| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-548ah |
| Genomic Coordinates | chr4: 76575551 - 76575626 |
| Description | Homo sapiens miR-548ah stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Mature miRNA Information | |||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-548ah-5p | ||||||||||||||||||||||||||||
| Sequence | 11| AAAAGUGAUUGCAGUGUUUG |30 | ||||||||||||||||||||||||||||
| Evidence | Experimental | ||||||||||||||||||||||||||||
| Experiments | Illumina | ||||||||||||||||||||||||||||
| Editing Events in miRNAs |
|
||||||||||||||||||||||||||||
| SNPs in miRNA |
|
||||||||||||||||||||||||||||
| Putative Targets | |||||||||||||||||||||||||||||
| miRNA Expression profile | |
|---|---|
| Human miRNA Tissue Atlas | |
| miRNAs in Extracellular Vesicles |
|
| Circulating MicroRNA Expression Profiling | |
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | AKAP11 | ||||||||||||||||||||
| Synonyms | AKAP-11, AKAP220, PPP1R44, PRKA11 | ||||||||||||||||||||
| Description | A-kinase anchoring protein 11 | ||||||||||||||||||||
| Transcript | NM_016248 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on AKAP11 | |||||||||||||||||||||
| 3'UTR of AKAP11 (miRNA target sites are highlighted) |
>AKAP11|NM_016248|3'UTR 1 AGCAAACCCCAAACCAGTATATTTTAGTATTTGTTTGGGGAGGGGAACAAGCCAATAAAGATGTTTAGGATAAAATTTGA 81 ATAGTGAATATTAACATCGTAAGTCAGTTGGGAGGCAAGTAAATATAGCTTTCTGAGCGCTTTGTGTTATCACTCGGTGT 161 ATATAGTTCATACTTTTGTAATCTGTCAAAATACTACCTTCATTTATTCTTCTATACACATGTGTAGTGTGTCAAGACCC 241 TAAGAACATGTATTTGAAGGAAGGTCTAACCAGGGGGTTTTCAGGGGCATTGTCTGACCACATTCTTTTTGTATCCAAAT 321 AGTGCTGCTAGAAACTGCACTGAAGTGGCTGAGGATAGGTTCCAGTGATAGAGTTATAATTTTGCTCCTTTGCAAACAAA 401 TGGTATCTAATTAATAACTAGTCTGACATCAGAAAATAAAATTGAGGCTGATTTTTAAAAATTTCTAGTAGATTTTTGGC 481 CTTTCCTGTTTTTAAAAATCAGTTTCATTTTCATATTTCATAGATCAGCTATTGGTAGCTTTTTGATTTCCCCAAACTAT 561 TTAATTTCTTAGCAGAAACATTAGTATTTTAGGTTTCTATAAACACTATAAGTGATAGTTTCCCCCATCCTTTCATTGAC 641 ATTATTTGCCAATGCTGCCAGTCATTCTGGCATGAAAGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT 721 GTAAGGGAGTACTTTAACCTTGCCAGTTTGTTCCCTCTTTTATTTTACTGTTTTCTTTTTAGAAACCCACTGTTAAAATT 801 TAAAAAGGTGCTTTAAAATAAAACGCCTATAAAGATTGTGCAGTAAGAATTTTTATTGACAATAATTAAAATTTTTTTTG 881 ACAATTTTGGGTTCCCAACTTATCTTACAAGTGAAAACTTAAATTGTAAAACATGTTGAAATTTTAAAAATTAATGTTAA 961 TATGGAAATGCATTTAGAGAAGCCCAGTAGTTTTTATTGTTGGATTTTTGAAAAAACCTCTACCAAGAATGTGGTGTTTT 1041 TTTTGTTTGTTTGTTTGTTTGTTTTAGAAAAATTGGGATTTCCCCCCACCCCGCCCCACCCAGATAAACTATATCTACAC 1121 TGTCTCGTCAAGTTCTCTGACACGATCTTTCTGGGCTCTACATTTCCTACTAGTTTGTGTCCAGAAACTGCAAGTTGACA 1201 TGAATAGAGGACAAAGGTTGTGTCTTGCTTTTGTCTCTCTCTTCCCTCCCTGCAACTCTCTCTCCCCTCCTCCCACTCTC 1281 TTCCCCCTCCCCCCTCCTCCCACTGTCTCTCACCTCCCCCACCCCCCACTCTCTCTCATCTCTCGCTGTGTCCTGTGTAT 1361 GTGTGGGTGTGTGTGTATTTGGGTGTGTAAATGTTGGTTCTTCCACTACTGGATTTTGTAATCTAGGATAAATCACTTTT 1441 TTTGGGGACTTTGATTTTGCTCCATTACGTTTTCATTTTTTCTGAGCACTGACTGTTCTGAAAGCTGCACAAAACGTAGA 1521 AAGAAGACATAGCGCCTGCCAGGGAATAGGAAATGAGGGCACTTACACATTAATGTGAATTAGTAATTGTGGTATAGAAA 1601 TGTTTTATAGTGAAAGATTCAAATTTGCTTTTCAAGAAAAATGCCAAAAGCTATTTAAATAATTCGAGGTTACATCGTAG 1681 GTTTTGATTTTTCTCAATTTAAGATACAGAAATACAGCAAGCCTTAATATAAAGTTTCCTAAAGTTTCTTCAAGTATTTT 1761 TTAAGGTGGAGAAATGCAGGAATTGTATAACCAGAATTGTTCCTGCCTTTAGCTTTTCAGAACTTGAGATGTGGCAGCAC 1841 TGGACTGGGTTTTTTTAAATGTTAGGACTAGGAATGTTTGCTCTTGTTAATTATGAATTAATTGATTATTAAGTTTAGAA 1921 TGCATTTTTACAAGTATCTAACTATCAAATTGTGTTTAGTAACTTGAGTGTATGCACAAGTTTGATCAACAGCAAAATAG 2001 AGTTCTGAATTTCTTTTAAAGTGATGATATATTATTTTGTGAAACTTTGTGTTTGAAAATGTTTATTTCTGTTTATGGTG 2081 TAATCATTCTGAGGTGAGGCTTTTCTTATTTCCTTTGCATTTTGCTAGAGCTGTGCTGAGTTCAGCATTTGCTTATTTAA 2161 CCACTACATAATGACAGACCAGTTATTAGGTATTAGCATGTGTGGTAATAATAATAGTGGAACTTCACACTTACATCAAT 2241 TCAGTGCAGGGGCATAGAATAAAATATTAAATATTGGCAGATGTATGAAAAGAAGTGTGAGTTAAAAATATTGAATATTG 2321 GCAGGTGTGAAAACAAGTGTCAAAATTCCTCATATAGAGAAAATAATTTTGAGTTTAGAGTATTATCTTTTAATTAAGTG 2401 TAGTCTAAACTTAACTTTCTGTAAAGGCACTTTGTGGTTTTTCCAAAGATGTTCTAGATCTATTTGGTTGCTCTATAGTC 2481 AAACAGCTCTTTTGAAGACAACTGTCTTATTTTATTACAAATTGGCTTGACATATTTATACTGTAACATTGTAATATTGC 2561 TGTGCTGTACATTTTGGCCCTTACGAAATACGTCTTTTTCAGAACTGTTAAAGTTTTGATGTACATCGAGCTGAATTCTG 2641 TTTTTACCAGTTTCAAAACCTTCAAGTGATATGTGGAAAAAAGTGAATGAGACCTCTGATAGGGGGTTTTCAGAACCTTG 2721 TTCACACCAAAATGTGACAGTTCTTTCATGTTTTCCTAAACCAAGTTAAAATTACATGTATATTTTGGTGTTAAGGTTGA 