miRTarBase - #MIRT135023


—
pre-miRNA Information
pre-miRNA hsa-mir-548g   
Genomic Coordinates chr4: 147344629 - 147344717
Synonyms MIRN548G, hsa-mir-548g, MIR548G
Description Homo sapiens miR-548g stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-548g-5p
Sequence 15| UGCAAAAGUAAUUGCAGUUUUUG |37
Evidence Not_experimental
Experiments
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 4 - 147344700 29233923 MiREDiBase
A-to-I 7 4 - 147344697 29233923 MiREDiBase
A-to-I 16 4 - 147344688 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1428532945 1 dbSNP
rs749197968 2 dbSNP
rs1271780804 3 dbSNP
rs375562730 4 dbSNP
rs1340837915 12 dbSNP
rs1222552086 20 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ADSS   
Synonyms ADEH, ADSS 2
Description adenylosuccinate synthase
Transcript NM_001126   
Expression
Putative miRNA Targets on ADSS
3'UTR of ADSS
(miRNA target sites are highlighted)		 
>ADSS|NM_001126|3'UTR
   1 TGATTGCCAGTAATGCAAGAAACACTCCTTGAGAGGGAGGGGAAAAGACTTTCTTAAATATTTCATTTATGACCTGCAAA
  81 TTCAAGAATAAAGACACTGAAGTAAGTTTGAAGCCCTACAGTTGTTTCCAGTCTTTTCAGATGGATGCCTACTGTGGAGA
 161 TTAACTTTGGCATATTCCAGTGTCAGCTTTCTTTAGCTGGAATTGCCAAATCATTTGTTGCTCCTGCTGCTCTCATGGTG
 241 CCACGTTTTTTTTTTCAATGTTTAGTAATAGTATAATCCATGTTGTTTGATATCAAAAGTAGAATTACTTTTAATGTAGT
 321 TTTTCTTCATTATTGTCATTGCGTGTTCTTAAGTTTTACCCCTATTAGATGGTAAGAACAATTAATGCAGTTTTGCACAA
 401 ATATTTTTACATTCTGATCATTCAGTTCTGTCATTGTAATCTTTGTTGTTAGAAACAAATGATGAAAACATAGGGGTTCT
 481 GTAAACTTTTGTAATGCTATGAATTCTGTTTAAATTTTGGGCTGTCTATTTTCTGCTGAAACCATGCAAAATTGAGCTTT
 561 GGTGGGGCTGGGAGGGGGTTATGTATTCATGGGACCTTTAATTTGTACAGAACACAGAACTTATTTCTGTCAGTTATTTA
 641 ATACATTGAAAATTTAGTGAAATGTTCAAAGAGAATAGATGTTTCCCAAAACAACAATCTTTATGTTAAAAATAGTCATT
 721 AAAAGATCTGTTGTAATATATGGTGGATATTTTTCTTTAATTTCAAACATTACCTCTGAAATGTGTATCTTTTCTTTTTT
 801 ATCTTACCATTAATTTTAAATCTAGTGGATTGGTTTTCAACATCGTGCCTGCCGATATGCCTACAGAATCATCTGTAAGT
 881 GTCAAAATGAACCCACGTTGTTAGCCATAATTTTGATTATGCCTTTATTTCTCCTTTCTTGAAAAAAAAAAGGTGTTATT
 961 TTGACAATTAGGCATAACATTGTTTTGTAGATTATCTTTTAATGAACTATTTTAAATGTTAAATTAGGTGCCACTTAAAT
1041 TTATTTTATTACACCATGAATAGCTGATTAAAAGAACCAAATATTTCTAGTATGAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' guuuuuGACGUUAAUGAAAACGu 5'
                |||:||  |||||||: 
Target 5' ggggttCTGTAA--ACTTTTGTa 3'
 473 - 493 145.00 -12.70
2 
miRNA  3' guUUUUGACGUUAAUGAAAAcgu 5'
            |||| |  ||||||||||   
Target 5' tcAAAAGTAGAATTACTTTTaat 3'
 293 - 315 141.00 -9.02
3 
miRNA  3' guuuuUGACG---UUAA-UGAAAACGu 5'
               ||||:   :||| ||||| || 
Target 5' tgcctACTGTGGAGATTAACTTTGGCa 3'
 146 - 172 130.00 -8.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30186031 2 COSMIC
COSN30451475 28 COSMIC
COSN13531264 35 COSMIC
COSN30147579 37 COSMIC
COSN31585735 47 COSMIC
COSN30452228 64 COSMIC
COSN30504775 66 COSMIC
