rs1439447292 1442 dbSNP
rs1258183729 1444 dbSNP
rs1232122716 1448 dbSNP
rs1332297469 1449 dbSNP
rs1312771332 1458 dbSNP
rs1228469632 1461 dbSNP
rs1011322751 1462 dbSNP
rs1296771709 1466 dbSNP
rs1045367507 1469 dbSNP
rs575103998 1471 dbSNP
rs1339874690 1474 dbSNP
rs1325375497 1475 dbSNP
rs367892990 1479 dbSNP
rs905432979 1487 dbSNP
rs150236063 1493 dbSNP
rs763532512 1494 dbSNP
rs1407016424 1500 dbSNP
rs1175230744 1506 dbSNP
rs537329168 1509 dbSNP
rs1035206494 1515 dbSNP
rs745825418 1516 dbSNP
rs993294068 1521 dbSNP
rs1466752168 1533 dbSNP
rs557364252 1543 dbSNP
rs1274440494 1546 dbSNP
rs1213773374 1552 dbSNP
rs764567961 1553 dbSNP
rs577164404 1555 dbSNP
rs1303325329 1561 dbSNP
rs1255549733 1578 dbSNP
rs1396815564 1579 dbSNP
rs751564630 1580 dbSNP
rs572194545 1586 dbSNP
rs1009172053 1588 dbSNP
rs1196394152 1593 dbSNP
rs1014771219 1598 dbSNP
rs751952792 1603 dbSNP
rs78959463 1605 dbSNP
rs961818211 1609 dbSNP
rs994546782 1612 dbSNP
rs965952000 1620 dbSNP
rs1477675831 1622 dbSNP
rs796923660 1623 dbSNP
rs924477815 1627 dbSNP
rs1452443977 1655 dbSNP
rs958398989 1656 dbSNP
rs1254381834 1661 dbSNP
rs138699312 1670 dbSNP
rs1197667329 1672 dbSNP
rs866592912 1678 dbSNP
rs916839540 1679 dbSNP
rs1302980947 1683 dbSNP
rs915295201 1684 dbSNP
rs546139031 1686 dbSNP
rs771868400 1696 dbSNP
rs982744230 1709 dbSNP
rs762091614 1718 dbSNP
rs34345774 1721 dbSNP
rs1045104382 1724 dbSNP
rs1302123747 1725 dbSNP
rs1381703378 1731 dbSNP
rs905172671 1732 dbSNP
rs1412865713 1742 dbSNP
rs924142453 1754 dbSNP
rs1003803880 1755 dbSNP
rs1360955063 1756 dbSNP
rs1056722020 1764 dbSNP
rs1432841192 1765 dbSNP
rs1379285094 1771 dbSNP
rs1176239506 1775 dbSNP
rs1340922361 1777 dbSNP
rs935447347 1779 dbSNP
rs74137610 1780 dbSNP
rs1258991917 1789 dbSNP
rs34050060 1793 dbSNP
rs915323112 1813 dbSNP
rs1195429330 1820 dbSNP
rs1804736 1827 dbSNP
rs994052335 1837 dbSNP
rs1257304172 1847 dbSNP
rs1209146587 1848 dbSNP
rs1027434552 1860 dbSNP
rs1293141846 1865 dbSNP
rs951899429 1877 dbSNP
rs1227253490 1878 dbSNP
rs1007239467 1898 dbSNP
rs932000782 1899 dbSNP
rs1050432580 1902 dbSNP
rs1312114494 1903 dbSNP
rs915452021 1905 dbSNP
rs1804735 1906 dbSNP
rs1804737 1910 dbSNP
rs76416255 1919 dbSNP
rs1303374688 1943 dbSNP
rs1036647023 1944 dbSNP
rs1370877624 1956 dbSNP
rs965650259 1957 dbSNP
rs1484693145 1973 dbSNP
rs1416695775 1978 dbSNP
rs117103442 1991 dbSNP
rs138896134 1994 dbSNP
rs750671916 1995 dbSNP
rs1195753538 2007 dbSNP
rs1488236757 2020 dbSNP
rs1027389725 2022 dbSNP
rs879123876 2022 dbSNP
rs1334526222 2028 dbSNP
rs955923031 2028 dbSNP
rs1291675011 2029 dbSNP
rs1185214618 2031 dbSNP
rs990378187 2031 dbSNP
rs1427684462 2034 dbSNP
rs1313116199 2035 dbSNP
rs1804734 2041 dbSNP
rs561049519 2045 dbSNP
rs1130691 2049 dbSNP
rs1013057121 2055 dbSNP
rs1394216968 2059 dbSNP
rs567153308 2059 dbSNP
rs1023988259 2060 dbSNP
rs971436989 2070 dbSNP
rs756366363 2076 dbSNP
rs1473545899 2081 dbSNP
rs780081453 2085 dbSNP
rs1369440413 2093 dbSNP
rs530047112 2096 dbSNP
rs1417914540 2105 dbSNP
rs1240568092 2106 dbSNP
rs1031668907 2115 dbSNP
rs1393991304 2119 dbSNP
rs956894363 2124 dbSNP
rs989637128 2127 dbSNP
rs1056739357 2129 dbSNP
rs915352873 2142 dbSNP
rs932074289 2151 dbSNP
rs986585315 2156 dbSNP
rs898056851 2158 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ugcaaauuuaaAGUGGGGAAGa 5'
                     || ||||||| 
Target 5' uaacccuccccUC-CCCCUUCc 3'
 		3 - 23
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177611. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_1 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Prostate Tissue
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRX1760597. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_C ...

- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.).

Article - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al.
- Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
CLIP-seq Support 1 for dataset GSM4903825
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / PID14_NS
Location of target site NM_006763 | 3UTR | AAAAGCACAACUCUCCUCUAACCCUCCCCUCCCCCUUCCCUUCUGGUCGGGUCAUAGAGCUACCGUAUUUUCUAGGACAAGAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161237
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_006763 | 3UTR | GCUGCUGCCAUGAUCCCUUUGAGAGGUGGCUCAAAAGCUACAGGGAACUCCAGGUCCUUUAUUACUGCCUUCUUUUCAAAAGCACAACUCUCCUCUAACCCUCCCCUCCCCCUUCCCUUCUGGUCGGGUCAUAGAGCUACCGUAUUUUCUAGGACAAGAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4903834
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_b
Location of target site NM_006763 | 3UTR | UCCCUUUGAGAGGUGGCUCAAAAGCUACAGGGAACUCCAGGUCCUUUAUUACUGCCUUCUUUUCAAAAGCACAACUCUCCUCUAACCCUCCCCUCCCCCUUCCCUUCUGGUCGGGUCAUAGAGCUACCGUAUUUUCUAGGACAAGAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM4903835
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_c
Location of target site NM_006763 | 3UTR | UGGCUCAAAAGCUACAGGGAACUCCAGGUCCUUUAUUACUGCCUUCUUUUCAAAAGCACAACUCUCCUCUAACCCUCCCCUCCCCCUUCCCUUCUGGUCGGGUCAUAGAGCUACCGUAUUUUCUAGGACAAGAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM4903836
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_a
Location of target site NM_006763 | 3UTR | UCCUUUAUUACUGCCUUCUUUUCAAAAGCACAACUCUCCUCUAACCCUCCCCUCCCCCUUCCCUUCUGGUCGGGUCAUAGAGCUACCGUAUUUUCUAGGACAAGAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM4903837
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_b
Location of target site NM_006763 | 3UTR | UGAGAGGUGGCUCAAAAGCUACAGGGAACUCCAGGUCCUUUAUUACUGCCUUCUUUUCAAAAGCACAACUCUCCUCUAACCCUCCCCUCCCCCUUCCCUUCUGGUCGGGUCAUAGAGCUACCGUAUUUUCUAGGACAAGAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM4903838
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_c
Location of target site NM_006763 | 3UTR | AUCCCUUUGAGAGGUGGCUCAAAAGCUACAGGGAACUCCAGGUCCUUUAUUACUGCCUUCUUUUCAAAAGCACAACUCUCCUCUAACCCUCCCCUCCCCCUUCCCUUCUGGUCGGGUCAUAGAGCUACCGUAUUUUCUAGGACAAGAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000290551.4 | 3UTR | UCUAACCCUCCCCUCCCCCUUCCCUUCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
Click to see details
Click to see details
133 hsa-miR-3179 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT102087 GIGYF1 GRB10 interacting GYF protein 1 2 4
MIRT110061 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 2 6
MIRT112198 BTG2 BTG anti-proliferation factor 2 2 2
MIRT117668 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT146657 MINK1 misshapen like kinase 1 2 2
MIRT175505 ZBTB33 zinc finger and BTB domain containing 33 2 4
MIRT180535 TXNIP thioredoxin interacting protein 2 2
MIRT190624 BCL2L2-PABPN1 BCL2L2-PABPN1 readthrough 2 2
MIRT190650 PABPN1 poly(A) binding protein nuclear 1 2 2
MIRT366902 NONO non-POU domain containing octamer binding 2 2
MIRT443554 ZFP3 ZFP3 zinc finger protein 2 2
MIRT445953 MLLT11 MLLT11, transcription factor 7 cofactor 2 2
MIRT446042 HMCN1 hemicentin 1 2 2
MIRT447968 MSH6 mutS homolog 6 2 2
MIRT448634 ONECUT1 one cut homeobox 1 2 2
MIRT449316 MRO maestro 2 2
MIRT451380 C19orf43 telomerase RNA component interacting RNase 2 2
MIRT451547 CIAPIN1 cytokine induced apoptosis inhibitor 1 2 2