2801 TTTTTAAGATACTTCTGATTTGTACAAAAGGAATGTTTCCTTTATAAATCACAGAAGAAAATGACAATATCTGTTGGATA 2881 TTTGATATAATTTAATGGTGTTATAAAACCTTTAAGAGGATTCATGGTGAATATATGTGATAACATCTTTATACTTTGAA 2961 AAATGTTCCACTTACCCTTCAGATATTTGTTGTAAGTTAATTCAATTCTTAATACTTTAATTTTGCTCCAACAAGGGCTT 3041 TATGTTGCTGGTAAGAGAATTTATTTACTAAATGCACTATGTATAAAGTGAAAGATAGTTTACTTATCTGACTTTGATAT 3121 TAGATGGCTGACATTAGTGCACATAATGCAGAGTTTAACCTTGATTCTTCAACAGAGTCCAGATTTAAATGTCTACTTAG 3201 TTAATTAGTTAGCTGATATTCTTCCACAATTAATATATTCAATTTCCCATCAGTATATCACTTTAAATTTTATGTTTTTC 3281 TAAGGAAACTTTCCACAGAATTTTAAACAACTGATGCATCCATACTCAGGGTGTAGGGAGAATACTTTGCATTTAAAAAC 3361 CCTGTCCACCTGTCACCAGCACAAGAGAATTAGAGCTTCAGTGAGAATTTAGAAAAATTATACTAAAGTGAGATGCATTT 3441 TTTCTCATTTTCAGCAAGACTCCTCTAAGCATTTACTCATTTACTGTATTCCTGCTCTGAAGATGTGGATACAGAATTAG 3521 TCACTCTTGTCACTTTATTTATTTATTGGTTTTTTTTTAACCATCTGTGTACATTCCTTTCATAGGGTAGAGTTCTAGTT 3601 CTAGAAGTTCTTATTTTGTTTTTGTTGTAATGTTTGAATACTATTTAATATCCGGTTTTAATATTGCTGGATTTGCTACC 3681 TTTGGTTACTTGTGCAGTGTTAAAAGTAATCCACTTTCTTGTTTAATATACCAGATACATAGCAAAAGCAGCTTGGAATA 3761 ATTATAGCTGTTTATTTGGCTGTGCTCAGTTACTATATTAAGATCTTGTACTGTGTAACAGTAACTCTTTTTTGCTTTTC 3841 AGTAATTTAATATGTTCACTTAACAAAATACGAACTTTGAGATGCACTAAAGTTTTGTTTCAGCAGTGGCTCAAAAAATT 3921 TCAGAAATTACTTTTGTAATTATTTGCAATTAATTGTTCTTTTATCTTACAATTGTTTAAGCCTGTGATCTTTCTTCTCC 4001 CAGCTAAGAGTTCTTCAATAAATTTAAGAAATACCTGGTAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control
PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
| Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 11215.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
| Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | hESCs (WA-09) |
| Disease | 11215.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
| Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 11215.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
| Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
| Experimental Support 5 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | C8166 , TZM-bl |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
| Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
| Experimental Support 6 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | MCF7 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated
... - Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology. |
| Article |
- Farazi TA; Ten Hoeve JJ; Brown M; et al. - Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
|
| Experimental Support 7 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HCT116 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177615. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_5
PAR-CLIP data was present in ERX177603. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_5
PAR-CLIP data was present in ERX177627. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_5
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
| Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
| CLIP-seq Support 1 for dataset GSM714642 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repA |
| Location of target site | ENST00000025301.2 | 3UTR | AAUUAGUCACUCUUGUCACUUUAUUUAUUUAUUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM545212 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000025301.2 | 3UTR | UCACUCUUGUCACUUUAUUUAUUUAUU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM545214 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO3 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000025301.2 | 3UTR | AAUUAGUCACUCUUGUCACUUUAUUU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset GSM545216 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / miR-124 transfection |
| Location of target site | ENST00000025301.2 | 3UTR | GUCACUCUUGUCACUUUAUUUAUUUAUUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 5 for dataset GSM545217 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / miR-7 transfection |
| Location of target site | ENST00000025301.2 | 3UTR | UCACUCUUGUCACUUUAUUUAUUUAUUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 6 for dataset GSM714645 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repB |
| Location of target site | ENST00000025301.2 | 3UTR | UCACUCUUGUCACUUUAUUUAUUUAUUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 7 for dataset SRR359787 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