COSN26565673 97 COSMIC
COSN30514927 97 COSMIC
COSN30502043 104 COSMIC
COSN30511050 129 COSMIC
COSN20096208 245 COSMIC
COSN15662456 307 COSMIC
COSN8453261 473 COSMIC
COSN26665123 616 COSMIC
COSN21461186 625 COSMIC
COSN30169504 706 COSMIC
COSN30543715 743 COSMIC
COSN31564826 755 COSMIC
COSN1440495 763 COSMIC
COSN20729400 832 COSMIC
COSN20096207 941 COSMIC
COSN29329295 1011 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs775010741 9 dbSNP
rs763477587 10 dbSNP
rs1482569529 12 dbSNP
rs773613590 17 dbSNP
rs769381301 22 dbSNP
rs1361862529 24 dbSNP
rs142770938 25 dbSNP
rs768237912 27 dbSNP
rs746467727 28 dbSNP
rs1323018600 34 dbSNP
rs901724210 35 dbSNP
rs1310738906 37 dbSNP
rs1223307603 38 dbSNP
rs1314012935 39 dbSNP
rs779975384 41 dbSNP
rs1348954085 42 dbSNP
rs758332023 43 dbSNP
rs750263853 46 dbSNP
rs756959937 48 dbSNP
rs752982808 49 dbSNP
rs536580352 51 dbSNP
rs1241668453 53 dbSNP
rs1488760194 56 dbSNP
rs1192793707 58 dbSNP
rs999478620 70 dbSNP
rs1479965477 76 dbSNP
rs1159661576 82 dbSNP
rs372936425 84 dbSNP
rs1413670921 85 dbSNP
rs1335879577 88 dbSNP
rs1322306332 90 dbSNP
rs1157754299 102 dbSNP
rs369919965 114 dbSNP
rs1437989647 145 dbSNP
rs1295758570 149 dbSNP
rs1366138500 151 dbSNP
rs1404693543 152 dbSNP
rs1045518459 154 dbSNP
rs1043474934 160 dbSNP
rs111320617 161 dbSNP
rs1304136442 166 dbSNP
rs1331481989 167 dbSNP
rs148535556 168 dbSNP
rs1283845073 175 dbSNP
rs915988741 180 dbSNP
rs1160564978 185 dbSNP
rs1470616522 186 dbSNP
rs1223909757 190 dbSNP
rs547499743 205 dbSNP
rs1196825982 214 dbSNP
rs1449804994 221 dbSNP
rs767953645 229 dbSNP
rs1222989578 232 dbSNP
rs755371449 236 dbSNP
rs1414102346 241 dbSNP
rs1283589466 243 dbSNP
rs752116051 244 dbSNP
rs556782598 245 dbSNP
rs1424663147 255 dbSNP
rs201400497 256 dbSNP
rs398103917 256 dbSNP
rs76040005 256 dbSNP
rs1408392790 257 dbSNP
rs1350931488 258 dbSNP
rs1279149333 271 dbSNP
rs972275098 273 dbSNP
rs113711112 275 dbSNP
rs536837642 279 dbSNP
rs1310752165 281 dbSNP
rs1284432919 285 dbSNP
rs962291660 291 dbSNP
rs1358626234 293 dbSNP
rs3087609 307 dbSNP
rs551409330 316 dbSNP
rs778369211 320 dbSNP
rs953125432 320 dbSNP
rs1203582733 331 dbSNP
rs1029164983 332 dbSNP
rs1473595764 333 dbSNP
rs1179607418 337 dbSNP
rs944413169 338 dbSNP
rs1449561621 341 dbSNP
rs767687620 342 dbSNP
rs192048704 343 dbSNP
rs1408525565 345 dbSNP
rs544085026 362 dbSNP
rs965861681 362 dbSNP
rs1401693992 364 dbSNP
rs1359932122 372 dbSNP
rs1450531971 374 dbSNP
rs986287338 386 dbSNP
rs1030869108 397 dbSNP
rs1170896134 401 dbSNP
rs1481434886 404 dbSNP
rs999426115 420 dbSNP
rs1340025044 426 dbSNP
rs903790016 461 dbSNP
rs953552360 461 dbSNP
rs565636331 462 dbSNP
rs548686962 469 dbSNP
rs1477454207 489 dbSNP
rs1043027809 490 dbSNP
rs915495189 492 dbSNP
rs1242154110 493 dbSNP
rs1464924895 495 dbSNP
rs1011993362 503 dbSNP
rs763195509 517 dbSNP
