| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-4731 |
| Genomic Coordinates | chr17: 15251627 - 15251696 |
| Description | Homo sapiens miR-4731 stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Mature miRNA Information | |||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-4731-5p | ||||||||||||
| Sequence | 10| UGCUGGGGGCCACAUGAGUGUG |31 | ||||||||||||
| Evidence | Experimental | ||||||||||||
| Experiments | Illumina | ||||||||||||
| SNPs in miRNA |
|
||||||||||||
| Putative Targets | |||||||||||||
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | RAB5B | ||||||||||||||||||||
| Synonyms | - | ||||||||||||||||||||
| Description | RAB5B, member RAS oncogene family | ||||||||||||||||||||
| Transcript | NM_002868 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on RAB5B | |||||||||||||||||||||
| 3'UTR of RAB5B (miRNA target sites are highlighted) |
>RAB5B|NM_002868|3'UTR 1 GGGGGTGGCTAGCAGCAAACAAGTATGGAGCTAGCACAAGAGCTAAGAAATAACCTCCATCCCTACCCCTCAGCACACAA 81 CCCCTACGGTAACAGCACACTGAGCCCTGGCTCCCAAGGGCTGCCTCCTGACAGCTCCGTCATGGCACTTTTTAACGCTT 161 CAGCAACAAACACCAGGCAGCTGTTGCCACTGGCCTCCTACCCCCTACTCTGGGGCTTGGGGGTCAACTCCCCCCAGGAC 241 TTACCTTCCAAAACAAACTTTCTTCACTTTGTATTATAGGTACAAGACAGCGACTTACGTATCTTTTCTCCTCCTCCCTA 321 GTGTTCCTCCCCATTTTTTCAGAAAACACTTCTGACTCCTGTCCCTTCCCCTTCTGCTTTTGGTCAGTCCCTGTTCTTGA 401 GCCTCTTTTCTCCTCTCCCCAGGATGCAGAAAGTGGTGAACCCAGGAACTGAGGAAGGAGGTTTCCAGTTCATTTACATT 481 AAGGGCCCTGGGGGAGAATAAAGCTCAGAGCAGGAGGGAGTAAGGAAACATTTCCTTTTTGTTTTTATTTGGTTGGAGTT 561 TCTCATATTTGAAAACATTGCGGTATCCATGATTTGGCCTTGTGGAGGGTGTTCCTAGGTAGAGGTGAGAATGGGGAGGC 641 AAGATCTCAGGCACCAGGCAGGAGGTGCCTTGTAAGCTAACTGGGCGGAGGTGGAGGTGCAGTGTCAACTGTGGCTCTGT 721 AACTCTTCAAAGGCCCAGTTTCCCCTCACGCAGCCTCTTAGGTAGCGTTTCCCCTAATCGTGGGGGTTGGACCCCAGAGT 801 CTTCCAAAGAATTTTCACTGGTTGCCTGCATCTTTGGCTCTGCTGTGATCTGATTGGAGGAGGGACAGTTTCTGGTACCC 881 ATCCTCTGATTTATACATATGCATTTTTTCCCCTCTGGCCTTTAGATGGCCTCAGCCCCAGCCACCATATACCCCTGCAG 961 TTTGCACTTTAATTGATGGTAGTTCAGTTGGGGTACTTGTTTTATGGAAGTTTTGATTGATTTACTTGCCCTCCCACCTT 1041 CTTTTTAATTCAATGAAATCTGAGGTTAATGCGAGGTTCGAGGAGAGGTTATAGATAAAACTACCAGTGGCAGCTACTCA 1121 AGTCCTATCTCCACTGTTAGCTTCCTCCAACTCTAATTATTAACCTATATTCTTGCCAAGCTAACTATTGACTATAGGTT 1201 TGCCTTTCCTGGAGAATTAATTGAGCAATTGAGGAGTGTCTCAGGATAGCACAGGCCAAGGTAGGGGAGTAAAAAGGAGG 1281 TCAGGCAAAAGGGAGGAGTTTTCTGTCCTTTCCCAGGTTTCACACTCAATTTGATATCCATTACCATGTCTTTTCTACTT 1361 CCTTGTAAATAGGTATGATCTTTATTCCCACTGTACAGTCTGTTCTATCCTCTGCCTCCCATCAGGCCCTGTTTCTTTGT 1441 TCCTTTGTTAATATCTTGAATTTAGTCCCTCCATCCTTAATCCCCCCATCCCTCCCCATCATGCAACCAGTGGTTTAATC 1521 CATGTACCAATAGGGGCTAGTACCACAGAGGCCTCCTGTGGTGCCCTCGTATCATACCACCTGTTCCTGTGGAGAGGGAA 1601 TGACCGGCACTGAAGGTACCTTACAACTGGCTCATATTATCAGAGGACCTTGGTCCTTTCTAAATCTCTAGTCTCTCTTC 1681 ATATCCTTCATCAGGTGTTTTAAGATGTCTCTGAGAAGCCATCAAGGCAAAAGAGAACTTTAAGTTCCTTGTTCCAGCCC 1761 GGAGTTTTGGGAAAGAAAGAAAGGAAAGGTCACAGTGACCTAGGATTGGAACCTTCCTGCCCTTTTGGCTTGCAGACTGC 1841 CTTCTATCCCAGAACAGCTGAGAAATCTATGAAGCTGAGATTCTGAAGGACCCAGCTTAGGTTCTTCCACTTAGGCCTCA 1921 ATTCCCTTCCTTTTCCAGGGGCAGCCTTAGTTCCCATGGCCCTGAAACACACACATTTCCCCCTTCCTTTCCCAGAAGCC 2001 ACTGGCCCCCCATAGCACCCAGTGCATCCTTTTTACAAGTGGAAGAACTAGGATGGCTTTCCAAAGTCTTCTAGAAATGA 2081 AGTTCTTTCTCTGTGCAGCTTTCCCCCTTGGAGCAGGAGTGAAGATGTTTCATTATCTTGGGCCTGGGAAACCACTTCCC 2161 CAGGCTTCTCCCTCCCCCCACCCCCATAGGAACAGGATTTGGCCTTAGCTTCTGGGCCTATCGGCTGCCTTCCCTCTACT 2241 TCCTACCACCTCTTCTGCCTTCCTTTGAGCTCTGTTGGGCTTGGGGATCTTAGTTTTCTTTTGTTTATTTCCCAGCTCAT 2321 TTTTTTCTTCTGGTCAGTTTTTTTAAGGGGGGGTGTTGTGGTTTTTTGTTTTTGTTTTGCTTCTGAGAAAGCATTTGCCT 2401 TTCTTCCTCTCCCAACATAACAATCGTGGTAACAGAATGCGACTGCTGATTTACCGATGTATTTAATGTAAGTAAAAAAA 2481 GGAAAAAAAGAAAAGGGCATTGGAGTGTTGCTTTTTTTTATTTTATTGTTATTATTATTATTATTTTTGCTATTTGTCAG 2561 GTACTAGGAATTTGGAAGAAAGGATACCCAGTAATGTTCTACTGAATCAGAAACACACCTTTCCCTGCATCTTGATACAT 2641 CTTTATTCCCTTTAATCTTTTCTTAAACATCTAGTTTAGAAAATAGCCCTTCTATTGCTATTTAATCACCCCTCTTCTAA 2721 GGCCACTAGATTGTTCATCAAATCAAACCCTATTATATCTTTTTAGGCCCTCTTAACAGAATGTATATGTGTAGGGTATG 2801 GTCTGTGGATCTTTGGGCCCACTGATCAGATTAGAGAGAGGGGTGCTATTTGAAGTAGTATACAAAAATGTATGTGCATA 2881 TTTCTTTTTTTTTTTTTAATTGAGACGGAGTCTCTGTCGCTAGCCTGGAGTACAGTGGCACGATCTTGGCTCACAGCAAT 2961 CTCCGCCTCCTGAGTTCAAGTGATTCTCCTGCCTCAGCCTCCTGAGTAGCTAGGATTACAGGCACGCACCAACACACCCA 3041 