pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-6830 |
Genomic Coordinates | chr5: 132217849 - 132217918 |
Description | Homo sapiens miR-6830 stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | |||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-6830-3p | ||||||||||||||||||||||||
Sequence | 48| UGUCUUUCUUCUCUCCCUUGCAG |70 | ||||||||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||||||||
Experiments | Meta-analysis | ||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||
Putative Targets |
Gene Information | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | IER5 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Synonyms | SBBI48 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Description | immediate early response 5 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Transcript | NM_016545 | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Expression | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Putative miRNA Targets on IER5 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3'UTR of IER5 (miRNA target sites are highlighted) |
>IER5|NM_016545|3'UTR 1 GCCCTTGGCCCCCCTGCGGGGAGGAGGTGGAGCAGCGGGCGTCCCCGAAGTGAGGGCCAGGCCCTTCCCGGCTGCGAGGA 81 CGCCCAGAGACCGCGGGCGCTGAGCGCGTTGGGCAGACTGGTTGCCTCTGGGCATCGCAAACTGCCCCCGGGCGCATCTG 161 GCTTATCTGGAGACCTGGGAGCTTGAGGCTCATTGGAAGAGGACGATCGTTAACTTTTGTGTTTGTGTATGTCTGTGTAT 241 GTAAGTTTGTCTTGTGGCATTAAGACTATTTTGCTCTTCTGGAATGCACCACTCCTTCCCCAGGGTTTAAGAGATTGGGG 321 GCAGACAGGGACTTTCCTCTGCCGGCTGCGTGGAGAAGGAAGCGGCTAAAAGGTTTGGGCCGGGGAGTTCCCCATTCGTT 401 CTCCGGGGAGGGAGGGACTTTACACCTACCCCTCACCGGAAAGCTAGACCCGCTTCAGGGCCAGGAGTGGCGTTTCCGCA 481 CAGGATTTCCTAAGACGAGAGGGATTTAGCCAAGAGCACAGACTTGGATTCCTTCTGTCCCTCCCCACCTTTCTCTCCCA 561 ATGAAGAAACGTTTATATCCTGTGATTACTCTAGGAAAGGGGCGTATTAACGGTCCTTTGCTTCCCCGCAGGGGAGAAAA 641 AGCTTGACGAACTTCACAGAAGAGTTCAAGCTTGGAAATAATGGAGTTTATAGAGAAAAGATATATTTTTAAAAGCTCTA 721 GGTCAGAAGTACTACACAGTGCTTTTAAAAAGTGTTTAATGAGAGTTTACAGACAGAAGCCCGAAGTGGAAAGACCTTAT 801 GGTTTTGTAGATATGGTGACTCCAGTCTTTGTTGTATAAAGGTTGGGGGAGCTGATAAGGTTTTTGTACAGTATTTTCTC 881 CTTCGTTGTATTGATTTTTGTATAAAAATGTAACTTCTACGTGTCTAACACGTATTAAATATTTTGAAGCAACGTAAAAA 961 AAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
DRVs in gene 3'UTRs |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
SNPs in gene 3'UTRs |
|
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293S | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
HITS-CLIP data was present in GSM1084065. RNA binding protein: AGO2. Condition:CLIP_emetine_AbnovaAb
... - Karginov FV; Hannon GJ, 2013, Genes & development. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Karginov FV; Hannon GJ - Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
|
CLIP-seq Support 1 for dataset GSM1084065 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293S / CLIP_emetine_AbnovaAb |
Location of target site | ENST00000367577.4 | 3UTR | AAAAGAUGGGAGAGAUUGAAGAAAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23824327 / GSE44404 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