MIRT451807 CDCA3 cell division cycle associated 3 2 4
MIRT451916 ILK integrin linked kinase 2 2
MIRT451938 TMPRSS5 transmembrane protease, serine 5 2 2
MIRT452189 KIAA1456 KIAA1456 2 2
MIRT452498 HMGXB3 HMG-box containing 3 2 2
MIRT452548 ZNF467 zinc finger protein 467 2 2
MIRT453844 SDK1 sidekick cell adhesion molecule 1 2 2
MIRT454515 ZFYVE27 zinc finger FYVE-type containing 27 2 2
MIRT455363 KDM5C lysine demethylase 5C 2 2
MIRT455455 EPB41L4B erythrocyte membrane protein band 4.1 like 4B 2 2
MIRT455628 PABPC1L2B poly(A) binding protein cytoplasmic 1 like 2B 2 10
MIRT455639 PABPC1L2A poly(A) binding protein cytoplasmic 1 like 2A 2 10
MIRT455690 GLO1 glyoxalase I 2 2
MIRT456300 ASH1L ASH1 like histone lysine methyltransferase 2 2
MIRT456784 MTHFSD methenyltetrahydrofolate synthetase domain containing 2 2
MIRT456819 PIGP phosphatidylinositol glycan anchor biosynthesis class P 2 2
MIRT457566 ZNF34 zinc finger protein 34 2 2
MIRT457604 IDS iduronate 2-sulfatase 2 2
MIRT458236 NXPH3 neurexophilin 3 2 2
MIRT458313 TNFAIP8L3 TNF alpha induced protein 8 like 3 2 2
MIRT458350 NOC2L NOC2 like nucleolar associated transcriptional repressor 2 2
MIRT458670 GPR35 G protein-coupled receptor 35 2 2
MIRT459675 VPS37C VPS37C, ESCRT-I subunit 2 2
MIRT461126 RAB36 RAB36, member RAS oncogene family 2 2
MIRT461918 NECAB3 N-terminal EF-hand calcium binding protein 3 2 2
MIRT462301 PPM1H protein phosphatase, Mg2+/Mn2+ dependent 1H 2 2
MIRT463520 ZBTB7B zinc finger and BTB domain containing 7B 2 2
MIRT464378 URM1 ubiquitin related modifier 1 2 2
MIRT464614 UBE4B ubiquitination factor E4B 2 2
MIRT464711 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 2
MIRT465520 PRICKLE4 prickle planar cell polarity protein 4 2 2
MIRT465974 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 2
MIRT466058 TMEM189 transmembrane protein 189 2 2
MIRT466548 TBL1XR1 transducin beta like 1 X-linked receptor 1 2 2
MIRT466647 TAGLN2 transgelin 2 2 2
MIRT467357 SP2 Sp2 transcription factor 2 2
MIRT468744 SDC2 syndecan 2 2 2
MIRT470244 PRRC2A proline rich coiled-coil 2A 2 2
MIRT471426 PDIA6 protein disulfide isomerase family A member 6 2 2
MIRT471732 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 2 2
MIRT472190 NHP2L1 small nuclear ribonucleoprotein 13 2 2
MIRT472450 NAV2 neuron navigator 2 2 6
MIRT474563 KLHDC3 kelch domain containing 3 2 2
MIRT474936 KCTD15 potassium channel tetramerization domain containing 15 2 2
MIRT475165 IP6K1 inositol hexakisphosphate kinase 1 2 2
MIRT475399 ICMT isoprenylcysteine carboxyl methyltransferase 2 4
MIRT475426 ICK intestinal cell kinase 2 2
MIRT477090 FAM168A family with sequence similarity 168 member A 2 2
MIRT478458 DAB2 DAB2, clathrin adaptor protein 2 2
MIRT478953 COX15 COX15, cytochrome c oxidase assembly homolog 2 2
MIRT480096 CALR calreticulin 2 2
MIRT481924 ANKRD33B ankyrin repeat domain 33B 2 2
MIRT483217 APOA1 apolipoprotein A1 2 6
MIRT483882 TGIF1 TGFB induced factor homeobox 1 2 2
MIRT483923 SPSB1 splA/ryanodine receptor domain and SOCS box containing 1 2 2
MIRT483942 LENG8 leukocyte receptor cluster member 8 2 4
MIRT484209 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT484512 SYT7 synaptotagmin 7 2 2
MIRT484709 RNF11 ring finger protein 11 2 2
MIRT485356 MYO1C myosin IC 2 4
MIRT485615 FOSL1 FOS like 1, AP-1 transcription factor subunit 2 4
MIRT486584 ZNF619 zinc finger protein 619 2 2
MIRT487013 C2orf82 chromosome 2 open reading frame 82 2 2