GCTAATTTTTGTATTTTTAGTAGAGACGGGGTTTCACCATGTTGGTCAGGCTGGTCTTGAACTCCTGACCTCGTGATCCA 3121 CCCACCTTGGCCTCCCAAAGTGCTGGGATTACGGGCGTGAGCCACTGCGCCCGGCCGTATGTGCATATTTCTAGGATCCA 3201 TTTCTATATGTTTCTCAAAGGGGTCCATGACCCAAAGGTTGAAAAACATCACTGAGTTAGTTTTCTTGTAGCTTCCACCT 3281 CAACGGGAAAATTTCCTCTGGATCTGCTCTTGACTCCTAGTGTACTTCAAACCCTTCAGTCCACCACAGTCTAAAGGTCG 3361 AGGGAAGGGAAATGAAATAGGATTATGTGTGGTTGCAGTAGGCTTTAAATTCCAAAGAATCTGAAGGTGGATAGGAAAGA 3441 GGACTGGTGCCAGACAAATCTGACATTCTAGGCCTGTCTCTGTCAACTTAACCAGCTGTGGCCTTGATCAAGTTAGTTAG 3521 TGCCTTCCGCCTCGTTTCTTCATCTGTAAAGTAAAAGCTGAAGATTAAGGTCAATTATGTAAAGTATGTGTGTCACACAA 3601 AAGTAGATGACACTATTAGGAAGGAGGCTTTTAGATAGTCCCTAACTGACTTCTCTGTATCTTCCTTTGGCTGAGACTTT 3681 TTTTTTTTTAGGTTGAAGCTCGCTTTCTCTCTCTCTCCCTCTTTCTCCCTCTCTCTCTCTCTCTCACTCTCTCTCTCTCC 3761 ATATATATATACATATATATATATATATATATTTTTTTTTTAACAACTGGTAGGATAGGTTGGGCATTAGCCTTCTTCAG 3841 TGATTTGATTGTATACAGATTGAAATCCTTTCCATTTCCAAACACTTAAGAGCCAAAGCCAACTTGCCAACTTTTCACTG 3921 TCGGTTCCCTTACCTTATATCTCTTGGTAATACCCCCCACCCCCGTTCCCTGATTCCTGGTAAAAGCTCTAGTTGGAGAG 4001 CCGAAAGGAAAGGAAATGATCTTTCAAAATTAAAGGTGAACACCTTCACTTAAACTGATTAAAATTGCAGCTCCACCGTC 4081 CGGCCTCTAGAGGGCAGTGTATGGATACATTTGTCCAGATTGGGGGACTAGGTTTGATAAATTTTGTCCTGCATCAAATG 4161 ACAAAAGGGTAATAGGAAATGTATTATATTTATGCCCCTTACTTTGAGATAAGAGACTACAACCTTCATACTTCGGGGTG 4241 TTAAGCTGCCATTGCTCTTGTTAAGGGGCAGTTTGTTTTTTAAGAGATGGGGTCTTGCTCTGTTGTCCAGGCTGGAGTGC 4321 AGTGCCGCGATCTTGGCTCAGTGCAACCTCGAACTCCTGGGCTTAAGCGATCCTCCCGCCTCAGCCTCCCGAGTACTGGG 4401 ACTACAGGCGTGTGCCACCAAGGGGCGATTATTATTTTTTTTTTCTACGCAAAATAAAAGACGGCTATTCA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
|---|---|---|---|---|---|---|---|
| miRNA:Target | ---- | ||||||
| Validation Method |
|
||||||
| Conditions | HEK293 | ||||||
| Location of target site | 3'UTR | ||||||
| Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
| miRNA-target interactions (Provided by authors) |
|
||||||
| Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
||||||
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 5869.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714646. RNA binding protein: AGO2. Condition:mildMNase
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
| Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 5869.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
| Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | TZM-bl |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
| Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
| Experimental Support 5 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | Prostate Tissue |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRX1760591. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_B
PAR-CLIP data was present in SRX1760597. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_C
PAR-CLIP data was present in SRX1760632. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_C
... - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.). |
| Article |
- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al. - Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
|
| CLIP-seq Support 1 for dataset GSM545214 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO3 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000553116.1 | 3UTR | CCACCAUAUACCCCUGCAGUUUGCACUUUAAU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM714644 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repA |
| Location of target site | ENST00000553116.1 | 3UTR | CCACCAUAUACCCCUGCAGUUUGCACUUUAAUUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM714646 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / mildMNase, repA |
| Location of target site | ENST00000553116.1 | 3UTR | CCACCAUAUACCCCUGCAGUUUGCACUUUAAUUGA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset GSM1065668 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_7 |
| Location of target site | ENST00000553116.1 | 3UTR | CCACCAUAUACCCCUGCAGUUUGCACUUUA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 5 for dataset GSM1462574 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | TZM-bl / TZM-bl ami BaL |
| Location of target site | ENST00000553116.1 | 3UTR | CCCCAGCCACCAUAUACCCCUGCAGUUUGCACUUUAAUUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||
