miRTarBase - #MIRT135054


—
pre-miRNA Information
pre-miRNA hsa-mir-2116   
Genomic Coordinates chr15: 59171183 - 59171262
Description Homo sapiens miR-2116 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-2116-5p
Sequence 14| GGUUCUUAGCAUAGGAGGUCU |34
Evidence Experimental
Experiments 454
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 8 15 - 59171242 29233923 MiREDiBase
A-to-I 13 15 - 59171237 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1217966510 1 dbSNP
rs1170901508 3 dbSNP
rs1364783161 5 dbSNP
rs1240890962 11 dbSNP
rs537360898 13 dbSNP
rs776323490 17 dbSNP
Putative Targets

Gene Information
Gene Symbol ADSS   
Synonyms ADEH, ADSS 2
Description adenylosuccinate synthase
Transcript NM_001126   
Expression
Putative miRNA Targets on ADSS
3'UTR of ADSS
(miRNA target sites are highlighted)		 
>ADSS|NM_001126|3'UTR
   1 TGATTGCCAGTAATGCAAGAAACACTCCTTGAGAGGGAGGGGAAAAGACTTTCTTAAATATTTCATTTATGACCTGCAAA
  81 TTCAAGAATAAAGACACTGAAGTAAGTTTGAAGCCCTACAGTTGTTTCCAGTCTTTTCAGATGGATGCCTACTGTGGAGA
 161 TTAACTTTGGCATATTCCAGTGTCAGCTTTCTTTAGCTGGAATTGCCAAATCATTTGTTGCTCCTGCTGCTCTCATGGTG
 241 CCACGTTTTTTTTTTCAATGTTTAGTAATAGTATAATCCATGTTGTTTGATATCAAAAGTAGAATTACTTTTAATGTAGT
 321 TTTTCTTCATTATTGTCATTGCGTGTTCTTAAGTTTTACCCCTATTAGATGGTAAGAACAATTAATGCAGTTTTGCACAA
 401 ATATTTTTACATTCTGATCATTCAGTTCTGTCATTGTAATCTTTGTTGTTAGAAACAAATGATGAAAACATAGGGGTTCT
 481 GTAAACTTTTGTAATGCTATGAATTCTGTTTAAATTTTGGGCTGTCTATTTTCTGCTGAAACCATGCAAAATTGAGCTTT
 561 GGTGGGGCTGGGAGGGGGTTATGTATTCATGGGACCTTTAATTTGTACAGAACACAGAACTTATTTCTGTCAGTTATTTA
 641 ATACATTGAAAATTTAGTGAAATGTTCAAAGAGAATAGATGTTTCCCAAAACAACAATCTTTATGTTAAAAATAGTCATT
 721 AAAAGATCTGTTGTAATATATGGTGGATATTTTTCTTTAATTTCAAACATTACCTCTGAAATGTGTATCTTTTCTTTTTT
 801 ATCTTACCATTAATTTTAAATCTAGTGGATTGGTTTTCAACATCGTGCCTGCCGATATGCCTACAGAATCATCTGTAAGT
 881 GTCAAAATGAACCCACGTTGTTAGCCATAATTTTGATTATGCCTTTATTTCTCCTTTCTTGAAAAAAAAAAGGTGTTATT
 961 TTGACAATTAGGCATAACATTGTTTTGTAGATTATCTTTTAATGAACTATTTTAAATGTTAAATTAGGTGCCACTTAAAT
1041 TTATTTTATTACACCATGAATAGCTGATTAAAAGAACCAAATATTTCTAGTATGAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ucuGGAGGA--UACGAUUCUUGg 5'
             ||| :|  ||| ||||||| 
Target 5' accCCTATTAGATGGTAAGAACa 3'
 358 - 380 160.00 -15.20
2 
miRNA  3' ucUGGAGGAUACG-AU-UCUUGg 5'
            ||||:: || : || ||||| 
Target 5' ggACCTTTAATTTGTACAGAACa 3'
 592 - 614 127.00 -12.70
3 
miRNA  3' ucUGGAGGAUACGAUUCUUGg 5'
            |:|| :||||:||| ||: 
Target 5' caATCT-TTATGTTAAAAATa 3'
 695 - 714 122.00 -8.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30186031 2 COSMIC
COSN30451475 28 COSMIC
COSN13531264 35 COSMIC
COSN30147579 37 COSMIC
COSN31585735 47 COSMIC
COSN30452228 64 COSMIC
COSN30504775 66 COSMIC
COSN26565673 97 COSMIC
