miRTarBase - #MIRT135026


—
pre-miRNA Information
pre-miRNA hsa-mir-548x   
Genomic Coordinates chr21: 18686090 - 18686164
Description Homo sapiens miR-548x stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-548x-5p
Sequence 8| UGCAAAAGUAAUUGCAGUUUUUG |30
Evidence Not_experimental
Experiments
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1339173470 13 dbSNP
rs1213127694 16 dbSNP
rs924142144 17 dbSNP
rs1220375299 23 dbSNP
Putative Targets

Gene Information
Gene Symbol ADSS   
Synonyms ADEH, ADSS 2
Description adenylosuccinate synthase
Transcript NM_001126   
Expression
Putative miRNA Targets on ADSS
3'UTR of ADSS
(miRNA target sites are highlighted)		 
>ADSS|NM_001126|3'UTR
   1 TGATTGCCAGTAATGCAAGAAACACTCCTTGAGAGGGAGGGGAAAAGACTTTCTTAAATATTTCATTTATGACCTGCAAA
  81 TTCAAGAATAAAGACACTGAAGTAAGTTTGAAGCCCTACAGTTGTTTCCAGTCTTTTCAGATGGATGCCTACTGTGGAGA
 161 TTAACTTTGGCATATTCCAGTGTCAGCTTTCTTTAGCTGGAATTGCCAAATCATTTGTTGCTCCTGCTGCTCTCATGGTG
 241 CCACGTTTTTTTTTTCAATGTTTAGTAATAGTATAATCCATGTTGTTTGATATCAAAAGTAGAATTACTTTTAATGTAGT
 321 TTTTCTTCATTATTGTCATTGCGTGTTCTTAAGTTTTACCCCTATTAGATGGTAAGAACAATTAATGCAGTTTTGCACAA
 401 ATATTTTTACATTCTGATCATTCAGTTCTGTCATTGTAATCTTTGTTGTTAGAAACAAATGATGAAAACATAGGGGTTCT
 481 GTAAACTTTTGTAATGCTATGAATTCTGTTTAAATTTTGGGCTGTCTATTTTCTGCTGAAACCATGCAAAATTGAGCTTT
 561 GGTGGGGCTGGGAGGGGGTTATGTATTCATGGGACCTTTAATTTGTACAGAACACAGAACTTATTTCTGTCAGTTATTTA
 641 ATACATTGAAAATTTAGTGAAATGTTCAAAGAGAATAGATGTTTCCCAAAACAACAATCTTTATGTTAAAAATAGTCATT
 721 AAAAGATCTGTTGTAATATATGGTGGATATTTTTCTTTAATTTCAAACATTACCTCTGAAATGTGTATCTTTTCTTTTTT
 801 ATCTTACCATTAATTTTAAATCTAGTGGATTGGTTTTCAACATCGTGCCTGCCGATATGCCTACAGAATCATCTGTAAGT
 881 GTCAAAATGAACCCACGTTGTTAGCCATAATTTTGATTATGCCTTTATTTCTCCTTTCTTGAAAAAAAAAAGGTGTTATT
 961 TTGACAATTAGGCATAACATTGTTTTGTAGATTATCTTTTAATGAACTATTTTAAATGTTAAATTAGGTGCCACTTAAAT
1041 TTATTTTATTACACCATGAATAGCTGATTAAAAGAACCAAATATTTCTAGTATGAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' guuuuuGACGUUAAUGAAAACGu 5'
                |||:||  |||||||: 
Target 5' ggggttCTGTAA--ACTTTTGTa 3'
 473 - 493 145.00 -12.70
2 
miRNA  3' guUUUUGACGUUAAUGAAAAcgu 5'
            |||| |  ||||||||||   
Target 5' tcAAAAGTAGAATTACTTTTaat 3'
 293 - 315 141.00 -9.02
3 
miRNA  3' guuuuUGACG---UUAA-UGAAAACGu 5'
               ||||:   :||| ||||| || 
Target 5' tgcctACTGTGGAGATTAACTTTGGCa 3'
 146 - 172 130.00 -8.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30186031 2 COSMIC
COSN30451475 28 COSMIC
COSN13531264 35 COSMIC
COSN30147579 37 COSMIC
COSN31585735 47 COSMIC
COSN30452228 64 COSMIC
COSN30504775 66 COSMIC
COSN26565673 97 COSMIC
COSN30514927 97 COSMIC
COSN30502043 104 COSMIC
COSN30511050 129 COSMIC
COSN20096208 245 COSMIC
COSN15662456 307 COSMIC
COSN8453261 473 COSMIC
COSN26665123 616 COSMIC
COSN21461186 625 COSMIC