|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||
|---|---|---|---|---|---|---|---|
|
321 hsa-miR-4731-5p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT081189 | MIDN | midnolin |  |
|
2 | 4 | ||||||
| MIRT113400 | RAB5B | RAB5B, member RAS oncogene family | |
|
2 | 8 | ||||||
| MIRT153789 | NCOA3 | nuclear receptor coactivator 3 | |
|
2 | 2 | ||||||
| MIRT169837 | GIGYF1 | GRB10 interacting GYF protein 1 | |
|
2 | 6 | ||||||
| MIRT441540 | CHD7 | chromodomain helicase DNA binding protein 7 | |
|
2 | 2 | ||||||
| MIRT443470 | ACPP | acid phosphatase, prostate | |
|
2 | 2 | ||||||
| MIRT443851 | RGS6 | regulator of G protein signaling 6 | |
|
2 | 2 | ||||||
| MIRT444416 | EMC1 | ER membrane protein complex subunit 1 | |
|
2 | 2 | ||||||
| MIRT444838 | PDE6D | phosphodiesterase 6D | |
|
2 | 2 | ||||||
| MIRT444997 | HRH1 | histamine receptor H1 | |
|
2 | 2 | ||||||
| MIRT446371 | THSD4 | thrombospondin type 1 domain containing 4 | |
|
2 | 2 | ||||||
| MIRT449696 | SLC10A3 | solute carrier family 10 member 3 | |
|
2 | 2 | ||||||
| MIRT451068 | PNMAL2 | paraneoplastic Ma antigen family member 8B | |
|
2 | 2 | ||||||
| MIRT451915 | ILK | integrin linked kinase | |
|
2 | 2 | ||||||
| MIRT452990 | CABP4 | calcium binding protein 4 | |
|
2 | 2 | ||||||
| MIRT458034 | MRPL12 | mitochondrial ribosomal protein L12 | |
|
2 | 2 | ||||||
| MIRT460780 | VPS37B | VPS37B, ESCRT-I subunit | |
|
2 | 2 | ||||||
| MIRT463916 | WNT3 | Wnt family member 3 | |
|
2 | 2 | ||||||
| MIRT465880 | TMEM43 | transmembrane protein 43 | |
|
2 | 4 | ||||||
| MIRT466317 | THRA | thyroid hormone receptor, alpha | |
|
2 | 2 | ||||||
| MIRT468696 | SEC22C | SEC22 homolog C, vesicle trafficking protein | |
|
2 | 4 | ||||||
| MIRT469129 | RNF126 | ring finger protein 126 | |
|
2 | 2 | ||||||
| MIRT472239 | NFIC | nuclear factor I C | |
|
2 | 2 | ||||||
| MIRT479647 | CD4 | CD4 molecule | |
|
2 | 2 | ||||||
| MIRT479734 | CCND1 | cyclin D1 | |
|
2 | 6 | ||||||
| MIRT479837 | CCDC86 | coiled-coil domain containing 86 | |
|
2 | 2 | ||||||
| MIRT483408 | SPATA6 | spermatogenesis associated 6 | |
|
2 | 4 | ||||||
| MIRT485972 | RTBDN | retbindin | |
|
2 | 2 | ||||||
| MIRT486614 | METTL6 | methyltransferase like 6 | |
|
2 | 2 | ||||||
| MIRT487814 | PER3 | period circadian clock 3 | |
|
2 | 2 | ||||||
| MIRT488586 | ST7L | suppression of tumorigenicity 7 like | |
|
2 | 2 | ||||||
| MIRT488673 | WWP2 | WW domain containing E3 ubiquitin protein ligase 2 | |
|
2 | 2 | ||||||
| MIRT490783 | PSMD3 | proteasome 26S subunit, non-ATPase 3 | |
|
2 | 2 | ||||||
| MIRT491356 | PEX6 | peroxisomal biogenesis factor 6 | |
|
2 | 2 | ||||||
| MIRT493539 | IGDCC3 | immunoglobulin superfamily DCC subclass member 3 | |
|
2 | 4 | ||||||
| MIRT493894 | FAM43A | family with sequence similarity 43 member A | |
|
2 | 4 | ||||||
| MIRT494664 | ARL8A | ADP ribosylation factor like GTPase 8A | |
|
2 | 2 | ||||||
| MIRT506353 | NUP50 | nucleoporin 50 | |
|
2 | 6 | ||||||
| MIRT508553 | CEP72 | centrosomal protein 72 | |
|
2 | 4 | ||||||
| MIRT508722 | ZNF682 | zinc finger protein 682 | |
|
2 | 4 | ||||||
| MIRT508811 | GPR155 | G protein-coupled receptor 155 | |
|
2 | 2 | ||||||
| MIRT509070 | MED18 | mediator complex subunit 18 | |
|
2 | 2 | ||||||
| MIRT509107 | BMP8B | bone morphogenetic protein 8b | |
|
2 | 6 | ||||||
| MIRT509198 | TTF2 | transcription termination factor 2 | |
|
2 | 2 | ||||||
| MIRT509308 | ZNF460 | zinc finger protein 460 | |
|
2 | 2 | ||||||
| MIRT509341 | ZNF708 | zinc finger protein 708 | |
|
2 | 2 | ||||||
| MIRT509381 | ASH2L | ASH2 like histone lysine methyltransferase complex subunit | |
|
2 | 6 | ||||||
| MIRT509722 | EFCAB11 | EF-hand calcium binding domain 11 | |
|
2 | 4 | ||||||
| MIRT510008 | CRISPLD2 | cysteine rich secretory protein LCCL domain containing 2 | |
|
2 | 4 | ||||||
| MIRT510067 | C12orf49 | chromosome 12 open reading frame 49 | |
|
2 | 6 | ||||||
| MIRT510179 | BCL2L2 | BCL2 like 2 | |
|
2 | 2 | ||||||
| MIRT511300 | KIAA1551 | KIAA1551 | |
|
2 | 2 | ||||||
| MIRT511531 | HMGB1 | high mobility group box 1 | |
|
2 | 6 | ||||||
| MIRT512018 | DNAJC10 | DnaJ heat shock protein family (Hsp40) member C10 | |
|
2 | 2 | ||||||
