miRTarBase - #MIRT123870


—
pre-miRNA Information
pre-miRNA hsa-mir-3180-1   
Genomic Coordinates chr16: 14911220 - 14911313
Description Homo sapiens miR-3180-1 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA hsa-mir-3180-2   
Genomic Coordinates chr16: 16309879 - 16309966
Description Homo sapiens miR-3180-2 stem-loop
Comment None
RNA Secondary Structure
pre-miRNA hsa-mir-3180-3   
Genomic Coordinates chr16: 18402178 - 18402271
Description Homo sapiens miR-3180-3 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3180-5p
Sequence 18| CUUCCAGACGCUCCGCCCCACGUCG |42
Evidence Experimental
Experiments Illumina
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol FZD6   
Synonyms FZ-6, FZ6, HFZ6, NDNC10
Description frizzled class receptor 6
Transcript NM_001164615   
Other Transcripts NM_001164616 , NM_003506   
Expression
Putative miRNA Targets on FZD6
3'UTR of FZD6
(miRNA target sites are highlighted)		 
>FZD6|NM_001164615|3'UTR
   1 AGAACATTTTCTCTCGTTACTCAGAAGCAAATTTGTGTTACACTGGAAGTGACCTATGCACTGTTTTGTAAGAATCACTG
  81 TTACATTCTTCTTTTGCACTTAAAGTTGCATTGCCTACTGTTATACTGGAAAAAATAGAGTTCAAGAATAATATGACTCA
 161 TTTCACACAAAGGTTAATGACAACAATATACCTGAAAACAGAAATGTGCAGGTTAATAATATTTTTTTAATAGTGTGGGA
 241 GGACAGAGTTAGAGGAATCTTCCTTTTCTATTTATGAAGATTCTACTCTTGGTAAGAGTATTTTAAGATGTACTATGCTA
 321 TTTTACTTTTTTGATATAAAATCAAGATATTTCTTTGCTGAAGTATTTAAATCTTATCCTTGTATCTTTTTATACATATT
 401 TGAAAATAAGCTTATATGTATTTGAACTTTTTTGAAATCCTATTCAAGTATTTTTATCATGCTATTGTGATATTTTAGCA
 481 CTTTGGTAGCTTTTACACTGAATTTCTAAGAAAATTGTAAAATAGTCTTCTTTTATACTGTAAAAAAAGATATACCAAAA
 561 AGTCTTATAATAGGAATTTAACTTTAAAAACCCACTTATTGATACCTTACCATCTAAAATGTGTGATTTTTATAGTCTCG
 641 TTTTAGGAATTTCACAGATCTAAATTATGTAACTGAAATAAGGTGCTTACTCAAAGAGTGTCCACTATTGATTGTATTAT
 721 GCTGCTCACTGATCCTTCTGCATATTTAAAATAAAATGTCCTAAAGGGTTAGTAGACAAAATGTTAGTCTTTTGTATATT
 801 AGGCCAAGTGCAATTGACTTCCCTTTTTTAATGTTTCATGACCACCCATTGATTGTATTATAACCACTTACAGTTGCTTA
 881 TATTTTTTGTTTTAACTTTTGTTTTTTAACATTTAGAATATTACATTTTGTATTATACAGTACCTTTCTCAGACATTTTG
 961 TAGAATTCATTTCGGCAGCTCACTAGGATTTTGCTGAACATTAAAAAGTGTGATAGCGATATTAGTGCCAATCAAATGGA
1041 AAAAAGGTAGTTTTAATAAACAAGACACAACGTTTTTATACAACATACTTTAAAATATTAAGGAGTTTTCTTAATTTTGT
1121 TTCCTATTAAGTATTATTCTTTGGGCAAGATTTTCTGATGCTTTTGATTTTCTCTCAATTTAGCATTTGCTTTTGGTTTT
1201 TTTCTCTATTTAGCATTCTGTTAAGGCACAAAAACTATGTACTGTATGGGAAATGTTGTAAATATTACCTTTTCCACATT
1281 TTAAACAGACAACTTTGAATACAAAAACTTTGTTTTGTGTGATCTTTTCATTAATAAAATTATCTTTGTATAAGAAAAAA
1361 AAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gcugcaccccgccucgcaGACCUUc 5'
                            |||||| 
Target 5' aagcaaatttgtgttacaCTGGAAg 3'
 25 - 49 120.00 -13.90
2 
miRNA  3' gcugcaccccgccucgcaGACCUUc 5'
                            |||||| 
Target 5' gcattgcctactgttataCTGGAAa 3'
 108 - 132 120.00 -8.10
3 
miRNA  3' gcugcaccccGCCUCGCAGACCUUc 5'
                    :| | :|| |||:| 
Target 5' acaaaaactaTGTACTGTATGGGAa 3'
 1228 - 1252 103.00 -7.10
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31532865 11 COSMIC
COSN30162732 14 COSMIC