COSN30169504 706 COSMIC
COSN30543715 743 COSMIC
COSN31564826 755 COSMIC
COSN1440495 763 COSMIC
COSN20729400 832 COSMIC
COSN20096207 941 COSMIC
COSN29329295 1011 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs775010741 9 dbSNP
rs763477587 10 dbSNP
rs1482569529 12 dbSNP
rs773613590 17 dbSNP
rs769381301 22 dbSNP
rs1361862529 24 dbSNP
rs142770938 25 dbSNP
rs768237912 27 dbSNP
rs746467727 28 dbSNP
rs1323018600 34 dbSNP
rs901724210 35 dbSNP
rs1310738906 37 dbSNP
rs1223307603 38 dbSNP
rs1314012935 39 dbSNP
rs779975384 41 dbSNP
rs1348954085 42 dbSNP
rs758332023 43 dbSNP
rs750263853 46 dbSNP
rs756959937 48 dbSNP
rs752982808 49 dbSNP
rs536580352 51 dbSNP
rs1241668453 53 dbSNP
rs1488760194 56 dbSNP
rs1192793707 58 dbSNP
rs999478620 70 dbSNP
rs1479965477 76 dbSNP
rs1159661576 82 dbSNP
rs372936425 84 dbSNP
rs1413670921 85 dbSNP
rs1335879577 88 dbSNP
rs1322306332 90 dbSNP
rs1157754299 102 dbSNP
rs369919965 114 dbSNP
rs1437989647 145 dbSNP
rs1295758570 149 dbSNP
rs1366138500 151 dbSNP
rs1404693543 152 dbSNP
rs1045518459 154 dbSNP
rs1043474934 160 dbSNP
rs111320617 161 dbSNP
rs1304136442 166 dbSNP
rs1331481989 167 dbSNP
rs148535556 168 dbSNP
rs1283845073 175 dbSNP
rs915988741 180 dbSNP
rs1160564978 185 dbSNP
rs1470616522 186 dbSNP
rs1223909757 190 dbSNP
rs547499743 205 dbSNP
rs1196825982 214 dbSNP
rs1449804994 221 dbSNP
rs767953645 229 dbSNP
rs1222989578 232 dbSNP
rs755371449 236 dbSNP
rs1414102346 241 dbSNP
rs1283589466 243 dbSNP
rs752116051 244 dbSNP
rs556782598 245 dbSNP
rs1424663147 255 dbSNP
rs201400497 256 dbSNP
rs398103917 256 dbSNP
rs76040005 256 dbSNP
rs1408392790 257 dbSNP
rs1350931488 258 dbSNP
rs1279149333 271 dbSNP
rs972275098 273 dbSNP
rs113711112 275 dbSNP
rs536837642 279 dbSNP
rs1310752165 281 dbSNP
rs1284432919 285 dbSNP
rs962291660 291 dbSNP
rs1358626234 293 dbSNP
rs3087609 307 dbSNP
rs551409330 316 dbSNP
rs778369211 320 dbSNP
rs953125432 320 dbSNP
rs1203582733 331 dbSNP
rs1029164983 332 dbSNP
rs1473595764 333 dbSNP
rs1179607418 337 dbSNP
rs944413169 338 dbSNP
rs1449561621 341 dbSNP
rs767687620 342 dbSNP
rs192048704 343 dbSNP
rs1408525565 345 dbSNP
rs544085026 362 dbSNP
rs965861681 362 dbSNP
rs1401693992 364 dbSNP
rs1359932122 372 dbSNP
rs1450531971 374 dbSNP
rs986287338 386 dbSNP
rs1030869108 397 dbSNP
rs1170896134 401 dbSNP
rs1481434886 404 dbSNP
rs999426115 420 dbSNP
rs1340025044 426 dbSNP
rs903790016 461 dbSNP
rs953552360 461 dbSNP
rs565636331 462 dbSNP
rs548686962 469 dbSNP
rs1477454207 489 dbSNP
rs1043027809 490 dbSNP
rs915495189 492 dbSNP
rs1242154110 493 dbSNP
rs1464924895 495 dbSNP
rs1011993362 503 dbSNP
rs763195509 517 dbSNP
rs188643354 522 dbSNP
rs1426242584 528 dbSNP
rs761772668 528 dbSNP
rs938796038 532 dbSNP
rs183595622 536 dbSNP
rs1003565295 544 dbSNP