| MIRT514112 | SERF2 | small EDRK-rich factor 2 | |
|
2 | 2 | ||||||
| MIRT514296 | FXYD5 | FXYD domain containing ion transport regulator 5 | |
|
2 | 6 | ||||||
| MIRT514460 | FANCA | Fanconi anemia complementation group A | |
|
2 | 2 | ||||||
| MIRT515183 | CRCP | CGRP receptor component | |
|
2 | 2 | ||||||
| MIRT515290 | C4orf3 | chromosome 4 open reading frame 3 | |
|
2 | 2 | ||||||
| MIRT515528 | QRFPR | pyroglutamylated RFamide peptide receptor | |
|
2 | 4 | ||||||
| MIRT515553 | TMEM134 | transmembrane protein 134 | |
|
2 | 2 | ||||||
| MIRT515619 | ISY1 | ISY1 splicing factor homolog | |
|
2 | 2 | ||||||
| MIRT515707 | ZNF321P | zinc finger protein 321, pseudogene | |
|
2 | 2 | ||||||
| MIRT515988 | SLC30A2 | solute carrier family 30 member 2 | |
|
2 | 2 | ||||||
| MIRT516179 | POLR3A | RNA polymerase III subunit A | |
|
2 | 4 | ||||||
| MIRT516247 | BCAS4 | breast carcinoma amplified sequence 4 | |
|
2 | 4 | ||||||
| MIRT516505 | SYTL3 | synaptotagmin like 3 | |
|
2 | 4 | ||||||
| MIRT516586 | SPHAR | S-phase response (cyclin related) | |
|
2 | 2 | ||||||
| MIRT516697 | ODF2L | outer dense fiber of sperm tails 2 like | |
|
2 | 2 | ||||||
| MIRT516779 | PTRF | caveolae associated protein 1 | |
|
2 | 4 | ||||||
| MIRT516998 | COX19 | COX19, cytochrome c oxidase assembly factor | |
|
2 | 2 | ||||||
| MIRT517094 | CCDC30 | coiled-coil domain containing 30 | |
|
2 | 4 | ||||||
| MIRT517163 | SLC28A1 | solute carrier family 28 member 1 | |
|
2 | 2 | ||||||
| MIRT517234 | PRIM1 | DNA primase subunit 1 | |
|
2 | 4 | ||||||
| MIRT517602 | SAV1 | salvador family WW domain containing protein 1 | |
|
2 | 2 | ||||||
| MIRT517631 | ZNF491 | zinc finger protein 491 | |
|
2 | 2 | ||||||
| MIRT517734 | C1orf220 | chromosome 1 open reading frame 220 | |
|
2 | 2 | ||||||
| MIRT517748 | DIS3L | DIS3 like exosome 3'-5' exoribonuclease | |
|
2 | 4 | ||||||
| MIRT518005 | RPL4 | ribosomal protein L4 | |
|
2 | 4 | ||||||
| MIRT518184 | SLC27A4 | solute carrier family 27 member 4 | |
|
2 | 2 | ||||||
| MIRT518266 | LEAP2 | liver enriched antimicrobial peptide 2 | |
|
2 | 2 | ||||||
| MIRT518448 | KIF6 | kinesin family member 6 | |
|
2 | 2 | ||||||
| MIRT518679 | KCNMB1 | potassium calcium-activated channel subfamily M regulatory beta subunit 1 | |
|
2 | 2 | ||||||
| MIRT518834 | NEK8 | NIMA related kinase 8 | |
|
2 | 2 | ||||||
| MIRT519142 | C2orf49 | chromosome 2 open reading frame 49 | |
|
2 | 2 | ||||||
| MIRT519250 | PLA2G12A | phospholipase A2 group XIIA | |
|
2 | 2 | ||||||
| MIRT519369 | RBM28 | RNA binding motif protein 28 | |
|
2 | 2 | ||||||
| MIRT519410 | KCNA7 | potassium voltage-gated channel subfamily A member 7 | |
|
2 | 4 | ||||||
| MIRT519495 | MAPK13 | mitogen-activated protein kinase 13 | |
|
2 | 2 | ||||||
| MIRT520061 | YIPF4 | Yip1 domain family member 4 | |
|
2 | 2 | ||||||
| MIRT520132 | WSB1 | WD repeat and SOCS box containing 1 | |
|
2 | 2 | ||||||
| MIRT520289 | UBXN2A | UBX domain protein 2A | |
|
2 | 2 | ||||||
| MIRT520433 | TTLL12 | tubulin tyrosine ligase like 12 | |
|
2 | 2 | ||||||
| MIRT520553 | TNRC6B | trinucleotide repeat containing 6B | |
|
2 | 2 | ||||||
| MIRT520764 | TCF23 | transcription factor 23 | |
|
2 | 2 | ||||||
| MIRT520806 | TAOK1 | TAO kinase 1 | |
|
2 | 2 | ||||||
| MIRT520874 | STX17 | syntaxin 17 | |
|
2 | 2 | ||||||
| MIRT520986 | SOCS5 | suppressor of cytokine signaling 5 | |
|
2 | 2 | ||||||
| MIRT521077 | SLC25A15 | solute carrier family 25 member 15 | |
|
2 | 2 | ||||||
| MIRT521165 | SDHAF1 | succinate dehydrogenase complex assembly factor 1 | |
|
2 | 2 | ||||||
| MIRT521213 | SBNO1 | strawberry notch homolog 1 | |
|
2 | 2 | ||||||
| MIRT521485 | RAB4A | RAB4A, member RAS oncogene family | |
|
2 | 2 | ||||||
| MIRT521638 | PROSC | pyridoxal phosphate binding protein | |
|
2 | 2 | ||||||
| MIRT522151 | NR2F6 | nuclear receptor subfamily 2 group F member 6 | |
|
2 | 4 | ||||||
| MIRT522300 | NKAP | NFKB activating protein | |
|
2 | 2 | ||||||
| MIRT522445 | MOB4 | MOB family member 4, phocein | |
|
2 | 2 | ||||||
| MIRT522493 | MFN1 | mitofusin 1 | |
|
2 | 2 | ||||||
| MIRT522877 | KHSRP | KH-type splicing regulatory protein | |
|
2 | 2 | ||||||