rs188643354 522 dbSNP
rs1426242584 528 dbSNP
rs761772668 528 dbSNP
rs938796038 532 dbSNP
rs183595622 536 dbSNP
rs1003565295 544 dbSNP
rs928787374 547 dbSNP
rs1435872672 551 dbSNP
rs1036505335 552 dbSNP
rs1324609792 557 dbSNP
rs1198256226 567 dbSNP
rs940915185 575 dbSNP
rs909465281 576 dbSNP
rs984436332 578 dbSNP
rs953161502 579 dbSNP
rs1263185671 582 dbSNP
rs921653783 582 dbSNP
rs975817351 586 dbSNP
rs1048957791 589 dbSNP
rs1218633713 606 dbSNP
rs965809809 607 dbSNP
rs1193015956 618 dbSNP
rs774705210 624 dbSNP
rs1272301155 630 dbSNP
rs1030816931 655 dbSNP
rs1479181115 656 dbSNP
rs999373806 663 dbSNP
rs550440493 664 dbSNP
rs1431847455 669 dbSNP
rs533528247 674 dbSNP
rs1332377751 675 dbSNP
rs765607331 680 dbSNP
rs1161449783 703 dbSNP
rs1382813404 705 dbSNP
rs1381729544 706 dbSNP
rs1324085239 716 dbSNP
rs1471063523 717 dbSNP
rs1406971068 721 dbSNP
rs1022631568 730 dbSNP
rs1402850641 731 dbSNP
rs1012198922 736 dbSNP
rs35885954 738 dbSNP
rs1170047850 750 dbSNP
rs1282441989 777 dbSNP
rs1465055057 787 dbSNP
rs762121079 791 dbSNP
rs1350726253 801 dbSNP
rs1229787480 817 dbSNP
rs1258587983 826 dbSNP
rs995126994 832 dbSNP
rs1209935164 838 dbSNP
rs564441604 842 dbSNP
rs1034335492 844 dbSNP
rs768749251 853 dbSNP
rs1268691840 854 dbSNP
rs1473133353 858 dbSNP
rs1184537640 861 dbSNP
rs1362314872 865 dbSNP
rs944419442 874 dbSNP
rs907307653 875 dbSNP
rs762855148 879 dbSNP
rs1050212103 881 dbSNP
rs1036452995 885 dbSNP
rs940867561 886 dbSNP
rs775108524 896 dbSNP
rs541478611 897 dbSNP
rs1411462614 900 dbSNP
rs1304350658 904 dbSNP
rs775360653 907 dbSNP
rs1334853471 909 dbSNP
rs932281312 914 dbSNP
rs1306272335 915 dbSNP
rs921577846 916 dbSNP
rs1220835241 920 dbSNP
rs1291702539 936 dbSNP
rs759334673 937 dbSNP
rs1215543743 941 dbSNP
rs944410800 949 dbSNP
rs1418763196 952 dbSNP
rs375505040 952 dbSNP
rs397962172 952 dbSNP
rs546910013 952 dbSNP
rs61084783 952 dbSNP
rs1491361146 953 dbSNP
rs527766409 971 dbSNP
rs1390734887 972 dbSNP
rs1296276168 994 dbSNP
rs1431376702 994 dbSNP
rs1395310674 1003 dbSNP
rs774331138 1004 dbSNP
rs977875288 1007 dbSNP
rs1383731558 1008 dbSNP
rs1379860257 1009 dbSNP
rs769885759 1015 dbSNP
rs1244646235 1016 dbSNP
rs562139270 1049 dbSNP
rs1023671917 1054 dbSNP
rs1022157577 1065 dbSNP
rs115523508 1074 dbSNP
rs952805163 1074 dbSNP
rs369680128 1085 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' guUUUUGACGUUA-AUGAAAACGu 5'
            | ||:|  |||  | |||||| 
Target 5' -aACAAUU--AAUGCAGUUUUGCa 3'
 		1 - 21
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 159.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 159.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' guuuuugACGUUAAUGAAAACGu 5'
                 ||||:    |||||| 
Target 5' ------aUGCAG----UUUUGCa 3'
 		1 - 13