rs928787374 547 dbSNP
rs1435872672 551 dbSNP
rs1036505335 552 dbSNP
rs1324609792 557 dbSNP
rs1198256226 567 dbSNP
rs940915185 575 dbSNP
rs909465281 576 dbSNP
rs984436332 578 dbSNP
rs953161502 579 dbSNP
rs1263185671 582 dbSNP
rs921653783 582 dbSNP
rs975817351 586 dbSNP
rs1048957791 589 dbSNP
rs1218633713 606 dbSNP
rs965809809 607 dbSNP
rs1193015956 618 dbSNP
rs774705210 624 dbSNP
rs1272301155 630 dbSNP
rs1030816931 655 dbSNP
rs1479181115 656 dbSNP
rs999373806 663 dbSNP
rs550440493 664 dbSNP
rs1431847455 669 dbSNP
rs533528247 674 dbSNP
rs1332377751 675 dbSNP
rs765607331 680 dbSNP
rs1161449783 703 dbSNP
rs1382813404 705 dbSNP
rs1381729544 706 dbSNP
rs1324085239 716 dbSNP
rs1471063523 717 dbSNP
rs1406971068 721 dbSNP
rs1022631568 730 dbSNP
rs1402850641 731 dbSNP
rs1012198922 736 dbSNP
rs35885954 738 dbSNP
rs1170047850 750 dbSNP
rs1282441989 777 dbSNP
rs1465055057 787 dbSNP
rs762121079 791 dbSNP
rs1350726253 801 dbSNP
rs1229787480 817 dbSNP
rs1258587983 826 dbSNP
rs995126994 832 dbSNP
rs1209935164 838 dbSNP
rs564441604 842 dbSNP
rs1034335492 844 dbSNP
rs768749251 853 dbSNP
rs1268691840 854 dbSNP
rs1473133353 858 dbSNP
rs1184537640 861 dbSNP
rs1362314872 865 dbSNP
rs944419442 874 dbSNP
rs907307653 875 dbSNP
rs762855148 879 dbSNP
rs1050212103 881 dbSNP
rs1036452995 885 dbSNP
rs940867561 886 dbSNP
rs775108524 896 dbSNP
rs541478611 897 dbSNP
rs1411462614 900 dbSNP
rs1304350658 904 dbSNP
rs775360653 907 dbSNP
rs1334853471 909 dbSNP
rs932281312 914 dbSNP
rs1306272335 915 dbSNP
rs921577846 916 dbSNP
rs1220835241 920 dbSNP
rs1291702539 936 dbSNP
rs759334673 937 dbSNP
rs1215543743 941 dbSNP
rs944410800 949 dbSNP
rs1418763196 952 dbSNP
rs375505040 952 dbSNP
rs397962172 952 dbSNP
rs546910013 952 dbSNP
rs61084783 952 dbSNP
rs1491361146 953 dbSNP
rs527766409 971 dbSNP
rs1390734887 972 dbSNP
rs1296276168 994 dbSNP
rs1431376702 994 dbSNP
rs1395310674 1003 dbSNP
rs774331138 1004 dbSNP
rs977875288 1007 dbSNP
rs1383731558 1008 dbSNP
rs1379860257 1009 dbSNP
rs769885759 1015 dbSNP
rs1244646235 1016 dbSNP
rs562139270 1049 dbSNP
rs1023671917 1054 dbSNP
rs1022157577 1065 dbSNP
rs115523508 1074 dbSNP
rs952805163 1074 dbSNP
rs369680128 1085 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' guUUUUGACGUUA-AUGAAAACGu 5'
            | ||:|  |||  | |||||| 
Target 5' -aACAAUU--AAUGCAGUUUUGCa 3'
 		1 - 21
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 159.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 159.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' guuuuugACGUUAAUGAAAACGu 5'
                 ||||:    |||||| 
Target 5' ------aUGCAG----UUUUGCa 3'
 		1 - 13