| Location of target site | ENST00000025301.2 | 3UTR | UCACUCUUGUCACUUUAUUUAUUUAUUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 22012620 / SRX103431 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 8 for dataset GSM1065667 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_6 |
| Location of target site | ENST00000025301.2 | 3UTR | AAUUAGUCACUCUUGUCACUUUAUUUAUUUAUUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 9 for dataset GSM1065668 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_7 |
| Location of target site | ENST00000025301.2 | 3UTR | UCACUCUUGUCACUUUAUUUAUUUAUU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 10 for dataset GSM1065669 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_8 |
| Location of target site | ENST00000025301.2 | 3UTR | UCACUCUUGUCACUUUAUUUAUUUAUUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 11 for dataset GSM1065670 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / 4-thiouridine, 3_ML_LG |
| Location of target site | ENST00000025301.2 | 3UTR | UCACUCUUGUCACUUUAUUUAUUUAUUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 12 for dataset SRR1045082 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | MCF7 / Untreated |
| Location of target site | ENST00000025301.2 | 3UTR | UCACUCUUGUCACUUUAUUUAUUUAUUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 24398324 / SRX388831 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 13 for dataset GSM1462572 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | C8166 / C8166 NL4-3 |
| Location of target site | ENST00000025301.2 | 3UTR | UCACUCUUGUCACUUUAUUUAUUUAUUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 14 for dataset GSM1462574 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | TZM-bl / TZM-bl ami BaL |
| Location of target site | ENST00000025301.2 | 3UTR | UCACUCUUGUCACUUUAUUUAUUUAUUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||
|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||
|---|---|---|---|---|---|---|---|
|
302 hsa-miR-548ah-5p Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT057035 | SGPL1 | sphingosine-1-phosphate lyase 1 |  |
|
2 | 2 | ||||||
| MIRT060559 | CCND1 | cyclin D1 | |
|
2 | 12 | ||||||
| MIRT061211 | MED17 | mediator complex subunit 17 | |
|
2 | 2 | ||||||
| MIRT061700 | BTG2 | BTG anti-proliferation factor 2 | |
|
2 | 4 | ||||||
| MIRT064457 | GPR137B | G protein-coupled receptor 137B | |
|
2 | 2 | ||||||
| MIRT065680 | ACVR1B | activin A receptor type 1B | |
|
2 | 6 | ||||||
| MIRT068902 | TPRG1L | tumor protein p63 regulated 1 like | |
|
2 | 2 | ||||||
| MIRT069414 | ZFYVE21 | zinc finger FYVE-type containing 21 | |
|
2 | 8 | ||||||
| MIRT069711 | FOXJ3 | forkhead box J3 | |
|
2 | 2 | ||||||
| MIRT071220 | FCF1 | FCF1, rRNA-processing protein | |
|
2 | 2 | ||||||
| MIRT072258 | B2M | beta-2-microglobulin | |
|
2 | 10 | ||||||
| MIRT073631 | IGF1R | insulin like growth factor 1 receptor | |
|
2 | 4 | ||||||
| MIRT077074 | KRT10 | keratin 10 | |
|
2 | 8 | ||||||
| MIRT080711 | ZCCHC2 | zinc finger CCHC-type containing 2 | |
|
2 | 2 | ||||||
| MIRT081230 | MIDN | midnolin | |
|
2 | 8 | ||||||
| MIRT085792 | FMNL2 | formin like 2 | |
|
2 | 2 | ||||||
| MIRT088055 | UBXN2A | UBX domain protein 2A | |
|
2 | 4 | ||||||
| MIRT089219 | ACTR2 | ARP2 actin related protein 2 homolog | |
|
2 | 6 | ||||||
| MIRT090626 | PLS1 | plastin 1 | |
|
2 | 2 | ||||||
| MIRT091390 | EIF4A2 | eukaryotic translation initiation factor 4A2 | |
|
2 | 2 | ||||||
| MIRT092424 | APPL1 | adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 1 | |
|
2 | 2 | ||||||
| MIRT094197 | THAP6 | THAP domain containing 6 | |
|
2 | 2 | ||||||
| MIRT098283 | SMIM13 | small integral membrane protein 13 | |
|
2 | 6 | ||||||
| MIRT099150 | MYLIP | myosin regulatory light chain interacting protein | |
|
2 | 12 | ||||||
| MIRT103209 | SP4 | Sp4 transcription factor | |
|
2 | 6 | ||||||
| MIRT108713 | XIAP | X-linked inhibitor of apoptosis | |
|
2 | 2 | ||||||
| MIRT114051 | AKAP11 | A-kinase anchoring protein 11 | |
|
2 | 12 | ||||||
| MIRT135494 | RAB5B | RAB5B, member RAS oncogene family | |
|
2 | 8 | ||||||
| MIRT156020 | SIK1 | salt inducible kinase 1 | |
|
2 | 2 | ||||||