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000366535.3 | 3UTR | AACAAUUAAUGCAGUUUUGCACAAAUAUUUUUACAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000366535.3 | 3UTR | UUUUACCCCUAUUAGAUGGUAAGAACAAUUAAUGCAGUUUUGCACAAAUAUUUUUACAUUCUGAUCAUUCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000366535.3 | 3UTR | AUGCAGUUUUGCACAAAUAUUUUUACAUUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
249 hsa-miR-548g-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT057504 CEP55 centrosomal protein 55 2 4
MIRT060829 CEP350 centrosomal protein 350 2 4
MIRT062719 MLEC malectin 2 4
MIRT064766 CCND2 cyclin D2 2 8
MIRT075336 SF3B3 splicing factor 3b subunit 3 2 2
MIRT080205 PRKACB protein kinase cAMP-activated catalytic subunit beta 2 2
MIRT080236 SMAD4 SMAD family member 4 2 6
MIRT087395 AGFG1 ArfGAP with FG repeats 1 2 4
MIRT088228 GRAMD4 GRAM domain containing 4 2 2
MIRT089490 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 6
MIRT091222 USP13 ubiquitin specific peptidase 13 2 2
MIRT092959 CYP2U1 cytochrome P450 family 2 subfamily U member 1 2 4
MIRT094091 PAICS phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase 2 4
MIRT097469 PAPD4 poly(A) RNA polymerase D4, non-canonical 2 2
MIRT102252 HBP1 HMG-box transcription factor 1 2 4
MIRT105440 ATP6V1B2 ATPase H+ transporting V1 subunit B2 2 10
MIRT107286 FAM73B mitoguardin 2 2 2
MIRT113584 ZDHHC18 zinc finger DHHC-type containing 18 2 2
MIRT113886 KPNA6 karyopherin subunit alpha 6 2 6
MIRT126457 ARL5B ADP ribosylation factor like GTPase 5B 2 2
MIRT135023 ADSS adenylosuccinate synthase 2 6
MIRT139889 BTF3L4 basic transcription factor 3 like 4 2 6
MIRT149702 LDLR low density lipoprotein receptor 2 2
MIRT163230 EDEM1 ER degradation enhancing alpha-mannosidase like protein 1 2 2
MIRT165198 GRAMD3 GRAM domain containing 2B 2 2
MIRT172169 FZD6 frizzled class receptor 6 2 8
MIRT177396 ZMYND11 zinc finger MYND-type containing 11 2 2
MIRT179427 TBRG1 transforming growth factor beta regulator 1 2 6
MIRT195617 FAM195A MAPK regulated corepressor interacting protein 2 2 6
MIRT208727 MED12L mediator complex subunit 12 like 2 6
MIRT211508 ELMOD2 ELMO domain containing 2 2 2
MIRT213434 MOB1B MOB kinase activator 1B 2 6
MIRT240121 NDRG1 N-myc downstream regulated 1 2 2
MIRT243102 LCLAT1 lysocardiolipin acyltransferase 1 2 4
MIRT247387 HCFC2 host cell factor C2 2 4
MIRT248057 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT249457 ZNF691 zinc finger protein 691 2 4
MIRT253421 EVI5L ecotropic viral integration site 5 like 2 2
MIRT254148 ETS2 ETS proto-oncogene 2, transcription factor 2 2
MIRT258906 LAPTM4B lysosomal protein transmembrane 4 beta 2 4
MIRT259391 SLC6A8 solute carrier family 6 member 8 2 4
MIRT266966 LRRC55 leucine rich repeat containing 55 2 4
MIRT279001 GMFB glia maturation factor beta 2 10