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000366535.3 | 3UTR | AACAAUUAAUGCAGUUUUGCACAAAUAUUUUUACAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000366535.3 | 3UTR | UUUUACCCCUAUUAGAUGGUAAGAACAAUUAAUGCAGUUUUGCACAAAUAUUUUUACAUUCUGAUCAUUCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000366535.3 | 3UTR | AUGCAGUUUUGCACAAAUAUUUUUACAUUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
249 hsa-miR-548x-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT057505 CEP55 centrosomal protein 55 2 4
MIRT060830 CEP350 centrosomal protein 350 2 4
MIRT062721 MLEC malectin 2 4
MIRT064767 CCND2 cyclin D2 2 8
MIRT075338 SF3B3 splicing factor 3b subunit 3 2 2
MIRT080209 PRKACB protein kinase cAMP-activated catalytic subunit beta 2 2
MIRT080238 SMAD4 SMAD family member 4 2 6
MIRT087397 AGFG1 ArfGAP with FG repeats 1 2 4
MIRT088230 GRAMD4 GRAM domain containing 4 2 2
MIRT089495 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 6
MIRT091224 USP13 ubiquitin specific peptidase 13 2 2
MIRT092960 CYP2U1 cytochrome P450 family 2 subfamily U member 1 2 4
MIRT094093 PAICS phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase 2 4
MIRT097470 PAPD4 poly(A) RNA polymerase D4, non-canonical 2 2
MIRT102253 HBP1 HMG-box transcription factor 1 2 4
MIRT105441 ATP6V1B2 ATPase H+ transporting V1 subunit B2 2 10
MIRT107289 FAM73B mitoguardin 2 2 2
MIRT113586 ZDHHC18 zinc finger DHHC-type containing 18 2 2
MIRT113887 KPNA6 karyopherin subunit alpha 6 2 6
MIRT126459 ARL5B ADP ribosylation factor like GTPase 5B 2 2
MIRT135026 ADSS adenylosuccinate synthase 2 6
MIRT139893 BTF3L4 basic transcription factor 3 like 4 2 6
MIRT149712 LDLR low density lipoprotein receptor 2 2
MIRT163234 EDEM1 ER degradation enhancing alpha-mannosidase like protein 1 2 2
MIRT165202 GRAMD3 GRAM domain containing 2B 2 2
MIRT172173 FZD6 frizzled class receptor 6 2 8
MIRT177397 ZMYND11 zinc finger MYND-type containing 11 2 2
MIRT179430 TBRG1 transforming growth factor beta regulator 1 2 6
MIRT195619 FAM195A MAPK regulated corepressor interacting protein 2 2 6
MIRT208729 MED12L mediator complex subunit 12 like 2 6
MIRT211511 ELMOD2 ELMO domain containing 2 2 2
MIRT213435 MOB1B MOB kinase activator 1B 2 6
MIRT240123 NDRG1 N-myc downstream regulated 1 2 2
MIRT243103 LCLAT1 lysocardiolipin acyltransferase 1 2 4
MIRT247389 HCFC2 host cell factor C2 2 4
MIRT248058 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT249459 ZNF691 zinc finger protein 691 2 4
MIRT253422 EVI5L ecotropic viral integration site 5 like 2 2
MIRT254149 ETS2 ETS proto-oncogene 2, transcription factor 2 2
MIRT258908 LAPTM4B lysosomal protein transmembrane 4 beta 2 4
MIRT259394 SLC6A8 solute carrier family 6 member 8 2 4
MIRT266973 LRRC55 leucine rich repeat containing 55 2 4
MIRT279002 GMFB glia maturation factor beta 2 10
MIRT288803 KCNJ2 potassium voltage-gated channel subfamily J member 2 2 2