COSN30165907 14 COSMIC
COSN26976932 23 COSMIC
COSN30538389 72 COSMIC
COSN17748687 89 COSMIC
COSN31558759 170 COSMIC
COSN30115185 187 COSMIC
COSN20105763 206 COSMIC
COSN27883597 415 COSMIC
COSN22187457 572 COSMIC
COSN24896780 659 COSMIC
COSN32057825 884 COSMIC
COSN29044457 1055 COSMIC
COSN21623381 1072 COSMIC
COSN17591425 1074 COSMIC
COSN28670831 1102 COSMIC
COSN26561826 1168 COSMIC
COSN5668764 1222 COSMIC
COSN31548689 1308 COSMIC
COSN21123903 1324 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs771707817 1 dbSNP
rs774893848 4 dbSNP
rs746461796 6 dbSNP
rs762772045 7 dbSNP
rs772994829 10 dbSNP
rs375233715 16 dbSNP
rs202151037 17 dbSNP
rs745515674 21 dbSNP
rs200202095 23 dbSNP
rs200403554 25 dbSNP
rs767708228 36 dbSNP
rs752732617 43 dbSNP
rs375750148 44 dbSNP
rs1390776903 45 dbSNP
rs1164501314 50 dbSNP
rs1459849574 55 dbSNP
rs1367299383 56 dbSNP
rs910955567 57 dbSNP
rs1478378328 61 dbSNP
rs1265578240 64 dbSNP
rs1191714488 67 dbSNP
rs775079407 76 dbSNP
rs1158430924 83 dbSNP
rs1211727466 84 dbSNP
rs1361553343 85 dbSNP
rs2934725 86 dbSNP
rs1299621945 89 dbSNP
rs970247879 101 dbSNP
rs1226157251 102 dbSNP
rs1331342054 103 dbSNP
rs1435160261 104 dbSNP
rs1384643717 106 dbSNP
rs980323449 110 dbSNP
rs1392883634 118 dbSNP
rs1274883789 119 dbSNP
rs922727017 124 dbSNP
rs765805800 125 dbSNP
rs1166518560 136 dbSNP
rs1475174470 137 dbSNP
rs773807060 162 dbSNP
rs1201083977 169 dbSNP
rs1431551303 170 dbSNP
rs768464864 185 dbSNP
rs35421828 202 dbSNP
rs796231490 202 dbSNP
rs763463112 203 dbSNP
rs202183884 206 dbSNP
rs550526662 213 dbSNP
rs766822353 223 dbSNP
rs893840152 244 dbSNP
rs1010847488 248 dbSNP
rs1345282590 252 dbSNP
rs984051667 270 dbSNP
rs190945010 271 dbSNP
rs1230412862 272 dbSNP
rs907614162 298 dbSNP
rs1369543930 300 dbSNP
rs1309390274 307 dbSNP
rs1045582849 311 dbSNP
rs1326120997 332 dbSNP
rs1403098424 336 dbSNP
rs1288019235 339 dbSNP
rs944488552 342 dbSNP
rs1409818865 343 dbSNP
rs1403141086 348 dbSNP
rs751902079 349 dbSNP
rs1040006453 354 dbSNP
rs905297334 358 dbSNP
rs1248468032 379 dbSNP
rs1179354230 381 dbSNP
rs1441453598 385 dbSNP
rs1438447006 409 dbSNP
rs1236355893 413 dbSNP
rs1004009565 420 dbSNP
rs900172400 425 dbSNP
rs931861615 441 dbSNP
rs755218973 442 dbSNP
rs1280504260 444 dbSNP
rs529787313 446 dbSNP
rs13273192 454 dbSNP
rs1346707039 458 dbSNP
rs566177819 461 dbSNP
rs999347514 466 dbSNP
rs1379754537 471 dbSNP
rs1278336752 472 dbSNP
rs960105698 480 dbSNP
rs1052734716 492 dbSNP
rs1404324410 500 dbSNP
rs1323662604 502 dbSNP
rs1433032434 519 dbSNP
rs1375132202 524 dbSNP
rs868069211 529 dbSNP
rs1159326309 536 dbSNP
rs1332307634 537 dbSNP
rs533546531 542 dbSNP
rs1308412762 543 dbSNP
rs983806856 555 dbSNP
rs567339455 557 dbSNP
rs1185545894 567 dbSNP
rs963835877 568 dbSNP
rs1355924623 587 dbSNP
rs1024268610 592 dbSNP
rs535316523 593 dbSNP
rs1350927706 602 dbSNP
rs1001520161 605 dbSNP
rs1357690412 612 dbSNP
rs147114928 612 dbSNP
rs1286310749 613 dbSNP
rs1456477348 614 dbSNP
rs1198627181 616 dbSNP
rs1239347824 621 dbSNP
rs1402108934 623 dbSNP