| MIRT523059 | HYPK | huntingtin interacting protein K | |
|
2 | 2 | ||||||
| MIRT523095 | HSPE1-MOB4 | HSPE1-MOB4 readthrough | |
|
2 | 2 | ||||||
| MIRT523577 | GGA2 | golgi associated, gamma adaptin ear containing, ARF binding protein 2 | |
|
2 | 2 | ||||||
| MIRT523634 | FOXK1 | forkhead box K1 | |
|
2 | 4 | ||||||
| MIRT524231 | DCTN6 | dynactin subunit 6 | |
|
2 | 2 | ||||||
| MIRT524266 | CYCS | cytochrome c, somatic | |
|
2 | 2 | ||||||
| MIRT524367 | CREB1 | cAMP responsive element binding protein 1 | |
|
2 | 2 | ||||||
| MIRT524430 | CNKSR3 | CNKSR family member 3 | |
|
2 | 2 | ||||||
| MIRT524557 | CASP16 | caspase 16, pseudogene | |
|
2 | 2 | ||||||
| MIRT524585 | CALCOCO2 | calcium binding and coiled-coil domain 2 | |
|
2 | 2 | ||||||
| MIRT524955 | AGO3 | argonaute 3, RISC catalytic component | |
|
2 | 2 | ||||||
| MIRT531856 | MAP2K2 | mitogen-activated protein kinase kinase 2 | |
|
2 | 2 | ||||||
| MIRT541995 | MYO1C | myosin IC | |
|
2 | 2 | ||||||
| MIRT542247 | HSPA4L | heat shock protein family A (Hsp70) member 4 like | |
|
2 | 2 | ||||||
| MIRT542601 | YOD1 | YOD1 deubiquitinase | |
|
2 | 2 | ||||||
| MIRT545238 | ZFAND3 | zinc finger AN1-type containing 3 | |
|
2 | 2 | ||||||
| MIRT552183 | F2RL3 | F2R like thrombin or trypsin receptor 3 | |
|
2 | 2 | ||||||
| MIRT553520 | TMEM245 | transmembrane protein 245 | |
|
2 | 2 | ||||||
| MIRT554430 | SAMD8 | sterile alpha motif domain containing 8 | |
|
2 | 2 | ||||||
| MIRT559138 | BTF3L4 | basic transcription factor 3 like 4 | |
|
2 | 4 | ||||||
| MIRT564062 | CDT1 | chromatin licensing and DNA replication factor 1 | |
|
2 | 2 | ||||||
| MIRT564857 | ZBED3 | zinc finger BED-type containing 3 | |
|
2 | 2 | ||||||
| MIRT565382 | TGOLN2 | trans-golgi network protein 2 | |
|
2 | 2 | ||||||
| MIRT568952 | RUNX3 | runt related transcription factor 3 | |
|
2 | 2 | ||||||
| MIRT568983 | CACNA1C | calcium voltage-gated channel subunit alpha1 C | |
|
2 | 2 | ||||||
| MIRT569255 | FAM129B | family with sequence similarity 129 member B | |
|
2 | 2 | ||||||
| MIRT570199 | RAP1GAP2 | RAP1 GTPase activating protein 2 | |
|
2 | 2 | ||||||
| MIRT570913 | PPFIA4 | PTPRF interacting protein alpha 4 | |
|
2 | 2 | ||||||
| MIRT571084 | ZNF670 | zinc finger protein 670 | |
|
2 | 2 | ||||||
| MIRT571456 | YKT6 | YKT6 v-SNARE homolog | |
|
2 | 2 | ||||||
| MIRT574233 | DMRT2 | doublesex and mab-3 related transcription factor 2 | |
|
2 | 2 | ||||||
| MIRT608730 | MYH9 | myosin heavy chain 9 | |
|
2 | 2 | ||||||
| MIRT610109 | IL17REL | interleukin 17 receptor E like | |
|
2 | 2 | ||||||
| MIRT614235 | WDR53 | WD repeat domain 53 | |
|
2 | 4 | ||||||
| MIRT626199 | PNRC1 | proline rich nuclear receptor coactivator 1 | |
|
2 | 4 | ||||||
| MIRT626325 | LRTOMT | leucine rich transmembrane and O-methyltransferase domain containing | |
|
2 | 2 | ||||||
| MIRT626381 | BBS1 | Bardet-Biedl syndrome 1 | |
|
2 | 2 | ||||||
| MIRT627164 | ZNF48 | zinc finger protein 48 | |
|
2 | 2 | ||||||
| MIRT633098 | CBX5 | chromobox 5 | |
|
2 | 2 | ||||||
| MIRT642246 | PAK4 | p21 (RAC1) activated kinase 4 | |
|
2 | 2 | ||||||
| MIRT643882 | IMP4 | IMP4, U3 small nucleolar ribonucleoprotein | |
|
2 | 2 | ||||||
| MIRT644837 | SEC14L4 | SEC14 like lipid binding 4 | |
|
2 | 2 | ||||||
| MIRT645189 | POLR3F | RNA polymerase III subunit F | |
|
2 | 4 | ||||||
| MIRT645781 | FFAR4 | free fatty acid receptor 4 | |
|
2 | 2 | ||||||
| MIRT647144 | CYP27C1 | cytochrome P450 family 27 subfamily C member 1 | |
|
2 | 2 | ||||||
| MIRT647273 | CHST6 | carbohydrate sulfotransferase 6 | |
|
2 | 2 | ||||||
| MIRT648743 | FAM46B | family with sequence similarity 46 member B | |
|
2 | 2 | ||||||
| MIRT649204 | KIAA1715 | lunapark, ER junction formation factor | |
|
2 | 2 | ||||||
| MIRT649859 | WDR12 | WD repeat domain 12 | |
|
2 | 2 | ||||||
| MIRT650814 | PNPLA3 | patatin like phospholipase domain containing 3 | |
|
2 | 2 | ||||||
| MIRT659537 | CHCHD5 | coiled-coil-helix-coiled-coil-helix domain containing 5 | |
|
2 | 2 | ||||||
| MIRT664212 | LSM3 | LSM3 homolog, U6 small nuclear RNA and mRNA degradation associated | |
|
2 | 2 | ||||||
| MIRT664373 | CYB5A | cytochrome b5 type A | |
|
2 | 2 | ||||||