MIRT325680 ZNF367 zinc finger protein 367 2 2
MIRT330544 HNRNPF heterogeneous nuclear ribonucleoprotein F 2 4
MIRT334273 RCC2 regulator of chromosome condensation 2 2 2
MIRT350226 PRNP prion protein 2 2
MIRT400513 SKIL SKI like proto-oncogene 2 10
MIRT405640 WBP4 WW domain binding protein 4 2 4
MIRT408652 QKI QKI, KH domain containing RNA binding 2 2
MIRT444160 ZNF701 zinc finger protein 701 2 2
MIRT444508 ZNF525 zinc finger protein 525 2 2
MIRT445208 CRYBG3 crystallin beta-gamma domain containing 3 2 2
MIRT446843 FOXP1 forkhead box P1 2 2
MIRT449025 ADRB1 adrenoceptor beta 1 2 2
MIRT450745 POLI DNA polymerase iota 2 4
MIRT450792 OTUD7A OTU deubiquitinase 7A 2 2
MIRT454915 ANKEF1 ankyrin repeat and EF-hand domain containing 1 2 12
MIRT455265 DDX39B DExD-box helicase 39B 2 10
MIRT455714 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 2 2
MIRT456097 MB21D1 Mab-21 domain containing 1 2 6
MIRT463634 YY1 YY1 transcription factor 2 8
MIRT463890 WNT7B Wnt family member 7B 2 2
MIRT466261 TMBIM6 transmembrane BAX inhibitor motif containing 6 2 4
MIRT466819 STX6 syntaxin 6 2 6
MIRT466878 STX16 syntaxin 16 2 2
MIRT467523 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 2 6
MIRT468198 SGK1 serum/glucocorticoid regulated kinase 1 2 2
MIRT468632 SELT selenoprotein T 2 2
MIRT470366 PPP2R5E protein phosphatase 2 regulatory subunit B'epsilon 2 2
MIRT470997 PITPNA phosphatidylinositol transfer protein alpha 2 2
MIRT471558 PATL1 PAT1 homolog 1, processing body mRNA decay factor 2 6
MIRT472276 NFIB nuclear factor I B 2 4
MIRT472757 MTMR6 myotubularin related protein 6 2 8
MIRT474718 KIF13A kinesin family member 13A 2 6
MIRT475868 H3F3C H3 histone family member 3C 2 10
MIRT475902 H3F3B H3 histone family member 3B 2 8
MIRT477349 EOGT EGF domain specific O-linked N-acetylglucosamine transferase 2 4
MIRT477485 ELL2 elongation factor for RNA polymerase II 2 2 2
MIRT478095 DLG5 discs large MAGUK scaffold protein 5 2 6
MIRT479804 CCNA2 cyclin A2 2 6
MIRT480812 BLCAP bladder cancer associated protein 2 10
MIRT481946 ANKRD11 ankyrin repeat domain 11 2 2
MIRT483059 EXT2 exostosin glycosyltransferase 2 2 6
MIRT484142 LRRC45 leucine rich repeat containing 45 2 4
MIRT484903 ZFYVE26 zinc finger FYVE-type containing 26 2 4
MIRT485079 SOX4 SRY-box 4 2 10
MIRT485638 DICER1 dicer 1, ribonuclease III 2 4
MIRT485797 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT486270 SEC23A Sec23 homolog A, coat complex II component 2 2
MIRT486739 CNOT4 CCR4-NOT transcription complex subunit 4 2 6
MIRT487166 LFNG LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase 2 2
MIRT491641 PDRG1 p53 and DNA damage regulated 1 2 10
MIRT491933 WDR45B WD repeat domain 45B 2 8
MIRT492231 SLC48A1 solute carrier family 48 member 1 2 2