COSN30514927 97 COSMIC
COSN30502043 104 COSMIC
COSN30511050 129 COSMIC
COSN20096208 245 COSMIC
COSN15662456 307 COSMIC
COSN8453261 473 COSMIC
COSN26665123 616 COSMIC
COSN21461186 625 COSMIC
COSN30169504 706 COSMIC
COSN30543715 743 COSMIC
COSN31564826 755 COSMIC
COSN1440495 763 COSMIC
COSN20729400 832 COSMIC
COSN20096207 941 COSMIC
COSN29329295 1011 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs775010741 9 dbSNP
rs763477587 10 dbSNP
rs1482569529 12 dbSNP
rs773613590 17 dbSNP
rs769381301 22 dbSNP
rs1361862529 24 dbSNP
rs142770938 25 dbSNP
rs768237912 27 dbSNP
rs746467727 28 dbSNP
rs1323018600 34 dbSNP
rs901724210 35 dbSNP
rs1310738906 37 dbSNP
rs1223307603 38 dbSNP
rs1314012935 39 dbSNP
rs779975384 41 dbSNP
rs1348954085 42 dbSNP
rs758332023 43 dbSNP
rs750263853 46 dbSNP
rs756959937 48 dbSNP
rs752982808 49 dbSNP
rs536580352 51 dbSNP
rs1241668453 53 dbSNP
rs1488760194 56 dbSNP
rs1192793707 58 dbSNP
rs999478620 70 dbSNP
rs1479965477 76 dbSNP
rs1159661576 82 dbSNP
rs372936425 84 dbSNP
rs1413670921 85 dbSNP
rs1335879577 88 dbSNP
rs1322306332 90 dbSNP
rs1157754299 102 dbSNP
rs369919965 114 dbSNP
rs1437989647 145 dbSNP
rs1295758570 149 dbSNP
rs1366138500 151 dbSNP
rs1404693543 152 dbSNP
rs1045518459 154 dbSNP
rs1043474934 160 dbSNP
rs111320617 161 dbSNP
rs1304136442 166 dbSNP
rs1331481989 167 dbSNP
rs148535556 168 dbSNP
rs1283845073 175 dbSNP
rs915988741 180 dbSNP
rs1160564978 185 dbSNP
rs1470616522 186 dbSNP
rs1223909757 190 dbSNP
rs547499743 205 dbSNP
rs1196825982 214 dbSNP
rs1449804994 221 dbSNP
rs767953645 229 dbSNP
rs1222989578 232 dbSNP
rs755371449 236 dbSNP
rs1414102346 241 dbSNP
rs1283589466 243 dbSNP
rs752116051 244 dbSNP
rs556782598 245 dbSNP
rs1424663147 255 dbSNP
rs201400497 256 dbSNP
rs398103917 256 dbSNP
rs76040005 256 dbSNP
rs1408392790 257 dbSNP
rs1350931488 258 dbSNP
rs1279149333 271 dbSNP
rs972275098 273 dbSNP
rs113711112 275 dbSNP
rs536837642 279 dbSNP
rs1310752165 281 dbSNP
rs1284432919 285 dbSNP
rs962291660 291 dbSNP
rs1358626234 293 dbSNP
rs3087609 307 dbSNP
rs551409330 316 dbSNP
rs778369211 320 dbSNP
rs953125432 320 dbSNP
rs1203582733 331 dbSNP
rs1029164983 332 dbSNP
rs1473595764 333 dbSNP
rs1179607418 337 dbSNP
rs944413169 338 dbSNP
rs1449561621 341 dbSNP
rs767687620 342 dbSNP
rs192048704 343 dbSNP
rs1408525565 345 dbSNP
rs544085026 362 dbSNP
rs965861681 362 dbSNP
rs1401693992 364 dbSNP
rs1359932122 372 dbSNP
rs1450531971 374 dbSNP
rs986287338 386 dbSNP
rs1030869108 397 dbSNP
rs1170896134 401 dbSNP
rs1481434886 404 dbSNP
rs999426115 420 dbSNP
rs1340025044 426 dbSNP
rs903790016 461 dbSNP
rs953552360 461 dbSNP
rs565636331 462 dbSNP
rs548686962 469 dbSNP
rs1477454207 489 dbSNP
rs1043027809 490 dbSNP
rs915495189 492 dbSNP
rs1242154110 493 dbSNP