| MIRT667395 | MOB1B | MOB kinase activator 1B | |
|
2 | 2 | ||||||
| MIRT669465 | ATL3 | atlastin GTPase 3 | |
|
2 | 2 | ||||||
| MIRT670556 | SHISA2 | shisa family member 2 | |
|
2 | 2 | ||||||
| MIRT673104 | MFSD2A | major facilitator superfamily domain containing 2A | |
|
2 | 2 | ||||||
| MIRT679350 | LRG1 | leucine rich alpha-2-glycoprotein 1 | |
|
2 | 2 | ||||||
| MIRT680354 | GATAD1 | GATA zinc finger domain containing 1 | |
|
2 | 4 | ||||||
| MIRT680680 | ZNF785 | zinc finger protein 785 | |
|
2 | 2 | ||||||
| MIRT680759 | WDR73 | WD repeat domain 73 | |
|
2 | 2 | ||||||
| MIRT681392 | RMND1 | required for meiotic nuclear division 1 homolog | |
|
2 | 2 | ||||||
| MIRT681687 | ABI2 | abl interactor 2 | |
|
2 | 2 | ||||||
| MIRT681817 | N4BP2L2 | NEDD4 binding protein 2 like 2 | |
|
2 | 2 | ||||||
| MIRT682314 | RAB42 | RAB42, member RAS oncogene family | |
|
2 | 2 | ||||||
| MIRT683308 | C19orf40 | Fanconi anemia core complex associated protein 24 | |
1 | 1 | |||||||
| MIRT683374 | ESR2 | estrogen receptor 2 | |
|
2 | 2 | ||||||
| MIRT683466 | CCS | copper chaperone for superoxide dismutase | |
|
2 | 2 | ||||||
| MIRT683481 | ZNF7 | zinc finger protein 7 | |
|
2 | 2 | ||||||
| MIRT683514 | C11orf54 | chromosome 11 open reading frame 54 | |
|
2 | 2 | ||||||
| MIRT683860 | OCIAD1 | OCIA domain containing 1 | |
|
2 | 2 | ||||||
| MIRT683926 | SLC43A3 | solute carrier family 43 member 3 | |
|
2 | 2 | ||||||
| MIRT683935 | MYLK3 | myosin light chain kinase 3 | |
|
2 | 2 | ||||||
| MIRT684068 | TLR7 | toll like receptor 7 | |
|
2 | 2 | ||||||
| MIRT684120 | CEP104 | centrosomal protein 104 | |
|
2 | 2 | ||||||
| MIRT684192 | MSRB2 | methionine sulfoxide reductase B2 | |
|
2 | 2 | ||||||
| MIRT684343 | IFIT3 | interferon induced protein with tetratricopeptide repeats 3 | |
|
2 | 2 | ||||||
| MIRT684480 | GPR137B | G protein-coupled receptor 137B | |
|
2 | 2 | ||||||
| MIRT684565 | ORAI2 | ORAI calcium release-activated calcium modulator 2 | |
|
2 | 2 | ||||||
| MIRT684608 | GTF2IRD2B | GTF2I repeat domain containing 2B | |
|
2 | 2 | ||||||
| MIRT684643 | PDE4C | phosphodiesterase 4C | |
|
2 | 2 | ||||||
| MIRT684700 | LRRD1 | leucine rich repeats and death domain containing 1 | |
|
2 | 2 | ||||||
| MIRT684735 | DNAJB13 | DnaJ heat shock protein family (Hsp40) member B13 | |
|
2 | 2 | ||||||
| MIRT684911 | CD28 | CD28 molecule | |
|
2 | 2 | ||||||
| MIRT685024 | MRI1 | methylthioribose-1-phosphate isomerase 1 | |
|
2 | 2 | ||||||
| MIRT685186 | DCTN5 | dynactin subunit 5 | |
|
2 | 2 | ||||||
| MIRT685234 | F2RL1 | F2R like trypsin receptor 1 | |
|
2 | 2 | ||||||
| MIRT685303 | ASB16 | ankyrin repeat and SOCS box containing 16 | |
|
2 | 2 | ||||||
| MIRT685345 | CCL5 | C-C motif chemokine ligand 5 | |
|
2 | 2 | ||||||
| MIRT685553 | TXK | TXK tyrosine kinase | |
|
2 | 2 | ||||||
| MIRT685570 | KCNK6 | potassium two pore domain channel subfamily K member 6 | |
|
2 | 2 | ||||||
| MIRT685651 | C11orf1 | chromosome 11 open reading frame 1 | |
|
2 | 2 | ||||||
| MIRT685697 | BHMT2 | betaine--homocysteine S-methyltransferase 2 | |
|
2 | 2 | ||||||
| MIRT685731 | C12orf65 | chromosome 12 open reading frame 65 | |
|
2 | 2 | ||||||
| MIRT685873 | RTN2 | reticulon 2 | |
|
2 | 2 | ||||||
| MIRT685937 | PTGIS | prostaglandin I2 synthase | |
|
2 | 2 | ||||||
| MIRT686095 | TNIP3 | TNFAIP3 interacting protein 3 | |
|
2 | 2 | ||||||
| MIRT686147 | HS3ST1 | heparan sulfate-glucosamine 3-sulfotransferase 1 | |
|
2 | 2 | ||||||
| MIRT686271 | WWC1 | WW and C2 domain containing 1 | |
|
2 | 2 | ||||||
| MIRT686307 | VPS53 | VPS53, GARP complex subunit | |
|
2 | 2 | ||||||
| MIRT686349 | USP15 | ubiquitin specific peptidase 15 | |
|
2 | 2 | ||||||
| MIRT686377 | UBE2V2 | ubiquitin conjugating enzyme E2 V2 | |
|
2 | 2 | ||||||
| MIRT686431 | LINC00598 | long intergenic non-protein coding RNA 598 | |
|
2 | 2 | ||||||
| MIRT686477 | TRIOBP | TRIO and F-actin binding protein | |
|
2 | 2 | ||||||
| MIRT686515 | TRAF3IP2 | TRAF3 interacting protein 2 | |
|
2 | 2 | ||||||
| MIRT686682 | TIMM10 | translocase of inner mitochondrial membrane 10 | |
|
2 | 2 | ||||||
| MIRT686818 | SLC7A11 | solute carrier family 7 member 11 | |
|
2 | 2 | ||||||