82 hsa-miR-6830-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT081461 | SSBP4 | single stranded DNA binding protein 4 | 2 | 2 | ||||||||
MIRT132029 | IER5 | immediate early response 5 | 2 | 2 | ||||||||
MIRT187279 | DAZAP2 | DAZ associated protein 2 | 2 | 6 | ||||||||
MIRT350303 | TMEM189-UBE2V1 | TMEM189-UBE2V1 readthrough | 2 | 8 | ||||||||
MIRT350307 | UBE2V1 | ubiquitin conjugating enzyme E2 V1 | 2 | 8 | ||||||||
MIRT372105 | EIF3H | eukaryotic translation initiation factor 3 subunit H | 2 | 2 | ||||||||
MIRT408159 | DCK | deoxycytidine kinase | 2 | 4 | ||||||||
MIRT442623 | LOX | lysyl oxidase | 2 | 2 | ||||||||
MIRT442952 | ASXL2 | additional sex combs like 2, transcriptional regulator | 2 | 2 | ||||||||
MIRT469401 | REL | REL proto-oncogene, NF-kB subunit | 2 | 6 | ||||||||
MIRT476631 | G2E3 | G2/M-phase specific E3 ubiquitin protein ligase | 2 | 2 | ||||||||
MIRT485039 | TMEM189 | transmembrane protein 189 | 2 | 8 | ||||||||
MIRT485133 | RASSF8 | Ras association domain family member 8 | 2 | 6 | ||||||||
MIRT498963 | ORC4 | origin recognition complex subunit 4 | 2 | 8 | ||||||||
MIRT500082 | L2HGDH | L-2-hydroxyglutarate dehydrogenase | 2 | 8 | ||||||||
MIRT503018 | CAND1 | cullin associated and neddylation dissociated 1 | 2 | 2 | ||||||||
MIRT503374 | SCAMP1 | secretory carrier membrane protein 1 | 2 | 2 | ||||||||
MIRT504975 | ZNF711 | zinc finger protein 711 | 2 | 2 | ||||||||
MIRT518984 | NNT | nicotinamide nucleotide transhydrogenase | 2 | 4 | ||||||||
MIRT520754 | TFDP1 | transcription factor Dp-1 | 2 | 6 | ||||||||
MIRT526785 | SGCD | sarcoglycan delta | 2 | 2 | ||||||||
MIRT533868 | TBL1XR1 | transducin beta like 1 X-linked receptor 1 | 2 | 2 | ||||||||
MIRT535107 | PMEPA1 | prostate transmembrane protein, androgen induced 1 | 2 | 2 | ||||||||
MIRT538991 | BAG4 | BCL2 associated athanogene 4 | 2 | 2 | ||||||||
MIRT543518 | PRSS21 | protease, serine 21 | 2 | 2 | ||||||||
MIRT543813 | SNX10 | sorting nexin 10 | 2 | 2 | ||||||||
MIRT543825 | GSG1 | germ cell associated 1 | 2 | 2 | ||||||||
MIRT545334 | CCDC83 | coiled-coil domain containing 83 | 2 | 2 | ||||||||
MIRT545669 | DECR1 | 2,4-dienoyl-CoA reductase 1 | 2 | 2 | ||||||||
MIRT547798 | KAT7 | lysine acetyltransferase 7 | 2 | 2 | ||||||||
MIRT548068 | GIGYF1 | GRB10 interacting GYF protein 1 | 2 | 2 | ||||||||
MIRT549577 | ZNF850 | zinc finger protein 850 | 2 | 2 | ||||||||
MIRT550753 | ENTPD1 | ectonucleoside triphosphate diphosphohydrolase 1 | 2 | 2 | ||||||||
MIRT550808 | FAM229B | family with sequence similarity 229 member B | 2 | 2 | ||||||||
MIRT551457 | CARKD | NAD(P)HX dehydratase | 2 | 2 | ||||||||
MIRT551852 | RPS3 | ribosomal protein S3 | 2 | 2 | ||||||||
MIRT554218 | SLC30A1 | solute carrier family 30 member 1 | 2 | 2 | ||||||||
MIRT556588 | LEPROT | leptin receptor overlapping transcript | 2 | 2 | ||||||||
MIRT557344 | HDGF | heparin binding growth factor | 2 | 4 | ||||||||
MIRT571945 | LARP1 | La ribonucleoprotein domain family member 1 | 2 | 2 | ||||||||