rs1442045688 626 dbSNP
rs922832875 632 dbSNP
rs570823999 641 dbSNP
rs983630462 642 dbSNP
rs538405054 646 dbSNP
rs1415942543 672 dbSNP
rs908044261 675 dbSNP
rs1474780290 688 dbSNP
rs965785669 692 dbSNP
rs1423866886 698 dbSNP
rs1052662948 700 dbSNP
rs976257128 709 dbSNP
rs1484692445 712 dbSNP
rs1185873472 715 dbSNP
rs921568266 716 dbSNP
rs931622687 727 dbSNP
rs1221740080 729 dbSNP
rs965219331 736 dbSNP
rs1368201862 740 dbSNP
rs1472295400 741 dbSNP
rs1043435776 744 dbSNP
rs925188304 754 dbSNP
rs915477348 763 dbSNP
rs1463626497 765 dbSNP
rs1334562340 767 dbSNP
rs946948227 769 dbSNP
rs1220621206 773 dbSNP
rs1360145853 774 dbSNP
rs1045087955 776 dbSNP
rs905161064 793 dbSNP
rs935277362 796 dbSNP
rs1052239513 798 dbSNP
rs1310383000 800 dbSNP
rs1339648182 801 dbSNP
rs756095977 804 dbSNP
rs1323862466 812 dbSNP
rs1245854135 817 dbSNP
rs1400706841 821 dbSNP
rs1286158299 825 dbSNP
rs1316246248 833 dbSNP
rs1426355529 835 dbSNP
rs556506602 847 dbSNP
rs1418438150 849 dbSNP
rs1191239268 862 dbSNP
rs1478754993 871 dbSNP
rs1250627087 873 dbSNP
rs1468434623 879 dbSNP
rs1259037341 882 dbSNP
rs1207131380 883 dbSNP
rs7827146 884 dbSNP
rs1295174108 899 dbSNP
rs895687169 906 dbSNP
rs993989464 912 dbSNP
rs1025458388 918 dbSNP
rs1199234004 921 dbSNP
rs79043564 922 dbSNP
rs1266018961 927 dbSNP
rs1005847263 934 dbSNP
rs1460311381 937 dbSNP
rs757109658 947 dbSNP
rs1017942388 949 dbSNP
rs1443330071 956 dbSNP
rs768441390 959 dbSNP
rs1045781451 961 dbSNP
rs905982766 968 dbSNP
rs1189990470 972 dbSNP
rs1001490410 973 dbSNP
rs184082629 975 dbSNP
rs572419216 976 dbSNP
rs1029812384 978 dbSNP
rs956890732 980 dbSNP
rs1479890739 981 dbSNP
rs952296491 982 dbSNP
rs1251127040 998 dbSNP
rs186924860 1002 dbSNP
rs1423701306 1013 dbSNP
rs915382635 1018 dbSNP
rs778777161 1019 dbSNP
rs76714224 1020 dbSNP
rs1377514935 1021 dbSNP
rs1309125265 1026 dbSNP
rs1389630220 1028 dbSNP
rs976305760 1031 dbSNP
rs1300976804 1034 dbSNP
rs1401296016 1035 dbSNP
rs1396416100 1039 dbSNP
rs1335898440 1040 dbSNP
rs1338724240 1041 dbSNP
rs1372297369 1041 dbSNP
rs1218185847 1049 dbSNP
rs2687355 1054 dbSNP
rs1373294496 1056 dbSNP
rs771760919 1068 dbSNP
rs939340612 1068 dbSNP
rs544382326 1073 dbSNP
rs897894611 1074 dbSNP
rs191610713 1076 dbSNP
rs1250173042 1078 dbSNP
rs1346276667 1090 dbSNP
rs1202548005 1094 dbSNP
rs1058130 1102 dbSNP
rs1487135833 1106 dbSNP
rs1255724796 1109 dbSNP
rs1192472063 1115 dbSNP
rs1046938550 1119 dbSNP
rs1263320256 1121 dbSNP
rs888241477 1128 dbSNP
rs1316287644 1132 dbSNP
rs771844178 1133 dbSNP
rs1173286021 1135 dbSNP
rs1005506493 1136 dbSNP
rs529794479 1141 dbSNP
rs1018598874 1146 dbSNP
rs899524179 1147 dbSNP
rs1400248133 1148 dbSNP
rs1466430767 1151 dbSNP
rs1286615311 1176 dbSNP
rs1175298083 1194 dbSNP
rs935221220 1196 dbSNP
rs183064316 1198 dbSNP
rs1399702900 1199 dbSNP
rs143515079 1208 dbSNP
rs956470244 1212 dbSNP
rs917870942 1227 dbSNP
rs187081989 1230 dbSNP
rs1187447834 1231 dbSNP
rs746553277 1241 dbSNP
rs968620326 1243 dbSNP
rs1332192574 1246 dbSNP
rs1236048931 1255 dbSNP