MIRT487621 C20orf96 chromosome 20 open reading frame 96 2 2
MIRT487801 GPR20 G protein-coupled receptor 20 2 4
MIRT488134 GPR107 G protein-coupled receptor 107 2 2
MIRT488773 FXYD1 FXYD domain containing ion transport regulator 1 2 2
MIRT488854 UBTF upstream binding transcription factor, RNA polymerase I 2 2
MIRT489783 GRINA glutamate ionotropic receptor NMDA type subunit associated protein 1 2 2
MIRT490102 FN3K fructosamine 3 kinase 2 2
MIRT490389 LHFPL3 LHFPL tetraspan subfamily member 3 2 2
MIRT490434 MYL9 myosin light chain 9 2 2
MIRT490451 GLUD1 glutamate dehydrogenase 1 2 2
MIRT490880 OSBP oxysterol binding protein 2 2
MIRT491037 ALPK3 alpha kinase 3 2 2
MIRT491250 HCN2 hyperpolarization activated cyclic nucleotide gated potassium and sodium channel 2 2 2
MIRT491748 SEMA3F semaphorin 3F 2 2
MIRT492235 SLC48A1 solute carrier family 48 member 1 2 2
MIRT492490 RAPGEF1 Rap guanine nucleotide exchange factor 1 2 2
MIRT492505 RANBP10 RAN binding protein 10 2 4
MIRT492773 PDGFB platelet derived growth factor subunit B 2 2
MIRT492922 NFAT5 nuclear factor of activated T-cells 5 2 2
MIRT493459 ITFG3 family with sequence similarity 234 member A 2 2
MIRT493654 HDLBP high density lipoprotein binding protein 2 2
MIRT494011 DUSP9 dual specificity phosphatase 9 2 2
MIRT499412 PLCG2 phospholipase C gamma 2 2 4
MIRT499552 C15orf43 telomere repeat binding bouquet formation protein 2 2 2
MIRT501836 NCOA2 nuclear receptor coactivator 2 2 2
MIRT501950 MAT2A methionine adenosyltransferase 2A 2 10
MIRT504066 KCTD12 potassium channel tetramerization domain containing 12 2 4
MIRT504509 PPP1R9B protein phosphatase 1 regulatory subunit 9B 2 2
MIRT508466 HOXB6 homeobox B6 2 4
MIRT512373 CPM carboxypeptidase M 2 2
MIRT513578 EVX1 even-skipped homeobox 1 2 2
MIRT517763 ZNF366 zinc finger protein 366 2 4
MIRT519773 ZNF354B zinc finger protein 354B 2 8
MIRT523568 GGCX gamma-glutamyl carboxylase 2 4
MIRT532802 CLDN11 claudin 11 2 2
MIRT544299 TSPYL1 TSPY like 1 2 2
MIRT544862 MYH2 myosin heavy chain 2 2 4
MIRT556731 KLHL15 kelch like family member 15 2 4
MIRT564347 AKR1B10 aldo-keto reductase family 1 member B10 2 2
MIRT568924 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 2
MIRT569012 CXorf36 chromosome X open reading frame 36 2 2
MIRT569256 FAM129B family with sequence similarity 129 member B 2 2
MIRT569591 PRELP proline and arginine rich end leucine rich repeat protein 2 2
MIRT569779 SAMD14 sterile alpha motif domain containing 14 2 2
MIRT570034 FAM228A family with sequence similarity 228 member A 2 2
MIRT573803 FRMPD4 FERM and PDZ domain containing 4 2 2
MIRT574190 ZNF264 zinc finger protein 264 2 2
MIRT576153 Hmox1 heme oxygenase 1 2 2
MIRT611311 CA8 carbonic anhydrase 8 2 4
MIRT673429 APAF1 apoptotic peptidase activating factor 1 2 2
MIRT674976 SH3BP2 SH3 domain binding protein 2 2 2
MIRT692712 MEAF6 MYST/Esa1 associated factor 6 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-3179 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-3179 Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-3179 Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-3179 Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-3179 Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-3179 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3179 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-3179 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)

Error report submission