| MIRT173035 | YTHDF3 | YTH N6-methyladenosine RNA binding protein 3 | |
|
2 | 2 | ||||||
| MIRT182263 | POU2F1 | POU class 2 homeobox 1 | |
|
2 | 2 | ||||||
| MIRT182529 | ZBTB37 | zinc finger and BTB domain containing 37 | |
|
2 | 2 | ||||||
| MIRT184889 | ULK1 | unc-51 like autophagy activating kinase 1 | |
|
2 | 2 | ||||||
| MIRT187295 | CLIC4 | chloride intracellular channel 4 | |
|
2 | 4 | ||||||
| MIRT187488 | PCBP2 | poly(rC) binding protein 2 | |
|
2 | 4 | ||||||
| MIRT188194 | DYRK2 | dual specificity tyrosine phosphorylation regulated kinase 2 | |
|
2 | 2 | ||||||
| MIRT188215 | RAP1B | RAP1B, member of RAS oncogene family | |
|
2 | 2 | ||||||
| MIRT192288 | BTF3L4 | basic transcription factor 3 like 4 | |
|
2 | 6 | ||||||
| MIRT201087 | ZNF805 | zinc finger protein 805 | |
|
2 | 2 | ||||||
| MIRT212617 | RBPJ | recombination signal binding protein for immunoglobulin kappa J region | |
|
2 | 8 | ||||||
| MIRT213196 | REST | RE1 silencing transcription factor | |
|
2 | 2 | ||||||
| MIRT213334 | KIAA0232 | KIAA0232 | |
|
2 | 2 | ||||||
| MIRT213444 | DCK | deoxycytidine kinase | |
|
2 | 4 | ||||||
| MIRT220129 | CAV1 | caveolin 1 | |
|
2 | 2 | ||||||
| MIRT230191 | AKAP17A | A-kinase anchoring protein 17A | |
|
2 | 2 | ||||||
| MIRT242730 | ZNF714 | zinc finger protein 714 | |
|
2 | 2 | ||||||
| MIRT242759 | FNBP1L | formin binding protein 1 like | |
|
2 | 2 | ||||||
| MIRT257297 | FOXC1 | forkhead box C1 | |
|
2 | 2 | ||||||
| MIRT258911 | LAPTM4B | lysosomal protein transmembrane 4 beta | |
|
2 | 4 | ||||||
| MIRT260958 | SCD | stearoyl-CoA desaturase | |
|
2 | 2 | ||||||
| MIRT263458 | SAMD8 | sterile alpha motif domain containing 8 | |
|
2 | 2 | ||||||
| MIRT284918 | NFAT5 | nuclear factor of activated T-cells 5 | |
|
2 | 6 | ||||||
| MIRT291947 | TPM4 | tropomyosin 4 | |
|
2 | 2 | ||||||
| MIRT297340 | BCL2L11 | BCL2 like 11 | |
|
2 | 8 | ||||||
| MIRT308819 | NPNT | nephronectin | |
|
2 | 2 | ||||||
| MIRT311518 | ISOC1 | isochorismatase domain containing 1 | |
|
2 | 2 | ||||||
| MIRT314181 | OCLN | occludin | |
|
2 | 4 | ||||||
| MIRT315706 | NUS1 | NUS1 dehydrodolichyl diphosphate synthase subunit | |
|
2 | 2 | ||||||
| MIRT331762 | PAFAH1B2 | platelet activating factor acetylhydrolase 1b catalytic subunit 2 | |
|
2 | 4 | ||||||
| MIRT338783 | STMN1 | stathmin 1 | |
|
2 | 2 | ||||||
| MIRT341459 | ATP6V0B | ATPase H+ transporting V0 subunit b | |
|
2 | 2 | ||||||
| MIRT344226 | SRSF11 | serine and arginine rich splicing factor 11 | |
|
2 | 2 | ||||||
| MIRT355851 | SGMS2 | sphingomyelin synthase 2 | |
|
2 | 4 | ||||||
| MIRT409854 | RLIM | ring finger protein, LIM domain interacting | |
|
2 | 2 | ||||||
| MIRT442758 | NRIP3 | nuclear receptor interacting protein 3 | |
|
2 | 2 | ||||||
| MIRT443716 | LLPH | LLP homolog, long-term synaptic facilitation | |
|
2 | 2 | ||||||
| MIRT444315 | SREK1IP1 | SREK1 interacting protein 1 | |
|
2 | 2 | ||||||
| MIRT444387 | ZNF623 | zinc finger protein 623 | |
|
2 | 2 | ||||||
| MIRT445543 | TBC1D8 | TBC1 domain family member 8 | |
|
2 | 2 | ||||||
| MIRT447791 | NUPL2 | nucleoporin like 2 | |
|
2 | 2 | ||||||
| MIRT447963 | WDR77 | WD repeat domain 77 | |
|
2 | 2 | ||||||
| MIRT448311 | WNK3 | WNK lysine deficient protein kinase 3 | |
|
2 | 2 | ||||||
| MIRT448363 | TSR1 | TSR1, ribosome maturation factor | |
|
2 | 6 | ||||||
| MIRT448389 | TP53INP1 | tumor protein p53 inducible nuclear protein 1 | |
|
2 | 2 | ||||||
| MIRT448801 | GLIS3 | GLIS family zinc finger 3 | |
|
2 | 2 | ||||||
| MIRT450193 | TMEM9B | TMEM9 domain family member B | |
|
2 | 2 | ||||||
| MIRT453365 | ZNF3 | zinc finger protein 3 | |
|
2 | 2 | ||||||
| MIRT453579 | CRCP | CGRP receptor component | |
|
2 | 2 | ||||||
| MIRT454815 | NEDD9 | neural precursor cell expressed, developmentally down-regulated 9 | |
|
2 | 2 | ||||||
| MIRT455376 | AAED1 | AhpC/TSA antioxidant enzyme domain containing 1 | |
|
2 | 2 | ||||||
| MIRT456971 | SPAM1 | sperm adhesion molecule 1 | |
|
2 | 2 | ||||||
| MIRT458297 | FUT10 | fucosyltransferase 10 | |
|
2 | 2 | ||||||
| MIRT458872 | CD55 | CD55 molecule (Cromer blood group) | |
|
2 | 2 | ||||||
| MIRT460528 | S100A11 | S100 calcium binding protein A11 | |
|
2 | 4 | ||||||
| MIRT462130 | AKR7A2 | aldo-keto reductase family 7 member A2 | |