rs1485498092 1257 dbSNP
rs905948665 1271 dbSNP
rs768030117 1289 dbSNP
rs1265999042 1292 dbSNP
rs1234877970 1302 dbSNP
rs981081323 1310 dbSNP
rs1215504424 1319 dbSNP
rs926856315 1326 dbSNP
rs1218789314 1332 dbSNP
rs527259038 1335 dbSNP
rs1327844788 1339 dbSNP
rs1292818825 1350 dbSNP
rs1384845453 1352 dbSNP
rs191837768 1355 dbSNP
rs1463506628 1356 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000358755.4 | 3UTR | AAUCACUGUUACAUUCUUCUUUUGCACUUAAAGUUGCAUUGCCUACUGUUAUACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
126 hsa-miR-3180-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT088042 UBXN2A UBX domain protein 2A 2 2
MIRT092741 SETD5 SET domain containing 5 2 4
MIRT123870 FZD6 frizzled class receptor 6 2 2
MIRT134588 GXYLT1 glucoside xylosyltransferase 1 2 2
MIRT174919 RNF38 ring finger protein 38 2 2
MIRT232088 CCSAP centriole, cilia and spindle associated protein 2 2
MIRT257503 HIST1H2AH histone cluster 1 H2A family member h 2 2
MIRT332968 CELF1 CUGBP Elav-like family member 1 2 4
MIRT441902 SEPN1 selenoprotein N 2 2
MIRT443231 ALG8 ALG8, alpha-1,3-glucosyltransferase 2 2
MIRT446243 ELP2 elongator acetyltransferase complex subunit 2 2 2
MIRT447999 GPR63 G protein-coupled receptor 63 2 2
MIRT458203 FOXL2 forkhead box L2 2 2
MIRT461680 ZNF426 zinc finger protein 426 2 2
MIRT462650 HMOX1 heme oxygenase 1 2 4
MIRT462850 UBR7 ubiquitin protein ligase E3 component n-recognin 7 (putative) 2 2
MIRT464366 URM1 ubiquitin related modifier 1 2 2
MIRT466852 STX6 syntaxin 6 2 2
MIRT468228 SGK1 serum/glucocorticoid regulated kinase 1 2 2
MIRT472037 NPAT nuclear protein, coactivator of histone transcription 2 2
MIRT481535 ARL5B ADP ribosylation factor like GTPase 5B 2 2
MIRT482639 RPL18A ribosomal protein L18a 2 2
MIRT498085 SEMA7A semaphorin 7A (John Milton Hagen blood group) 2 2
MIRT498273 POFUT1 protein O-fucosyltransferase 1 2 2
MIRT506560 MNX1 motor neuron and pancreas homeobox 1 2 4
MIRT507153 GATA6 GATA binding protein 6 2 4
MIRT507447 EIF6 eukaryotic translation initiation factor 6 2 2
MIRT507565 DEK DEK proto-oncogene 2 2
MIRT519629 ZNF772 zinc finger protein 772 2 4
MIRT527689 IL17REL interleukin 17 receptor E like 2 2
MIRT528200 NELFE negative elongation factor complex member E 2 2
MIRT528528 CYP2C19 cytochrome P450 family 2 subfamily C member 19 2 4
MIRT528871 ATF3 activating transcription factor 3 2 2
MIRT529121 HOMEZ homeobox and leucine zipper encoding 2 2
MIRT529479 TPD52L3 tumor protein D52 like 3 2 2
MIRT530757 ZNF582 zinc finger protein 582 2 2
MIRT530897 C9orf3 chromosome 9 open reading frame 3 2 2
MIRT531495 NONO non-POU domain containing octamer binding 2 2
MIRT531927 IL12RB2 interleukin 12 receptor subunit beta 2 2 2
MIRT532343 PLEK pleckstrin 2 2
MIRT532817 ZNF827 zinc finger protein 827 2 2
MIRT533516 TRIM13 tripartite motif containing 13 2 2
MIRT534275 SLC12A7 solute carrier family 12 member 7 2 2
MIRT534480 SAR1B secretion associated Ras related GTPase 1B 2 2
MIRT537351 FJX1 four jointed box 1 2 2