MIRT288802 KCNJ2 potassium voltage-gated channel subfamily J member 2 2 2
MIRT325678 ZNF367 zinc finger protein 367 2 2
MIRT330543 HNRNPF heterogeneous nuclear ribonucleoprotein F 2 4
MIRT334269 RCC2 regulator of chromosome condensation 2 2 2
MIRT350225 PRNP prion protein 2 2
MIRT400510 SKIL SKI like proto-oncogene 2 10
MIRT405635 WBP4 WW domain binding protein 4 2 4
MIRT408651 QKI QKI, KH domain containing RNA binding 2 2
MIRT444161 ZNF701 zinc finger protein 701 2 2
MIRT444509 ZNF525 zinc finger protein 525 2 2
MIRT445209 CRYBG3 crystallin beta-gamma domain containing 3 2 2
MIRT446844 FOXP1 forkhead box P1 2 2
MIRT449026 ADRB1 adrenoceptor beta 1 2 2
MIRT450746 POLI DNA polymerase iota 2 4
MIRT450793 OTUD7A OTU deubiquitinase 7A 2 2
MIRT454916 ANKEF1 ankyrin repeat and EF-hand domain containing 1 2 12
MIRT455266 DDX39B DExD-box helicase 39B 2 10
MIRT455715 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 2 2
MIRT456098 MB21D1 Mab-21 domain containing 1 2 6
MIRT463635 YY1 YY1 transcription factor 2 8
MIRT463891 WNT7B Wnt family member 7B 2 2
MIRT466262 TMBIM6 transmembrane BAX inhibitor motif containing 6 2 4
MIRT466820 STX6 syntaxin 6 2 6
MIRT466879 STX16 syntaxin 16 2 2
MIRT467524 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 2 6
MIRT468199 SGK1 serum/glucocorticoid regulated kinase 1 2 2
MIRT468633 SELT selenoprotein T 2 2
MIRT470367 PPP2R5E protein phosphatase 2 regulatory subunit B'epsilon 2 2
MIRT470998 PITPNA phosphatidylinositol transfer protein alpha 2 2
MIRT471559 PATL1 PAT1 homolog 1, processing body mRNA decay factor 2 6
MIRT472277 NFIB nuclear factor I B 2 4
MIRT472758 MTMR6 myotubularin related protein 6 2 8
MIRT474719 KIF13A kinesin family member 13A 2 6
MIRT475869 H3F3C H3 histone family member 3C 2 10
MIRT475903 H3F3B H3 histone family member 3B 2 8
MIRT477350 EOGT EGF domain specific O-linked N-acetylglucosamine transferase 2 4
MIRT477486 ELL2 elongation factor for RNA polymerase II 2 2 2
MIRT478096 DLG5 discs large MAGUK scaffold protein 5 2 6
MIRT479805 CCNA2 cyclin A2 2 6
MIRT480813 BLCAP bladder cancer associated protein 2 10
MIRT481947 ANKRD11 ankyrin repeat domain 11 2 2
MIRT483060 EXT2 exostosin glycosyltransferase 2 2 6
MIRT484143 LRRC45 leucine rich repeat containing 45 2 4
MIRT484904 ZFYVE26 zinc finger FYVE-type containing 26 2 4
MIRT485080 SOX4 SRY-box 4 2 10
MIRT485639 DICER1 dicer 1, ribonuclease III 2 4
MIRT485798 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT486271 SEC23A Sec23 homolog A, coat complex II component 2 2
MIRT486740 CNOT4 CCR4-NOT transcription complex subunit 4 2 6
MIRT487167 LFNG LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase 2 2
MIRT491642 PDRG1 p53 and DNA damage regulated 1 2 10
MIRT491934 WDR45B WD repeat domain 45B 2 8
MIRT492232 SLC48A1 solute carrier family 48 member 1 2 2