MIRT493088 MMGT1 membrane magnesium transporter 1 2 12
MIRT494478 BRWD3 bromodomain and WD repeat domain containing 3 2 2
MIRT494985 ROCK1 Rho associated coiled-coil containing protein kinase 1 2 2
MIRT495670 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 2
MIRT498466 PTBP2 polypyrimidine tract binding protein 2 2 10
MIRT499267 NBPF11 NBPF member 11 2 2
MIRT499853 SVOP SV2 related protein 2 12
MIRT500306 ZNF622 zinc finger protein 622 2 8
MIRT500639 TUBB2A tubulin beta 2A class IIa 2 8
MIRT501221 SEMA4C semaphorin 4C 2 6
MIRT501525 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 8
MIRT501568 PLEKHF2 pleckstrin homology and FYVE domain containing 2 2 4
MIRT502429 G3BP2 G3BP stress granule assembly factor 2 2 10
MIRT502966 CCNL1 cyclin L1 2 8
MIRT503469 ZNF154 zinc finger protein 154 2 6
MIRT504571 ERCC4 ERCC excision repair 4, endonuclease catalytic subunit 2 4
MIRT504955 ZNRF2 zinc and ring finger 2 2 6
MIRT505205 UBN2 ubinuclein 2 2 8
MIRT505237 UBE2D3 ubiquitin conjugating enzyme E2 D3 2 2
MIRT507569 DEK DEK proto-oncogene 2 2
MIRT509411 MCM7 minichromosome maintenance complex component 7 2 6
MIRT510714 SPG20 spartin 2 6
MIRT510858 RAN RAN, member RAS oncogene family 2 8
MIRT510913 PSMA2 proteasome subunit alpha 2 2 4
MIRT510943 PPTC7 PTC7 protein phosphatase homolog 2 8
MIRT511071 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 2 4
MIRT511212 LNPEP leucyl and cystinyl aminopeptidase 2 4
MIRT511958 ELOVL5 ELOVL fatty acid elongase 5 2 6
MIRT512122 CREBL2 cAMP responsive element binding protein like 2 2 8
MIRT513685 RNF111 ring finger protein 111 2 2
MIRT513895 GRB10 growth factor receptor bound protein 10 2 6
MIRT516304 F8A2 coagulation factor VIII associated 2 2 2
MIRT516330 F8A3 coagulation factor VIII associated 3 2 2
MIRT517520 ITM2C integral membrane protein 2C 2 6
MIRT517929 IMPA1 inositol monophosphatase 1 2 2
MIRT521367 RNF11 ring finger protein 11 2 6
MIRT525191 ZNF93 zinc finger protein 93 2 2
MIRT527215 CCNL2 cyclin L2 2 2
MIRT527834 NUPL1 nucleoporin 58 2 2
MIRT529432 MALT1 MALT1 paracaspase 2 2
MIRT530165 C11orf44 chromosome 11 open reading frame 44 2 4
MIRT530514 C4orf32 family with sequence similarity 241 member A 2 4
MIRT532371 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT533854 TEAD1 TEA domain transcription factor 1 2 2
MIRT534749 RAVER2 ribonucleoprotein, PTB binding 2 2 4
MIRT534794 RAB8B RAB8B, member RAS oncogene family 2 2
MIRT538601 CDK19 cyclin dependent kinase 19 2 2
MIRT539246 ANKRD50 ankyrin repeat domain 50 2 2
MIRT539466 ADARB2 adenosine deaminase, RNA specific B2 (inactive) 2 2
MIRT543099 TNFRSF11A TNF receptor superfamily member 11a 2 2
MIRT543896 ESYT1 extended synaptotagmin 1 2 2
MIRT544979 MFF mitochondrial fission factor 2 4