|
2 | 4 | ||||||
| MIRT463268 | ZFYVE9 | zinc finger FYVE-type containing 9 | |
|
2 | 2 | ||||||
| MIRT463618 | ZBTB33 | zinc finger and BTB domain containing 33 | |
|
2 | 4 | ||||||
| MIRT465229 | TRIP10 | thyroid hormone receptor interactor 10 | |
|
2 | 2 | ||||||
| MIRT465831 | TMEM64 | transmembrane protein 64 | |
|
2 | 2 | ||||||
| MIRT466460 | TFAM | transcription factor A, mitochondrial | |
|
2 | 8 | ||||||
| MIRT467891 | SLC22A23 | solute carrier family 22 member 23 | |
|
2 | 2 | ||||||
| MIRT468847 | RRM2 | ribonucleotide reductase regulatory subunit M2 | |
|
2 | 2 | ||||||
| MIRT469854 | PXK | PX domain containing serine/threonine kinase like | |
|
2 | 8 | ||||||
| MIRT469885 | PURB | purine rich element binding protein B | |
|
2 | 4 | ||||||
| MIRT470448 | PPP1R15B | protein phosphatase 1 regulatory subunit 15B | |
|
2 | 8 | ||||||
| MIRT471867 | NUFIP2 | NUFIP2, FMR1 interacting protein 2 | |
|
2 | 4 | ||||||
| MIRT472053 | NPAT | nuclear protein, coactivator of histone transcription | |
|
2 | 2 | ||||||
| MIRT472163 | NIN | ninein | |
|
2 | 4 | ||||||
| MIRT474279 | LARP1 | La ribonucleoprotein domain family member 1 | |
|
2 | 6 | ||||||
| MIRT474602 | KLF6 | Kruppel like factor 6 | |
|
2 | 2 | ||||||
| MIRT475468 | HSPA8 | heat shock protein family A (Hsp70) member 8 | |
|
2 | 6 | ||||||
| MIRT476648 | G2E3 | G2/M-phase specific E3 ubiquitin protein ligase | |
|
2 | 2 | ||||||
| MIRT476878 | FEM1B | fem-1 homolog B | |
|
2 | 2 | ||||||
| MIRT476906 | FBXL5 | F-box and leucine rich repeat protein 5 | |
|
2 | 12 | ||||||
| MIRT477188 | F3 | coagulation factor III, tissue factor | |
|
2 | 8 | ||||||
| MIRT477291 | ERGIC2 | ERGIC and golgi 2 | |
|
2 | 2 | ||||||
| MIRT478410 | DCAF8 | DDB1 and CUL4 associated factor 8 | |
|
2 | 2 | ||||||
| MIRT479045 | COIL | coilin | |
|
2 | 10 | ||||||
| MIRT479061 | CNOT6L | CCR4-NOT transcription complex subunit 6 like | |
|
2 | 8 | ||||||
| MIRT479273 | CHSY1 | chondroitin sulfate synthase 1 | |
|
2 | 2 | ||||||
| MIRT480523 | C11orf30 | EMSY, BRCA2 interacting transcriptional repressor | |
|
2 | 10 | ||||||
| MIRT480557 | BZW1 | basic leucine zipper and W2 domains 1 | |
|
2 | 2 | ||||||
| MIRT480781 | BMP2 | bone morphogenetic protein 2 | |
|
2 | 2 | ||||||
| MIRT481213 | ATXN7L3B | ataxin 7 like 3B | |
|
2 | 2 | ||||||
| MIRT481341 | ATL3 | atlastin GTPase 3 | |
|
2 | 2 | ||||||
| MIRT481800 | APEX1 | apurinic/apyrimidinic endodeoxyribonuclease 1 | |
|
2 | 2 | ||||||
| MIRT481934 | ANKRD11 | ankyrin repeat domain 11 | |
|
2 | 12 | ||||||
| MIRT481962 | ANKH | ANKH inorganic pyrophosphate transport regulator | |
|
2 | 8 | ||||||
| MIRT484826 | ZNFX1 | zinc finger NFX1-type containing 1 | |
|
2 | 4 | ||||||
| MIRT484913 | ZFYVE26 | zinc finger FYVE-type containing 26 | |
|
2 | 4 | ||||||
| MIRT485132 | RRAS2 | RAS related 2 | |
|
2 | 6 | ||||||
| MIRT485197 | PTP4A1 | protein tyrosine phosphatase type IVA, member 1 | |
|
2 | 4 | ||||||
| MIRT492016 | UGCG | UDP-glucose ceramide glucosyltransferase | |
|
2 | 2 | ||||||
| MIRT492366 | SEMA7A | semaphorin 7A (John Milton Hagen blood group) | |
|
2 | 2 | ||||||
| MIRT493120 | MKNK2 | MAP kinase interacting serine/threonine kinase 2 | |
|
2 | 6 | ||||||
| MIRT493391 | KIAA0513 | KIAA0513 | |
|
2 | 6 | ||||||
| MIRT493668 | HBP1 | HMG-box transcription factor 1 | |
|
2 | 2 | ||||||
| MIRT494069 | DUSP2 | dual specificity phosphatase 2 | |
|
2 | 4 | ||||||
| MIRT494385 | SOLH | calpain 15 | |
1 | 1 | |||||||
| MIRT494776 | ANKRD33B | ankyrin repeat domain 33B | |
|
2 | 10 | ||||||
| MIRT496737 | TRIM31 | tripartite motif containing 31 | |
|
2 | 2 | ||||||
| MIRT497422 | FAM46A | family with sequence similarity 46 member A | |
|
2 | 2 | ||||||
| MIRT498160 | FEM1C | fem-1 homolog C | |
|
2 | 8 | ||||||
| MIRT498357 | ABHD17B | abhydrolase domain containing 17B | |
|
2 | 2 | ||||||
| MIRT499911 | KIAA1191 | KIAA1191 | |
|
2 | 4 | ||||||
| MIRT500764 | TMEM127 | transmembrane protein 127 | |
|
2 | 6 | ||||||
| MIRT501461 | PTPN4 | protein tyrosine phosphatase, non-receptor type 4 | |
|
2 | 8 | ||||||
| MIRT501956 | MAPRE3 | microtubule associated protein RP/EB family member 3 | |
|
2 | 8 | ||||||
| MIRT502368 | GIGYF1 | GRB10 interacting GYF protein 1 | |
|
2 | 8 | ||||||