| MIRT686904 | SGTB | small glutamine rich tetratricopeptide repeat containing beta | |
|
2 | 2 | ||||||
| MIRT686974 | SERINC1 | serine incorporator 1 | |
|
2 | 2 | ||||||
| MIRT687035 | RNF115 | ring finger protein 115 | |
|
2 | 2 | ||||||
| MIRT687067 | RABGAP1L | RAB GTPase activating protein 1 like | |
|
2 | 2 | ||||||
| MIRT687240 | PDHB | pyruvate dehydrogenase E1 beta subunit | |
|
2 | 2 | ||||||
| MIRT687494 | NFATC2IP | nuclear factor of activated T-cells 2 interacting protein | |
|
2 | 2 | ||||||
| MIRT687591 | MANEAL | mannosidase endo-alpha like | |
|
2 | 2 | ||||||
| MIRT687635 | LRIF1 | ligand dependent nuclear receptor interacting factor 1 | |
|
2 | 2 | ||||||
| MIRT687673 | LMBR1L | limb development membrane protein 1 like | |
|
2 | 2 | ||||||
| MIRT687849 | ISCA2 | iron-sulfur cluster assembly 2 | |
|
2 | 2 | ||||||
| MIRT687918 | HOOK3 | hook microtubule tethering protein 3 | |
|
2 | 2 | ||||||
| MIRT687974 | GTF2IRD2 | GTF2I repeat domain containing 2 | |
|
2 | 2 | ||||||
| MIRT688105 | GK5 | glycerol kinase 5 (putative) | |
|
2 | 2 | ||||||
| MIRT688115 | GEMIN8 | gem nuclear organelle associated protein 8 | |
|
2 | 2 | ||||||
| MIRT688148 | GABPB1 | GA binding protein transcription factor beta subunit 1 | |
|
2 | 2 | ||||||
| MIRT688263 | FAM213A | family with sequence similarity 213 member A | |
|
2 | 2 | ||||||
| MIRT688456 | DNAJB4 | DnaJ heat shock protein family (Hsp40) member B4 | |
|
2 | 2 | ||||||
| MIRT688497 | DDI2 | DNA damage inducible 1 homolog 2 | |
|
2 | 2 | ||||||
| MIRT688558 | DCAF16 | DDB1 and CUL4 associated factor 16 | |
|
2 | 2 | ||||||
| MIRT688668 | CPT1A | carnitine palmitoyltransferase 1A | |
|
2 | 2 | ||||||
| MIRT689057 | AGMAT | agmatinase | |
|
2 | 2 | ||||||
| MIRT689075 | ADO | 2-aminoethanethiol dioxygenase | |
|
2 | 2 | ||||||
| MIRT689108 | ZBTB25 | zinc finger and BTB domain containing 25 | |
|
2 | 2 | ||||||
| MIRT689161 | ZNF665 | zinc finger protein 665 | |
|
2 | 2 | ||||||
| MIRT689788 | GTF2H3 | general transcription factor IIH subunit 3 | |
|
2 | 2 | ||||||
| MIRT689835 | HIST1H2BJ | histone cluster 1 H2B family member j | |
|
2 | 2 | ||||||
| MIRT690061 | MBD1 | methyl-CpG binding domain protein 1 | |
|
2 | 2 | ||||||
| MIRT690727 | IRAK4 | interleukin 1 receptor associated kinase 4 | |
|
2 | 2 | ||||||
| MIRT690974 | ZNF578 | zinc finger protein 578 | |
|
2 | 2 | ||||||
| MIRT691066 | NUGGC | nuclear GTPase, germinal center associated | |
|
2 | 2 | ||||||
| MIRT691315 | KIAA1841 | KIAA1841 | |
|
2 | 2 | ||||||
| MIRT691485 | FOXRED2 | FAD dependent oxidoreductase domain containing 2 | |
|
2 | 2 | ||||||
| MIRT691568 | CCDC125 | coiled-coil domain containing 125 | |
|
2 | 2 | ||||||
| MIRT691601 | IPP | intracisternal A particle-promoted polypeptide | |
|
2 | 2 | ||||||
| MIRT692059 | ACOT9 | acyl-CoA thioesterase 9 | |
|
2 | 2 | ||||||
| MIRT692099 | CXorf38 | chromosome X open reading frame 38 | |
|
2 | 4 | ||||||
| MIRT692311 | RFK | riboflavin kinase | |
|
2 | 2 | ||||||
| MIRT692371 | LY6G5B | lymphocyte antigen 6 family member G5B | |
|
2 | 2 | ||||||
| MIRT692432 | METTL8 | methyltransferase like 8 | |
|
2 | 2 | ||||||
| MIRT692468 | APEX2 | apurinic/apyrimidinic endodeoxyribonuclease 2 | |
|
2 | 2 | ||||||
| MIRT692532 | PARD3 | par-3 family cell polarity regulator | |
|
2 | 2 | ||||||
| MIRT692594 | GDF5OS | growth differentiation factor 5 opposite strand | |
|
2 | 2 | ||||||
| MIRT692776 | SYNPO2L | synaptopodin 2 like | |
|
2 | 2 | ||||||
| MIRT692810 | C1orf50 | chromosome 1 open reading frame 50 | |
|
2 | 2 | ||||||
| MIRT692868 | RBM41 | RNA binding motif protein 41 | |
|
2 | 2 | ||||||
| MIRT693131 | THEM4 | thioesterase superfamily member 4 | |
|
2 | 2 | ||||||
| MIRT693313 | TRIM58 | tripartite motif containing 58 | |
|
2 | 2 | ||||||
| MIRT693497 | MOB3A | MOB kinase activator 3A | |
|
2 | 2 | ||||||
| MIRT694101 | ZNF446 | zinc finger protein 446 | |
|
2 | 2 | ||||||
| MIRT694173 | POLM | DNA polymerase mu | |
|
2 | 2 | ||||||
| MIRT694186 | ZNF347 | zinc finger protein 347 | |
|
2 | 2 | ||||||
| MIRT694444 | TNFAIP8L1 | TNF alpha induced protein 8 like 1 | |
|
2 | 2 | ||||||
| MIRT694653 | C14orf119 | chromosome 14 open reading frame 119 | |