rs1464924895 495 dbSNP
rs1011993362 503 dbSNP
rs763195509 517 dbSNP
rs188643354 522 dbSNP
rs1426242584 528 dbSNP
rs761772668 528 dbSNP
rs938796038 532 dbSNP
rs183595622 536 dbSNP
rs1003565295 544 dbSNP
rs928787374 547 dbSNP
rs1435872672 551 dbSNP
rs1036505335 552 dbSNP
rs1324609792 557 dbSNP
rs1198256226 567 dbSNP
rs940915185 575 dbSNP
rs909465281 576 dbSNP
rs984436332 578 dbSNP
rs953161502 579 dbSNP
rs1263185671 582 dbSNP
rs921653783 582 dbSNP
rs975817351 586 dbSNP
rs1048957791 589 dbSNP
rs1218633713 606 dbSNP
rs965809809 607 dbSNP
rs1193015956 618 dbSNP
rs774705210 624 dbSNP
rs1272301155 630 dbSNP
rs1030816931 655 dbSNP
rs1479181115 656 dbSNP
rs999373806 663 dbSNP
rs550440493 664 dbSNP
rs1431847455 669 dbSNP
rs533528247 674 dbSNP
rs1332377751 675 dbSNP
rs765607331 680 dbSNP
rs1161449783 703 dbSNP
rs1382813404 705 dbSNP
rs1381729544 706 dbSNP
rs1324085239 716 dbSNP
rs1471063523 717 dbSNP
rs1406971068 721 dbSNP
rs1022631568 730 dbSNP
rs1402850641 731 dbSNP
rs1012198922 736 dbSNP
rs35885954 738 dbSNP
rs1170047850 750 dbSNP
rs1282441989 777 dbSNP
rs1465055057 787 dbSNP
rs762121079 791 dbSNP
rs1350726253 801 dbSNP
rs1229787480 817 dbSNP
rs1258587983 826 dbSNP
rs995126994 832 dbSNP
rs1209935164 838 dbSNP
rs564441604 842 dbSNP
rs1034335492 844 dbSNP
rs768749251 853 dbSNP
rs1268691840 854 dbSNP
rs1473133353 858 dbSNP
rs1184537640 861 dbSNP
rs1362314872 865 dbSNP
rs944419442 874 dbSNP
rs907307653 875 dbSNP
rs762855148 879 dbSNP
rs1050212103 881 dbSNP
rs1036452995 885 dbSNP
rs940867561 886 dbSNP
rs775108524 896 dbSNP
rs541478611 897 dbSNP
rs1411462614 900 dbSNP
rs1304350658 904 dbSNP
rs775360653 907 dbSNP
rs1334853471 909 dbSNP
rs932281312 914 dbSNP
rs1306272335 915 dbSNP
rs921577846 916 dbSNP
rs1220835241 920 dbSNP
rs1291702539 936 dbSNP
rs759334673 937 dbSNP
rs1215543743 941 dbSNP
rs944410800 949 dbSNP
rs1418763196 952 dbSNP
rs375505040 952 dbSNP
rs397962172 952 dbSNP
rs546910013 952 dbSNP
rs61084783 952 dbSNP
rs1491361146 953 dbSNP
rs527766409 971 dbSNP
rs1390734887 972 dbSNP
rs1296276168 994 dbSNP
rs1431376702 994 dbSNP
rs1395310674 1003 dbSNP
rs774331138 1004 dbSNP
rs977875288 1007 dbSNP
rs1383731558 1008 dbSNP
rs1379860257 1009 dbSNP
rs769885759 1015 dbSNP
rs1244646235 1016 dbSNP
rs562139270 1049 dbSNP
rs1023671917 1054 dbSNP
rs1022157577 1065 dbSNP
rs115523508 1074 dbSNP
rs952805163 1074 dbSNP
rs369680128 1085 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 159.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000366535.3 | 3UTR | AACAAUUAAUGCAGUUUUGCACAAAUAUUUUUACAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000366535.3 | 3UTR | UUUUACCCCUAUUAGAUGGUAAGAACAAUUAAUGCAGUUUUGCACAAAUAUUUUUACAUUCUGAUCAUUCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