MIRT545793 ZNF772 zinc finger protein 772 2 4
MIRT546008 WDR26 WD repeat domain 26 2 4
MIRT546377 STOX2 storkhead box 2 2 4
MIRT546680 RORA RAR related orphan receptor A 2 4
MIRT546946 SFTPA1 surfactant protein A1 2 2
MIRT547033 POGZ pogo transposable element derived with ZNF domain 2 2
MIRT547396 MKX mohawk homeobox 2 2
MIRT547469 MBNL3 muscleblind like splicing regulator 3 2 4
MIRT547500 MBNL1 muscleblind like splicing regulator 1 2 4
MIRT548076 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT548499 E2F8 E2F transcription factor 8 2 2
MIRT548882 CHEK2 checkpoint kinase 2 2 4
MIRT549062 CALM1 calmodulin 1 2 2
MIRT549165 BMP3 bone morphogenetic protein 3 2 2
MIRT549309 ARHGAP12 Rho GTPase activating protein 12 2 4
MIRT549344 ARC activity regulated cytoskeleton associated protein 2 2
MIRT549474 ACBD5 acyl-CoA binding domain containing 5 2 2
MIRT549677 ZNF598 zinc finger protein 598 2 2
MIRT550208 MAVS mitochondrial antiviral signaling protein 2 4
MIRT550355 INCENP inner centromere protein 2 4
MIRT550530 MYZAP myocardial zonula adherens protein 2 2
MIRT551155 ZNF678 zinc finger protein 678 2 2
MIRT552310 ZXDA zinc finger, X-linked, duplicated A 2 4
MIRT552879 WASL Wiskott-Aldrich syndrome like 2 4
MIRT553382 TRIM33 tripartite motif containing 33 2 2
MIRT554452 SAMD8 sterile alpha motif domain containing 8 2 2
MIRT554867 RCAN2 regulator of calcineurin 2 2 2
MIRT556021 MYBL1 MYB proto-oncogene like 1 2 2
MIRT556174 MCC mutated in colorectal cancers 2 2
MIRT556237 MARCKS myristoylated alanine rich protein kinase C substrate 2 2
MIRT556877 ITGA2 integrin subunit alpha 2 2 2
MIRT557574 GNPTAB N-acetylglucosamine-1-phosphate transferase alpha and beta subunits 2 2
MIRT557689 GATA6 GATA binding protein 6 2 2
MIRT557905 FBXO8 F-box protein 8 2 2
MIRT558131 ENPP4 ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative) 2 2
MIRT558480 DBN1 drebrin 1 2 2
MIRT558743 CHIC1 cysteine rich hydrophobic domain 1 2 2
MIRT558759 CFL2 cofilin 2 2 2
MIRT559121 C11orf57 chromosome 11 open reading frame 57 2 2
MIRT559405 GDNF glial cell derived neurotrophic factor 2 4
MIRT559475 ARL8A ADP ribosylation factor like GTPase 8A 2 2
MIRT559676 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT560048 ZNF680 zinc finger protein 680 2 2
MIRT560644 ZNF107 zinc finger protein 107 2 2
MIRT562580 CBX3 chromobox 3 2 2
MIRT564187 CLVS2 clavesin 2 2 2
MIRT564529 SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 2 2
MIRT564539 CCDC80 coiled-coil domain containing 80 2 2
MIRT565288 TMPPE transmembrane protein with metallophosphoesterase domain 2 2
MIRT565314 TMEM41A transmembrane protein 41A 2 2
MIRT565949 RRAGD Ras related GTP binding D 2 2
MIRT566632 NFYA nuclear transcription factor Y subunit alpha 2 4
MIRT566817 MAPK8 mitogen-activated protein kinase 8 2 2