MIRT493089 MMGT1 membrane magnesium transporter 1 2 12
MIRT494479 BRWD3 bromodomain and WD repeat domain containing 3 2 2
MIRT494986 ROCK1 Rho associated coiled-coil containing protein kinase 1 2 2
MIRT495671 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 2
MIRT498467 PTBP2 polypyrimidine tract binding protein 2 2 10
MIRT499268 NBPF11 NBPF member 11 2 2
MIRT499855 SVOP SV2 related protein 2 12
MIRT500307 ZNF622 zinc finger protein 622 2 8
MIRT500640 TUBB2A tubulin beta 2A class IIa 2 8
MIRT501222 SEMA4C semaphorin 4C 2 6
MIRT501526 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 8
MIRT501569 PLEKHF2 pleckstrin homology and FYVE domain containing 2 2 4
MIRT502430 G3BP2 G3BP stress granule assembly factor 2 2 10
MIRT502967 CCNL1 cyclin L1 2 8
MIRT503470 ZNF154 zinc finger protein 154 2 6
MIRT504572 ERCC4 ERCC excision repair 4, endonuclease catalytic subunit 2 4
MIRT504956 ZNRF2 zinc and ring finger 2 2 6
MIRT505206 UBN2 ubinuclein 2 2 8
MIRT505238 UBE2D3 ubiquitin conjugating enzyme E2 D3 2 2
MIRT507570 DEK DEK proto-oncogene 2 2
MIRT509412 MCM7 minichromosome maintenance complex component 7 2 6
MIRT510715 SPG20 spartin 2 6
MIRT510859 RAN RAN, member RAS oncogene family 2 8
MIRT510914 PSMA2 proteasome subunit alpha 2 2 4
MIRT510944 PPTC7 PTC7 protein phosphatase homolog 2 8
MIRT511072 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 2 4
MIRT511213 LNPEP leucyl and cystinyl aminopeptidase 2 4
MIRT511959 ELOVL5 ELOVL fatty acid elongase 5 2 6
MIRT512123 CREBL2 cAMP responsive element binding protein like 2 2 8
MIRT513686 RNF111 ring finger protein 111 2 2
MIRT513896 GRB10 growth factor receptor bound protein 10 2 6
MIRT516305 F8A2 coagulation factor VIII associated 2 2 2
MIRT516331 F8A3 coagulation factor VIII associated 3 2 2
MIRT517521 ITM2C integral membrane protein 2C 2 6
MIRT517930 IMPA1 inositol monophosphatase 1 2 2
MIRT521368 RNF11 ring finger protein 11 2 6
MIRT525192 ZNF93 zinc finger protein 93 2 2
MIRT527216 CCNL2 cyclin L2 2 2
MIRT527835 NUPL1 nucleoporin 58 2 2
MIRT529433 MALT1 MALT1 paracaspase 2 2
MIRT530166 C11orf44 chromosome 11 open reading frame 44 2 4
MIRT530515 C4orf32 family with sequence similarity 241 member A 2 4
MIRT532372 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT533855 TEAD1 TEA domain transcription factor 1 2 2
MIRT534750 RAVER2 ribonucleoprotein, PTB binding 2 2 4
MIRT534795 RAB8B RAB8B, member RAS oncogene family 2 2
MIRT538602 CDK19 cyclin dependent kinase 19 2 2
MIRT539247 ANKRD50 ankyrin repeat domain 50 2 2
MIRT539467 ADARB2 adenosine deaminase, RNA specific B2 (inactive) 2 2
MIRT543100 TNFRSF11A TNF receptor superfamily member 11a 2 2
MIRT543897 ESYT1 extended synaptotagmin 1 2 2
MIRT544980 MFF mitochondrial fission factor 2 4
MIRT545794 ZNF772 zinc finger protein 772 2 4