THCA -0.351 0.11 -0.332 0.12 14 Click to see details
HNSC 0.587 0.11 0.543 0.13 6 Click to see details
KIRC -0.443 0.14 -0.619 0.05 8 Click to see details
LIHC -0.241 0.2 -0.354 0.11 14 Click to see details
PAAD 0.772 0.22 0.500 0.33 3 Click to see details
STAD 0.368 0.24 0.143 0.39 6 Click to see details
BRCA 0.288 0.24 0.095 0.41 8 Click to see details
KIRP -0.352 0.28 -0.500 0.2 5 Click to see details
UCEC -0.145 0.35 -0.250 0.26 9 Click to see details
LUSC 0.108 0.41 -0.071 0.44 7 Click to see details
LUSC 0.108 0.41 -0.071 0.44 7 Click to see details
LUSC 0.108 0.41 -0.071 0.44 7 Click to see details
LUSC 0.108 0.41 -0.071 0.44 7 Click to see details
LUSC 0.108 0.41 -0.071 0.44 7 Click to see details
LUSC 0.108 0.41 -0.071 0.44 7 Click to see details
LUSC 0.108 0.41 -0.071 0.44 7 Click to see details
62 hsa-miR-2116-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT080547 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 2 2
MIRT135054 ADSS adenylosuccinate synthase 2 4
MIRT147317 KPNA2 karyopherin subunit alpha 2 2 4
MIRT154323 CEBPB CCAAT/enhancer binding protein beta 2 2
MIRT326799 SYAP1 synapse associated protein 1 2 2
MIRT357963 GRPEL2 GrpE like 2, mitochondrial 2 2
MIRT384296 GOLT1B golgi transport 1B 2 2
MIRT442316 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 2 2
MIRT443785 ST13 ST13, Hsp70 interacting protein 2 2
MIRT446868 NBPF3 NBPF member 3 2 2
MIRT447647 RAB3GAP1 RAB3 GTPase activating protein catalytic subunit 1 2 2
MIRT448470 SLC45A4 solute carrier family 45 member 4 2 2
MIRT449121 XRRA1 X-ray radiation resistance associated 1 2 2
MIRT450245 TRIM66 tripartite motif containing 66 2 2
MIRT450270 F2RL2 coagulation factor II thrombin receptor like 2 2 2
MIRT450688 RPN2 ribophorin II 2 2
MIRT481123 AZIN1 antizyme inhibitor 1 2 4
MIRT497207 CDH7 cadherin 7 2 4
MIRT502956 CCNT2 cyclin T2 2 2
MIRT509226 KIF14 kinesin family member 14 2 6
MIRT515395 ARHGAP21 Rho GTPase activating protein 21 2 4
MIRT525559 MTRNR2L7 MT-RNR2-like 7 2 6
MIRT525608 MTRNR2L3 MT-RNR2-like 3 2 4
MIRT533254 VCAM1 vascular cell adhesion molecule 1 2 2
MIRT535782 MTRNR2L11 MT-RNR2-like 11 2 6
MIRT535803 MTRNR2L10 MT-RNR2-like 10 2 4
MIRT543211 TMEM117 transmembrane protein 117 2 2
MIRT552792 YAF2 YY1 associated factor 2 2 2
MIRT553947 STAMBP STAM binding protein 2 2
MIRT556217 MB21D2 Mab-21 domain containing 2 2 2
MIRT566351 POLDIP2 DNA polymerase delta interacting protein 2 2 2
MIRT568429 GDNF glial cell derived neurotrophic factor 2 2
MIRT568521 ANP32E acidic nuclear phosphoprotein 32 family member E 2 2
MIRT573359 PDE3A phosphodiesterase 3A 2 2
MIRT574653 LMAN2 lectin, mannose binding 2 2 2
MIRT608172 ERBB2 erb-b2 receptor tyrosine kinase 2 2 2