| MIRT502408 | GATA6 | GATA binding protein 6 | |
|
2 | 8 | ||||||
| MIRT503445 | GINS4 | GINS complex subunit 4 | |
|
2 | 4 | ||||||
| MIRT503565 | MDM2 | MDM2 proto-oncogene | |
|
2 | 4 | ||||||
| MIRT503614 | ZNF780A | zinc finger protein 780A | |
|
2 | 2 | ||||||
| MIRT503833 | TMEM242 | transmembrane protein 242 | |
|
2 | 4 | ||||||
| MIRT504102 | C9orf40 | chromosome 9 open reading frame 40 | |
|
2 | 6 | ||||||
| MIRT505495 | SRSF2 | serine and arginine rich splicing factor 2 | |
|
2 | 4 | ||||||
| MIRT505741 | SEPT2 | septin 2 | |
|
2 | 4 | ||||||
| MIRT505977 | RAB11FIP1 | RAB11 family interacting protein 1 | |
|
2 | 4 | ||||||
| MIRT506229 | PFKP | phosphofructokinase, platelet | |
|
2 | 8 | ||||||
| MIRT506432 | NAGK | N-acetylglucosamine kinase | |
|
2 | 6 | ||||||
| MIRT506455 | NACC2 | NACC family member 2 | |
|
2 | 4 | ||||||
| MIRT506515 | MSANTD4 | Myb/SANT DNA binding domain containing 4 with coiled-coils | |
|
2 | 4 | ||||||
| MIRT506626 | MARCH6 | membrane associated ring-CH-type finger 6 | |
|
2 | 8 | ||||||
| MIRT506677 | LZIC | leucine zipper and CTNNBIP1 domain containing | |
|
2 | 4 | ||||||
| MIRT506839 | KIF23 | kinesin family member 23 | |
|
2 | 4 | ||||||
| MIRT506866 | KIAA1147 | KIAA1147 | |
|
2 | 2 | ||||||
| MIRT507190 | FZD9 | frizzled class receptor 9 | |
|
2 | 6 | ||||||
| MIRT507236 | FOXK2 | forkhead box K2 | |
|
2 | 4 | ||||||
| MIRT507363 | FAM129A | family with sequence similarity 129 member A | |
|
2 | 6 | ||||||
| MIRT508089 | ANKRD52 | ankyrin repeat domain 52 | |
|
2 | 2 | ||||||
| MIRT508230 | ZNF850 | zinc finger protein 850 | |
|
2 | 6 | ||||||
| MIRT511090 | NIPA1 | non imprinted in Prader-Willi/Angelman syndrome 1 | |
|
2 | 4 | ||||||
| MIRT511258 | KLHL36 | kelch like family member 36 | |
|
2 | 6 | ||||||
| MIRT512681 | ENO4 | enolase family member 4 | |
|
2 | 2 | ||||||
| MIRT512754 | CD59 | CD59 molecule (CD59 blood group) | |
|
2 | 4 | ||||||
| MIRT513471 | NARS | asparaginyl-tRNA synthetase | |
|
2 | 6 | ||||||
| MIRT513903 | GRB10 | growth factor receptor bound protein 10 | |
|
2 | 6 | ||||||
| MIRT513985 | CEP97 | centrosomal protein 97 | |
|
2 | 2 | ||||||
| MIRT513999 | CENPQ | centromere protein Q | |
|
2 | 4 | ||||||
| MIRT514036 | BNIP2 | BCL2 interacting protein 2 | |
|
2 | 2 | ||||||
| MIRT514106 | EPS15L1 | epidermal growth factor receptor pathway substrate 15 like 1 | |
|
2 | 6 | ||||||
| MIRT515002 | DNTTIP2 | deoxynucleotidyltransferase terminal interacting protein 2 | |
|
2 | 2 | ||||||
| MIRT517025 | COX19 | COX19, cytochrome c oxidase assembly factor | |
|
2 | 2 | ||||||
| MIRT517533 | ITM2C | integral membrane protein 2C | |
|
2 | 6 | ||||||
| MIRT517825 | KIAA2018 | upstream transcription factor family member 3 | |
|
2 | 4 | ||||||
| MIRT524333 | CRLF3 | cytokine receptor like factor 3 | |
|
2 | 4 | ||||||
| MIRT524700 | BTG3 | BTG anti-proliferation factor 3 | |
|
2 | 8 | ||||||
| MIRT525208 | ZNF93 | zinc finger protein 93 | |
|
2 | 2 | ||||||
| MIRT527210 | XIRP2 | xin actin binding repeat containing 2 | |
|
2 | 2 | ||||||
| MIRT527478 | CLEC12B | C-type lectin domain family 12 member B | |
|
2 | 4 | ||||||
| MIRT527889 | SERF1B | small EDRK-rich factor 1B | |
|
2 | 2 | ||||||
| MIRT529345 | SERF1A | small EDRK-rich factor 1A | |
|
2 | 2 | ||||||
| MIRT529613 | H1F0 | H1 histone family member 0 | |
|
2 | 2 | ||||||
| MIRT531822 | ZNF264 | zinc finger protein 264 | |
|
2 | 6 | ||||||
| MIRT531843 | MTPAP | mitochondrial poly(A) polymerase | |
|
2 | 4 | ||||||
| MIRT532091 | RTTN | rotatin | |
|
2 | 2 | ||||||
| MIRT533391 | U2SURP | U2 snRNP associated SURP domain containing | |
|
2 | 6 | ||||||
| MIRT533837 | TGFBR2 | transforming growth factor beta receptor 2 | |
|
2 | 6 | ||||||
| MIRT533885 | TBL1XR1 | transducin beta like 1 X-linked receptor 1 | |
|
2 | 2 | ||||||
| MIRT534006 | SUV420H1 | lysine methyltransferase 5B | |
|
2 | 2 | ||||||
| MIRT534053 | STC2 | stanniocalcin 2 | |
|
2 | 2 | ||||||
| MIRT534635 | RNASEH1 | ribonuclease H1 | |
|
2 | 4 | ||||||
| MIRT537732 | ELAVL2 | ELAV like RNA binding protein 2 | |
|
2 | 2 | ||||||
| MIRT537782 | EIF4H | eukaryotic translation initiation factor 4H | |
|
2 | 6 | ||||||
| MIRT538015 | DNAJC10 | DnaJ heat shock protein family (Hsp40) member C10 | |