MIRT538799 C2CD5 C2 calcium dependent domain containing 5 2 2
MIRT538842 BTG1 BTG anti-proliferation factor 1 2 2
MIRT539266 ANKRD28 ankyrin repeat domain 28 2 2
MIRT543401 ANAPC13 anaphase promoting complex subunit 13 2 2
MIRT552637 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT556033 MXD1 MAX dimerization protein 1 2 2
MIRT556449 LMNB2 lamin B2 2 4
MIRT562448 CSDE1 cold shock domain containing E1 2 2
MIRT567281 HNRNPL heterogeneous nuclear ribonucleoprotein L 2 2
MIRT574050 PROSC pyridoxal phosphate binding protein 2 2
MIRT575658 Map1b microtubule-associated protein 1B 2 2
MIRT606823 APBB2 amyloid beta precursor protein binding family B member 2 2 2
MIRT609583 GPM6B glycoprotein M6B 2 2
MIRT609678 TMEM213 transmembrane protein 213 2 2
MIRT611221 ZNF274 zinc finger protein 274 2 2
MIRT612577 SYNGAP1 synaptic Ras GTPase activating protein 1 2 4
MIRT613583 MDGA2 MAM domain containing glycosylphosphatidylinositol anchor 2 2 2
MIRT614394 C11orf45 chromosome 11 open reading frame 45 2 2
MIRT615558 JPH2 junctophilin 2 2 2
MIRT615850 RASGRP1 RAS guanyl releasing protein 1 2 2
MIRT615906 C1orf27 chromosome 1 open reading frame 27 2 2
MIRT615932 MAP1LC3B microtubule associated protein 1 light chain 3 beta 2 2
MIRT617632 RXRA retinoid X receptor alpha 2 2
MIRT618745 CNNM3 cyclin and CBS domain divalent metal cation transport mediator 3 2 2
MIRT622073 SRPX2 sushi repeat containing protein, X-linked 2 2 2
MIRT624390 CD3D CD3d molecule 2 2
MIRT634656 GRIN2B glutamate ionotropic receptor NMDA type subunit 2B 2 2
MIRT636717 AQR aquarius intron-binding spliceosomal factor 2 2
MIRT638033 SHPK sedoheptulokinase 2 2
MIRT638543 KIAA1549 KIAA1549 2 2
MIRT638754 EPHA4 EPH receptor A4 2 2
MIRT639223 IMMP2L inner mitochondrial membrane peptidase subunit 2 2 2
MIRT641774 ZFP91 ZFP91 zinc finger protein 2 2
MIRT643672 CEP78 centrosomal protein 78 2 2
MIRT645851 AFF2 AF4/FMR2 family member 2 2 2
MIRT646021 S100A7A S100 calcium binding protein A7A 2 2
MIRT646071 NDUFS2 NADH:ubiquinone oxidoreductase core subunit S2 2 2
MIRT646730 FADS1 fatty acid desaturase 1 2 2
MIRT646742 MUC4 mucin 4, cell surface associated 2 2
MIRT647563 ZNF660 zinc finger protein 660 2 2
MIRT648539 TMEM169 transmembrane protein 169 2 2
MIRT650852 UNC13D unc-13 homolog D 2 2
MIRT650872 PPP1R15A protein phosphatase 1 regulatory subunit 15A 2 2
MIRT652345 TMOD3 tropomodulin 3 2 2
MIRT653451 SLC6A17 solute carrier family 6 member 17 2 2
MIRT654750 PRKCB protein kinase C beta 2 2
MIRT655569 OXSR1 oxidative stress responsive 1 2 2
MIRT656547 LZIC leucine zipper and CTNNBIP1 domain containing 2 2
MIRT657212 IGF1R insulin like growth factor 1 receptor 2 2
MIRT657740 GNG12 G protein subunit gamma 12 2 2
MIRT659225 CXorf23 BCLAF1 and THRAP3 family member 3 2 2
MIRT659272 CTNNBIP1 catenin beta interacting protein 1 2 2
MIRT660822 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT666123 SRCIN1 SRC kinase signaling inhibitor 1 2 2
MIRT666608 REEP2 receptor accessory protein 2 2 2