MIRT610692 FAM89A family with sequence similarity 89 member A 2 2
MIRT618459 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT622281 SH3TC2 SH3 domain and tetratricopeptide repeats 2 2 2
MIRT624615 B3GALT5 beta-1,3-galactosyltransferase 5 2 2
MIRT631041 TAS2R30 taste 2 receptor member 30 2 2
MIRT638335 RCAN1 regulator of calcineurin 1 2 2
MIRT641630 KIAA1244 ARFGEF family member 3 1 1
MIRT649117 SRD5A1 steroid 5 alpha-reductase 1 2 2
MIRT652246 TPI1 triosephosphate isomerase 1 2 2
MIRT659865 CAPRIN1 cell cycle associated protein 1 2 4
MIRT669219 CAND1 cullin associated and neddylation dissociated 1 2 2
MIRT682585 CPA4 carboxypeptidase A4 2 2
MIRT690129 EPHX2 epoxide hydrolase 2 2 2
MIRT699793 SEC24A SEC24 homolog A, COPII coat complex component 2 2
MIRT699991 RPS24 ribosomal protein S24 2 2
MIRT710376 LMBR1 limb development membrane protein 1 2 2
MIRT710412 YTHDC1 YTH domain containing 1 2 2
MIRT710574 TNPO1 transportin 1 2 2
MIRT712045 STYK1 serine/threonine/tyrosine kinase 1 2 2
MIRT713292 ADAMTS20 ADAM metallopeptidase with thrombospondin type 1 motif 20 2 2
MIRT718211 TNRC6C trinucleotide repeat containing 6C 2 2
MIRT718809 SLC25A33 solute carrier family 25 member 33 2 2
MIRT719341 VGLL4 vestigial like family member 4 2 2
MIRT720841 C1orf52 chromosome 1 open reading frame 52 2 2
MIRT724076 NCKAP1L NCK associated protein 1 like 2 2
MIRT724602 AP3B1 adaptor related protein complex 3 beta 1 subunit 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-2116 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-2116 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-2116 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-2116-5p Doxorubicin 31703 NSC123127 approved resistant High Hepatocellular Carcinoma cell line (HepG2)
hsa-miR-2116-5p Fulvestrant 17756771 NSC719276 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-2116-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-2116-5p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-2116-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-2116-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-2116-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-2116-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-2116-5p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-2116-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-2116-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-2116-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-2116-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-2116-5p Cisplatin 5460033 NSC119875 approved resistant cell line (OVSAHO)
hsa-miR-2116-5p Cisplatin 5460033 NSC119875 approved resistant cell line (TOV-112D)

Error report submission