|
2 | 2 | ||||||
| MIRT538717 | CAPRIN2 | caprin family member 2 | |
|
2 | 4 | ||||||
| MIRT539719 | EIF3H | eukaryotic translation initiation factor 3 subunit H | |
|
2 | 2 | ||||||
| MIRT540521 | CXCL10 | C-X-C motif chemokine ligand 10 | |
|
2 | 2 | ||||||
| MIRT541290 | GLO1 | glyoxalase I | |
|
2 | 2 | ||||||
| MIRT541747 | ZC3HAV1 | zinc finger CCCH-type containing, antiviral 1 | |
|
2 | 2 | ||||||
| MIRT542030 | PEX2 | peroxisomal biogenesis factor 2 | |
|
2 | 2 | ||||||
| MIRT542067 | SLC25A46 | solute carrier family 25 member 46 | |
|
2 | 2 | ||||||
| MIRT542509 | WDR13 | WD repeat domain 13 | |
|
2 | 2 | ||||||
| MIRT542717 | RPS15A | ribosomal protein S15a | |
|
2 | 2 | ||||||
| MIRT542890 | KLHL15 | kelch like family member 15 | |
|
2 | 4 | ||||||
| MIRT542953 | GDF11 | growth differentiation factor 11 | |
|
2 | 2 | ||||||
| MIRT543588 | RPF2 | ribosome production factor 2 homolog | |
|
2 | 6 | ||||||
| MIRT544312 | IFNGR1 | interferon gamma receptor 1 | |
|
2 | 4 | ||||||
| MIRT545143 | ADAMTS9 | ADAM metallopeptidase with thrombospondin type 1 motif 9 | |
|
2 | 2 | ||||||
| MIRT545210 | HIST1H2BD | histone cluster 1 H2B family member d | |
|
2 | 2 | ||||||
| MIRT546255 | TNFRSF21 | TNF receptor superfamily member 21 | |
|
2 | 2 | ||||||
| MIRT546294 | TMEM200C | transmembrane protein 200C | |
|
2 | 4 | ||||||
| MIRT546459 | SLC5A3 | solute carrier family 5 member 3 | |
|
2 | 4 | ||||||
| MIRT546821 | RAP2C | RAP2C, member of RAS oncogene family | |
|
2 | 2 | ||||||
| MIRT546843 | RAB4A | RAB4A, member RAS oncogene family | |
|
2 | 2 | ||||||
| MIRT547089 | PLRG1 | pleiotropic regulator 1 | |
|
2 | 2 | ||||||
| MIRT548229 | FJX1 | four jointed box 1 | |
|
2 | 4 | ||||||
| MIRT548339 | EPHA4 | EPH receptor A4 | |
|
2 | 2 | ||||||
| MIRT548392 | ENPP5 | ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) | |
|
2 | 4 | ||||||
| MIRT548464 | EGLN3 | egl-9 family hypoxia inducible factor 3 | |
|
2 | 2 | ||||||
| MIRT548861 | CERCAM | cerebral endothelial cell adhesion molecule | |
|
2 | 2 | ||||||
| MIRT549108 | C16orf70 | chromosome 16 open reading frame 70 | |
|
2 | 4 | ||||||
| MIRT549252 | ATXN1 | ataxin 1 | |
|
2 | 2 | ||||||
| MIRT549415 | ADAR | adenosine deaminase, RNA specific | |
|
2 | 2 | ||||||
| MIRT549830 | LUZP2 | leucine zipper protein 2 | |
|
2 | 2 | ||||||
| MIRT550101 | TRAPPC2 | trafficking protein particle complex 2 | |
|
2 | 2 | ||||||
| MIRT550109 | TAF6 | TATA-box binding protein associated factor 6 | |
|
2 | 2 | ||||||
| MIRT550242 | PVR | poliovirus receptor | |
|
2 | 4 | ||||||
| MIRT552212 | F2RL3 | F2R like thrombin or trypsin receptor 3 | |
|
2 | 2 | ||||||
| MIRT552640 | ZBTB18 | zinc finger and BTB domain containing 18 | |
|
2 | 2 | ||||||
| MIRT552693 | YWHAZ | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta | |
|
2 | 4 | ||||||
| MIRT553033 | USP48 | ubiquitin specific peptidase 48 | |
|
2 | 2 | ||||||
| MIRT553475 | TNKS2 | tankyrase 2 | |
|
2 | 2 | ||||||
| MIRT554302 | SIPA1L2 | signal induced proliferation associated 1 like 2 | |
|
2 | 2 | ||||||
| MIRT554330 | SH3GLB1 | SH3 domain containing GRB2 like, endophilin B1 | |
|
2 | 2 | ||||||
| MIRT554476 | SAMD12 | sterile alpha motif domain containing 12 | |
|
2 | 2 | ||||||
| MIRT554531 | RUFY2 | RUN and FYVE domain containing 2 | |
|
2 | 2 | ||||||
| MIRT554562 | RRN3 | RRN3 homolog, RNA polymerase I transcription factor | |
|
2 | 2 | ||||||
| MIRT554612 | RPS6KA5 | ribosomal protein S6 kinase A5 | |
|
2 | 2 | ||||||
| MIRT554745 | RHOC | ras homolog family member C | |
|
2 | 2 | ||||||
| MIRT554803 | RGMB | repulsive guidance molecule family member b | |
|
2 | 4 | ||||||
| MIRT555000 | RAB39B | RAB39B, member RAS oncogene family | |
|
2 | 2 | ||||||
| MIRT555166 | PTPDC1 | protein tyrosine phosphatase domain containing 1 | |
|
2 | 2 | ||||||
| MIRT555242 | PRICKLE2 | prickle planar cell polarity protein 2 | |
|
2 | 2 | ||||||
| MIRT556282 | MAPK1 | mitogen-activated protein kinase 1 | |
|
2 | 2 | ||||||
| MIRT557830 | FOXJ2 | forkhead box J2 | |
|
2 | 2 | ||||||
| MIRT558221 | EFCAB14 | EF-hand calcium binding domain 14 | |
|
2 | 4 | ||||||
| MIRT558332 | DNAJC28 | DnaJ heat shock protein family (Hsp40) member C28 | |
|
2 | 4 | ||||||
| MIRT558943 | CBX1 | chromobox 1 | |