MIRT574374 | YY1 | YY1 transcription factor | 2 | 2 | ||||||||
MIRT611142 | CRISP1 | cysteine rich secretory protein 1 | 2 | 4 | ||||||||
MIRT611799 | FCRL4 | Fc receptor like 4 | 2 | 2 | ||||||||
MIRT612834 | KCNN3 | potassium calcium-activated channel subfamily N member 3 | 2 | 2 | ||||||||
MIRT617257 | GLIPR1L2 | GLI pathogenesis related 1 like 2 | 2 | 2 | ||||||||
MIRT619781 | NRIP2 | nuclear receptor interacting protein 2 | 2 | 2 | ||||||||
MIRT620440 | SEMA3E | semaphorin 3E | 2 | 2 | ||||||||
MIRT621725 | TNR | tenascin R | 2 | 2 | ||||||||
MIRT622905 | PCDH17 | protocadherin 17 | 2 | 2 | ||||||||
MIRT623428 | KLF6 | Kruppel like factor 6 | 2 | 2 | ||||||||
MIRT627856 | PITPNM3 | PITPNM family member 3 | 2 | 2 | ||||||||
MIRT633894 | FGF10 | fibroblast growth factor 10 | 2 | 2 | ||||||||
MIRT636257 | SEC24D | SEC24 homolog D, COPII coat complex component | 2 | 2 | ||||||||
MIRT640654 | FRY | FRY microtubule binding protein | 2 | 2 | ||||||||
MIRT640857 | TSHZ2 | teashirt zinc finger homeobox 2 | 2 | 4 | ||||||||
MIRT641220 | LRCH1 | leucine rich repeats and calponin homology domain containing 1 | 2 | 2 | ||||||||
MIRT642526 | ANKRD9 | ankyrin repeat domain 9 | 2 | 2 | ||||||||
MIRT646011 | TNFAIP8L2 | TNF alpha induced protein 8 like 2 | 2 | 2 | ||||||||
MIRT653317 | SMOC1 | SPARC related modular calcium binding 1 | 2 | 2 | ||||||||
MIRT657940 | GATM | glycine amidinotransferase | 2 | 2 | ||||||||
MIRT658291 | FAM83F | family with sequence similarity 83 member F | 2 | 2 | ||||||||
MIRT660607 | ANTXR2 | anthrax toxin receptor 2 | 2 | 2 | ||||||||
MIRT664675 | LMBR1L | limb development membrane protein 1 like | 2 | 2 | ||||||||
MIRT664889 | PRRG4 | proline rich and Gla domain 4 | 2 | 2 | ||||||||
MIRT666972 | PHF20L1 | PHD finger protein 20 like 1 | 2 | 2 | ||||||||
MIRT669128 | CD200 | CD200 molecule | 2 | 2 | ||||||||
MIRT673267 | RUNDC1 | RUN domain containing 1 | 2 | 2 | ||||||||
MIRT704609 | CLN8 | CLN8, transmembrane ER and ERGIC protein | 2 | 2 | ||||||||
MIRT709404 | TADA2A | transcriptional adaptor 2A | 2 | 2 | ||||||||
MIRT710963 | CMKLR1 | chemerin chemokine-like receptor 1 | 2 | 2 | ||||||||
MIRT711745 | DTX1 | deltex E3 ubiquitin ligase 1 | 2 | 2 | ||||||||
MIRT715009 | CYP1B1 | cytochrome P450 family 1 subfamily B member 1 | 2 | 2 | ||||||||
MIRT715467 | NEGR1 | neuronal growth regulator 1 | 2 | 2 | ||||||||
MIRT715737 | CD226 | CD226 molecule | 2 | 2 | ||||||||
MIRT716526 | KSR2 | kinase suppressor of ras 2 | 2 | 2 | ||||||||
MIRT718311 | TMPRSS11B | transmembrane protease, serine 11B | 2 | 2 | ||||||||
MIRT719006 | TMEM184C | transmembrane protein 184C | 2 | 2 | ||||||||
MIRT719319 | STAC | SH3 and cysteine rich domain | 2 | 2 | ||||||||
MIRT722092 | SUSD1 | sushi domain containing 1 | 2 | 2 | ||||||||
MIRT723198 | TNRC6C | trinucleotide repeat containing 6C | 2 | 2 | ||||||||
MIRT723239 | BTLA | B and T lymphocyte associated | 2 | 2 | ||||||||
MIRT724850 | IGFBP5 | insulin like growth factor binding protein 5 | 2 | 2 |