MIRT668974 CLSTN2 calsyntenin 2 2 2
MIRT678890 TTLL12 tubulin tyrosine ligase like 12 2 2
MIRT683998 FOLR1 folate receptor 1 2 2
MIRT685672 PSMB7 proteasome subunit beta 7 2 2
MIRT689095 ZBTB25 zinc finger and BTB domain containing 25 2 2
MIRT690645 RPF2 ribosome production factor 2 homolog 2 2
MIRT697740 USP5 ubiquitin specific peptidase 5 2 2
MIRT698823 STARD7 StAR related lipid transfer domain containing 7 2 2
MIRT699886 RUNX1 runt related transcription factor 1 2 2
MIRT700010 RPP25 ribonuclease P and MRP subunit p25 2 2
MIRT706001 ABCC1 ATP binding cassette subfamily C member 1 2 2
MIRT708394 XKR7 XK related 7 2 2
MIRT708517 TOP2B DNA topoisomerase II beta 2 2
MIRT709215 PARD3B par-3 family cell polarity regulator beta 2 2
MIRT710154 MTRF1L mitochondrial translational release factor 1 like 2 2
MIRT711069 NLGN2 neuroligin 2 2 2
MIRT714631 TM4SF18 transmembrane 4 L six family member 18 2 2
MIRT715418 SPOPL speckle type BTB/POZ protein like 2 2
MIRT716612 RBM18 RNA binding motif protein 18 2 2
MIRT718658 HNF4A hepatocyte nuclear factor 4 alpha 2 2
MIRT718929 TRIM66 tripartite motif containing 66 2 2
MIRT720637 ELF5 E74 like ETS transcription factor 5 2 2
MIRT720782 PRKRIP1 PRKR interacting protein 1 2 2
MIRT721285 TRABD2A TraB domain containing 2A 2 2
MIRT721337 LIF LIF, interleukin 6 family cytokine 2 2
MIRT722891 LRRC20 leucine rich repeat containing 20 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-3180-5p Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-3180 Fluorouracil 3385 NSC19893 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-3180 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-3180 Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-3180 Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-3180 Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-3180 Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-3180 Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (AsPC-1)
hsa-miR-3180 Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (MGC803)
hsa-miR-3180 Cisplatin 5460033 NSC119875 approved sensitive cell line
hsa-miR-3180 Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-3180 Tamoxifen 2733525 NSC180973 approved sensitive cell line (LCC2)
hsa-miR-3180 Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-3180 Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-3180 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3180-5p Paclitaxel 36314 NSC125973 approved sensitive High Non-Small Cell Lung Cancer cell line (H460)
hsa-miR-3180-5p Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MDA-MB-231, MCF-7)
hsa-miR-3180-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-3180-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-3180-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-3180-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3180-5p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-3180-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)

Error report submission