|
2 | 2 | ||||||
| MIRT558965 | CAMLG | calcium modulating ligand | |
|
2 | 4 | ||||||
| MIRT559440 | ARSJ | arylsulfatase family member J | |
|
2 | 2 | ||||||
| MIRT561378 | TXNIP | thioredoxin interacting protein | |
|
2 | 2 | ||||||
| MIRT561646 | RUNX3 | runt related transcription factor 3 | |
|
2 | 2 | ||||||
| MIRT562223 | HMGB2 | high mobility group box 2 | |
|
2 | 2 | ||||||
| MIRT562560 | CCDC71L | coiled-coil domain containing 71 like | |
|
2 | 4 | ||||||
| MIRT562973 | LRPAP1 | LDL receptor related protein associated protein 1 | |
|
2 | 2 | ||||||
| MIRT563387 | DSPP | dentin sialophosphoprotein | |
|
2 | 2 | ||||||
| MIRT563439 | TRIM27 | tripartite motif containing 27 | |
|
2 | 2 | ||||||
| MIRT565554 | SMG1 | SMG1, nonsense mediated mRNA decay associated PI3K related kinase | |
|
2 | 2 | ||||||
| MIRT566879 | LRP12 | LDL receptor related protein 12 | |
|
2 | 2 | ||||||
| MIRT567051 | KCNB1 | potassium voltage-gated channel subfamily B member 1 | |
|
2 | 2 | ||||||
| MIRT567121 | ITGB1 | integrin subunit beta 1 | |
|
2 | 2 | ||||||
| MIRT567551 | FGFR1OP | FGFR1 oncogene partner | |
|
2 | 2 | ||||||
| MIRT567628 | FAM210A | family with sequence similarity 210 member A | |
|
2 | 2 | ||||||
| MIRT567785 | DGAT2 | diacylglycerol O-acyltransferase 2 | |
|
2 | 2 | ||||||
| MIRT567917 | CRK | CRK proto-oncogene, adaptor protein | |
|
2 | 2 | ||||||
| MIRT570955 | RBM12B | RNA binding motif protein 12B | |
|
2 | 2 | ||||||
| MIRT571022 | CKAP2 | cytoskeleton associated protein 2 | |
|
2 | 2 | ||||||
| MIRT571221 | F2R | coagulation factor II thrombin receptor | |
|
2 | 2 | ||||||
| MIRT571702 | RPRD2 | regulation of nuclear pre-mRNA domain containing 2 | |
|
2 | 2 | ||||||
| MIRT571732 | RPL17-C18orf32 | RPL17-C18orf32 readthrough | |
|
2 | 2 | ||||||
| MIRT571862 | NKIRAS1 | NFKB inhibitor interacting Ras like 1 | |
|
2 | 2 | ||||||
| MIRT572151 | DESI1 | desumoylating isopeptidase 1 | |
|
2 | 2 | ||||||
| MIRT572217 | C18orf32 | chromosome 18 open reading frame 32 | |
|
2 | 2 | ||||||
| MIRT573377 | LIMA1 | LIM domain and actin binding 1 | |
|
2 | 2 | ||||||
| MIRT573924 | SNAP47 | synaptosome associated protein 47 | |
|
2 | 2 | ||||||
| MIRT574720 | HAUS8 | HAUS augmin like complex subunit 8 | |
|
2 | 2 | ||||||
| MIRT575857 | Rab1 | RAB1A, member RAS oncogene family | |
1 | 1 | |||||||
| MIRT608982 | PRKCB | protein kinase C beta | |
|
2 | 2 | ||||||
| MIRT611007 | BRI3BP | BRI3 binding protein | |
|
2 | 2 | ||||||
| MIRT613680 | SH3KBP1 | SH3 domain containing kinase binding protein 1 | |
|
2 | 2 | ||||||
| MIRT615455 | FAXC | failed axon connections homolog | |
|
2 | 2 | ||||||
| MIRT615880 | MEMO1 | mediator of cell motility 1 | |
|
2 | 2 | ||||||
| MIRT616444 | FAM126B | family with sequence similarity 126 member B | |
|
2 | 2 | ||||||
| MIRT623529 | KCNK10 | potassium two pore domain channel subfamily K member 10 | |
|
2 | 2 | ||||||
| MIRT624425 | CBX8 | chromobox 8 | |
|
2 | 2 | ||||||
| MIRT625087 | C15orf41 | chromosome 15 open reading frame 41 | |
|
2 | 2 | ||||||
| MIRT634463 | PAK6 | p21 (RAC1) activated kinase 6 | |
|
2 | 2 | ||||||
| MIRT640011 | OSTM1 | osteopetrosis associated transmembrane protein 1 | |
|
2 | 2 | ||||||
| MIRT641801 | USP32 | ubiquitin specific peptidase 32 | |
|
2 | 2 | ||||||
| MIRT664802 | LIAS | lipoic acid synthetase | |
|
2 | 4 | ||||||
| MIRT682525 | GJD3 | gap junction protein delta 3 | |
|
2 | 2 | ||||||
| MIRT688719 | CPS1 | carbamoyl-phosphate synthase 1 | |
|
2 | 2 | ||||||
| MIRT693162 | THEM4 | thioesterase superfamily member 4 | |
|
2 | 2 | ||||||
| MIRT694572 | RBMXL1 | RNA binding motif protein, X-linked like 1 | |
|
2 | 2 | ||||||
| MIRT699679 | SFT2D2 | SFT2 domain containing 2 | |
|
2 | 2 | ||||||
| MIRT701600 | MYPN | myopalladin | |
|
2 | 2 | ||||||
| MIRT701967 | MINK1 | misshapen like kinase 1 | |
|
2 | 2 | ||||||
| MIRT702948 | HIPK3 | homeodomain interacting protein kinase 3 | |
|
2 | 2 | ||||||
| MIRT702962 | HIF1A | hypoxia inducible factor 1 alpha subunit | |
|
2 | 2 | ||||||
| MIRT709508 | RHOH | ras homolog family member H | |
|
2 | 2 | ||||||
| MIRT725232 | PEA15 | phosphoprotein enriched in astrocytes 15 | |
|
2 | 2 | ||||||
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|