|
2 | 2 | ||||||
| MIRT694802 | STX4 | syntaxin 4 | |
|
2 | 2 | ||||||
| MIRT694922 | ANKS4B | ankyrin repeat and sterile alpha motif domain containing 4B | |
|
2 | 2 | ||||||
| MIRT695174 | SLC25A33 | solute carrier family 25 member 33 | |
|
2 | 2 | ||||||
| MIRT695305 | PIGO | phosphatidylinositol glycan anchor biosynthesis class O | |
|
2 | 4 | ||||||
| MIRT695656 | MAN2B2 | mannosidase alpha class 2B member 2 | |
|
2 | 2 | ||||||
| MIRT695823 | ABCG8 | ATP binding cassette subfamily G member 8 | |
|
2 | 2 | ||||||
| MIRT695964 | EIF2B2 | eukaryotic translation initiation factor 2B subunit beta | |
|
2 | 2 | ||||||
| MIRT696174 | GNB5 | G protein subunit beta 5 | |
|
2 | 2 | ||||||
| MIRT696433 | SUGP1 | SURP and G-patch domain containing 1 | |
|
2 | 2 | ||||||
| MIRT696610 | CRIPT | CXXC repeat containing interactor of PDZ3 domain | |
|
2 | 2 | ||||||
| MIRT696854 | UBOX5 | U-box domain containing 5 | |
|
2 | 2 | ||||||
| MIRT696896 | C14orf105 | coiled-coil domain containing 198 | |
|
2 | 2 | ||||||
| MIRT697382 | ZMAT3 | zinc finger matrin-type 3 | |
|
2 | 2 | ||||||
| MIRT697529 | ZBTB46 | zinc finger and BTB domain containing 46 | |
|
2 | 2 | ||||||
| MIRT697973 | TSPAN6 | tetraspanin 6 | |
|
2 | 2 | ||||||
| MIRT698325 | TMEM127 | transmembrane protein 127 | |
|
2 | 2 | ||||||
| MIRT698915 | SPEM1 | spermatid maturation 1 | |
|
2 | 2 | ||||||
| MIRT699257 | SLC6A4 | solute carrier family 6 member 4 | |
|
2 | 2 | ||||||
| MIRT699311 | SLC35F5 | solute carrier family 35 member F5 | |
|
2 | 4 | ||||||
| MIRT699624 | SH3BP5 | SH3 domain binding protein 5 | |
|
2 | 2 | ||||||
| MIRT699688 | SF3B3 | splicing factor 3b subunit 3 | |
|
2 | 2 | ||||||
| MIRT700040 | RPL14 | ribosomal protein L14 | |
|
2 | 2 | ||||||
| MIRT700095 | RNF19B | ring finger protein 19B | |
|
2 | 2 | ||||||
| MIRT700498 | PTPN4 | protein tyrosine phosphatase, non-receptor type 4 | |
|
2 | 2 | ||||||
| MIRT700747 | PLAA | phospholipase A2 activating protein | |
|
2 | 2 | ||||||
| MIRT701103 | PAPD5 | poly(A) RNA polymerase D5, non-canonical | |
|
2 | 2 | ||||||
| MIRT701568 | MYPN | myopalladin | |
|
2 | 2 | ||||||
| MIRT701692 | MYADM | myeloid associated differentiation marker | |
|
2 | 2 | ||||||
| MIRT701815 | MRPL37 | mitochondrial ribosomal protein L37 | |
|
2 | 2 | ||||||
| MIRT702435 | KIAA1549 | KIAA1549 | |
|
2 | 2 | ||||||
| MIRT702518 | KCND3 | potassium voltage-gated channel subfamily D member 3 | |
|
2 | 2 | ||||||
| MIRT702954 | HIP1 | huntingtin interacting protein 1 | |
|
2 | 2 | ||||||
| MIRT703079 | GPRIN3 | GPRIN family member 3 | |
|
2 | 2 | ||||||
| MIRT704106 | DRAXIN | dorsal inhibitory axon guidance protein | |
|
2 | 2 | ||||||
| MIRT704138 | DNAL1 | dynein axonemal light chain 1 | |
|
2 | 2 | ||||||
| MIRT704187 | LDHD | lactate dehydrogenase D | |
|
2 | 2 | ||||||
| MIRT704754 | CDKN2AIPNL | CDKN2A interacting protein N-terminal like | |
|
2 | 2 | ||||||
| MIRT705075 | C4orf29 | abhydrolase domain containing 18 | |
|
2 | 2 | ||||||
| MIRT705342 | ATP1B3 | ATPase Na+/K+ transporting subunit beta 3 | |
|
2 | 2 | ||||||
| MIRT706274 | SLC35F6 | solute carrier family 35 member F6 | |
|
2 | 2 | ||||||
| MIRT706397 | HAS2 | hyaluronan synthase 2 | |
|
2 | 2 | ||||||
| MIRT706431 | LIAS | lipoic acid synthetase | |
|
2 | 2 | ||||||
| MIRT706506 | MTMR9 | myotubularin related protein 9 | |
|
2 | 2 | ||||||
| MIRT707586 | PCNXL2 | pecanex homolog 2 | |
|
2 | 2 | ||||||
| MIRT708361 | CDIPT | CDP-diacylglycerol--inositol 3-phosphatidyltransferase | |
|
2 | 2 | ||||||
| MIRT708444 | MAPKAPK5 | mitogen-activated protein kinase-activated protein kinase 5 | |
|
2 | 2 | ||||||
| MIRT709915 | GRIK3 | glutamate ionotropic receptor kainate type subunit 3 | |
|
2 | 2 | ||||||
| MIRT712607 | BHLHA15 | basic helix-loop-helix family member a15 | |
|
2 | 2 | ||||||
| MIRT716540 | GOLGA2 | golgin A2 | |
|
2 | 2 | ||||||
| MIRT721623 | VDR | vitamin D receptor | |
|
2 | 2 | ||||||
| MIRT724887 | MVK | mevalonate kinase | |
|
2 | 2 | ||||||
| MIRT725257 | PARVB | parvin beta | |
|
2 | 2 | ||||||
| MIRT755885 | RPLP0 | ribosomal protein lateral stalk subunit P0 | 3 | 1 | ||||||||
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|