MIRT546009 WDR26 WD repeat domain 26 2 4
MIRT546378 STOX2 storkhead box 2 2 4
MIRT546681 RORA RAR related orphan receptor A 2 4
MIRT546947 SFTPA1 surfactant protein A1 2 2
MIRT547034 POGZ pogo transposable element derived with ZNF domain 2 2
MIRT547397 MKX mohawk homeobox 2 2
MIRT547470 MBNL3 muscleblind like splicing regulator 3 2 4
MIRT547501 MBNL1 muscleblind like splicing regulator 1 2 4
MIRT548077 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT548500 E2F8 E2F transcription factor 8 2 2
MIRT548883 CHEK2 checkpoint kinase 2 2 4
MIRT549063 CALM1 calmodulin 1 2 2
MIRT549166 BMP3 bone morphogenetic protein 3 2 2
MIRT549310 ARHGAP12 Rho GTPase activating protein 12 2 4
MIRT549345 ARC activity regulated cytoskeleton associated protein 2 2
MIRT549475 ACBD5 acyl-CoA binding domain containing 5 2 2
MIRT549678 ZNF598 zinc finger protein 598 2 2
MIRT550209 MAVS mitochondrial antiviral signaling protein 2 4
MIRT550356 INCENP inner centromere protein 2 4
MIRT550531 MYZAP myocardial zonula adherens protein 2 2
MIRT551156 ZNF678 zinc finger protein 678 2 2
MIRT552311 ZXDA zinc finger, X-linked, duplicated A 2 4
MIRT552880 WASL Wiskott-Aldrich syndrome like 2 4
MIRT553383 TRIM33 tripartite motif containing 33 2 2
MIRT554453 SAMD8 sterile alpha motif domain containing 8 2 2
MIRT554868 RCAN2 regulator of calcineurin 2 2 2
MIRT556022 MYBL1 MYB proto-oncogene like 1 2 2
MIRT556175 MCC mutated in colorectal cancers 2 2
MIRT556238 MARCKS myristoylated alanine rich protein kinase C substrate 2 2
MIRT556878 ITGA2 integrin subunit alpha 2 2 2
MIRT557575 GNPTAB N-acetylglucosamine-1-phosphate transferase alpha and beta subunits 2 2
MIRT557690 GATA6 GATA binding protein 6 2 2
MIRT557906 FBXO8 F-box protein 8 2 2
MIRT558132 ENPP4 ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative) 2 2
MIRT558481 DBN1 drebrin 1 2 2
MIRT558744 CHIC1 cysteine rich hydrophobic domain 1 2 2
MIRT558760 CFL2 cofilin 2 2 2
MIRT559122 C11orf57 chromosome 11 open reading frame 57 2 2
MIRT559406 GDNF glial cell derived neurotrophic factor 2 4
MIRT559476 ARL8A ADP ribosylation factor like GTPase 8A 2 2
MIRT559677 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT560049 ZNF680 zinc finger protein 680 2 2
MIRT560643 ZNF107 zinc finger protein 107 2 2
MIRT562581 CBX3 chromobox 3 2 2
MIRT564188 CLVS2 clavesin 2 2 2
MIRT564530 SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 2 2
MIRT564540 CCDC80 coiled-coil domain containing 80 2 2
MIRT565290 TMPPE transmembrane protein with metallophosphoesterase domain 2 2
MIRT565315 TMEM41A transmembrane protein 41A 2 2
MIRT565950 RRAGD Ras related GTP binding D 2 2
MIRT566633 NFYA nuclear transcription factor Y subunit alpha 2 4
MIRT566818 MAPK8 mitogen-activated protein kinase 8 2 2
MIRT567529 FGFR1OP FGFR1 oncogene partner 2 2