MIRT567528 FGFR1OP FGFR1 oncogene partner 2 2
MIRT568630 ACVR2A activin A receptor type 2A 2 2
MIRT572140 DESI1 desumoylating isopeptidase 1 2 2
MIRT616028 TMTC1 transmembrane and tetratricopeptide repeat containing 1 2 4
MIRT620047 ODF4 outer dense fiber of sperm tails 4 2 2
MIRT620530 AVPR1A arginine vasopressin receptor 1A 2 2
MIRT621877 TAOK3 TAO kinase 3 2 2
MIRT623241 MLLT6 MLLT6, PHD finger containing 2 2
MIRT623993 FAM104A family with sequence similarity 104 member A 2 2
MIRT624300 COL12A1 collagen type XII alpha 1 chain 2 2
MIRT626282 PEX26 peroxisomal biogenesis factor 26 2 2
MIRT627770 RAB30 RAB30, member RAS oncogene family 2 2
MIRT641138 ZBTB33 zinc finger and BTB domain containing 33 2 2
MIRT644586 SPOP speckle type BTB/POZ protein 2 2
MIRT644819 DNAJC21 DnaJ heat shock protein family (Hsp40) member C21 2 2
MIRT645970 NHLRC2 NHL repeat containing 2 2 2
MIRT646170 PTPN14 protein tyrosine phosphatase, non-receptor type 14 2 2
MIRT646495 ZNF429 zinc finger protein 429 2 2
MIRT647833 RAB23 RAB23, member RAS oncogene family 2 2
MIRT648462 CCDC127 coiled-coil domain containing 127 2 2
MIRT657280 HRK harakiri, BCL2 interacting protein 2 2
MIRT658643 ENAH ENAH, actin regulator 2 2
MIRT658676 EMP2 epithelial membrane protein 2 2 2
MIRT665228 ZZZ3 zinc finger ZZ-type containing 3 2 2
MIRT669276 C19orf44 chromosome 19 open reading frame 44 2 2
MIRT676047 AUTS8 Autism, susceptibility to, 8 2 2
MIRT681483 DIP2A disco interacting protein 2 homolog A 2 2
MIRT681554 UBXN2A UBX domain protein 2A 2 2
MIRT683142 MTHFD1 methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 2 2
MIRT688534 DCAF7 DDB1 and CUL4 associated factor 7 2 2
MIRT689428 CYB561 cytochrome b561 2 2
MIRT689534 KIAA0513 KIAA0513 2 2
MIRT689894 SOD2 superoxide dismutase 2 2 2
MIRT695989 SNX19 sorting nexin 19 2 2
MIRT697780 UBXN7 UBX domain protein 7 2 2
MIRT702914 CRAMP1L cramped chromatin regulator homolog 1 2 2
MIRT703144 GPR137C G protein-coupled receptor 137C 2 2
MIRT703524 FKBP15 FK506 binding protein 15 2 2
MIRT704536 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 2 2
MIRT704997 CAMSAP1 calmodulin regulated spectrin associated protein 1 2 2
MIRT705721 AMMECR1L AMMECR1 like 2 2
MIRT707120 NWD1 NACHT and WD repeat domain containing 1 2 2
MIRT707451 PPFIBP1 PPFIA binding protein 1 2 2
MIRT707775 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT707888 SLC30A7 solute carrier family 30 member 7 2 2
MIRT720531 CHERP calcium homeostasis endoplasmic reticulum protein 2 2
MIRT723859 CD209 CD209 molecule 2 2
MIRT725349 MUC21 mucin 21, cell surface associated 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-548x Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)

Error report submission