MIRT568631 ACVR2A activin A receptor type 2A 2 2
MIRT572141 DESI1 desumoylating isopeptidase 1 2 2
MIRT616029 TMTC1 transmembrane and tetratricopeptide repeat containing 1 2 4
MIRT620048 ODF4 outer dense fiber of sperm tails 4 2 2
MIRT620531 AVPR1A arginine vasopressin receptor 1A 2 2
MIRT621878 TAOK3 TAO kinase 3 2 2
MIRT623242 MLLT6 MLLT6, PHD finger containing 2 2
MIRT623994 FAM104A family with sequence similarity 104 member A 2 2
MIRT624301 COL12A1 collagen type XII alpha 1 chain 2 2
MIRT626283 PEX26 peroxisomal biogenesis factor 26 2 2
MIRT627771 RAB30 RAB30, member RAS oncogene family 2 2
MIRT641139 ZBTB33 zinc finger and BTB domain containing 33 2 2
MIRT644587 SPOP speckle type BTB/POZ protein 2 2
MIRT644820 DNAJC21 DnaJ heat shock protein family (Hsp40) member C21 2 2
MIRT645971 NHLRC2 NHL repeat containing 2 2 2
MIRT646171 PTPN14 protein tyrosine phosphatase, non-receptor type 14 2 2
MIRT646496 ZNF429 zinc finger protein 429 2 2
MIRT647834 RAB23 RAB23, member RAS oncogene family 2 2
MIRT648463 CCDC127 coiled-coil domain containing 127 2 2
MIRT657281 HRK harakiri, BCL2 interacting protein 2 2
MIRT658644 ENAH ENAH, actin regulator 2 2
MIRT658677 EMP2 epithelial membrane protein 2 2 2
MIRT665229 ZZZ3 zinc finger ZZ-type containing 3 2 2
MIRT669277 C19orf44 chromosome 19 open reading frame 44 2 2
MIRT676048 AUTS8 Autism, susceptibility to, 8 2 2
MIRT681484 DIP2A disco interacting protein 2 homolog A 2 2
MIRT681555 UBXN2A UBX domain protein 2A 2 2
MIRT683143 MTHFD1 methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 2 2
MIRT688535 DCAF7 DDB1 and CUL4 associated factor 7 2 2
MIRT689429 CYB561 cytochrome b561 2 2
MIRT689535 KIAA0513 KIAA0513 2 2
MIRT689895 SOD2 superoxide dismutase 2 2 2
MIRT695990 SNX19 sorting nexin 19 2 2
MIRT697781 UBXN7 UBX domain protein 7 2 2
MIRT702915 CRAMP1L cramped chromatin regulator homolog 1 2 2
MIRT703145 GPR137C G protein-coupled receptor 137C 2 2
MIRT703525 FKBP15 FK506 binding protein 15 2 2
MIRT704537 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 2 2
MIRT704998 CAMSAP1 calmodulin regulated spectrin associated protein 1 2 2
MIRT705722 AMMECR1L AMMECR1 like 2 2
MIRT707121 NWD1 NACHT and WD repeat domain containing 1 2 2
MIRT707452 PPFIBP1 PPFIA binding protein 1 2 2
MIRT707776 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT707889 SLC30A7 solute carrier family 30 member 7 2 2
MIRT720532 CHERP calcium homeostasis endoplasmic reticulum protein 2 2
MIRT723860 CD209 CD209 molecule 2 2
MIRT725350 MUC21 mucin 21, cell surface associated 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-548g Cisplatin 5460033 NSC119875 approved resistant cell line (OE19)
hsa-mir-548g Docetaxel+Cisplatin+5-Fluorouracil sensitive tissue (hypopharyngeal squamous cell carcinoma)

Error report submission