miRTarBase - #MIRT135263


—
pre-miRNA Information
pre-miRNA hsa-mir-4796   
Genomic Coordinates chr3: 114743445 - 114743525
Description Homo sapiens miR-4796 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4796-3p
Sequence 53| UAAAGUGGCAGAGUAUAGACAC |74
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN9734363 9 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1045223845 8 dbSNP
rs185555286 18 dbSNP
Putative Targets

Gene Information
Gene Symbol TMBIM6   
Synonyms BAXI1, BI-1, TEGT
Description transmembrane BAX inhibitor motif containing 6
Transcript NM_001098576   
Other Transcripts NM_003217   
Expression
Putative miRNA Targets on TMBIM6
3'UTR of TMBIM6
(miRNA target sites are highlighted)		 
>TMBIM6|NM_001098576|3'UTR
   1 AGTGACCATCCAGCCTTTCCCAATTAGACTTCCTCTCCTTCCACCCCTCATTTCCTTTTTGCACACATTACAGGTGGTGT
  81 GTTCTGTGATAATGAAAAGCATCAGAAAAGCTTTTGTACTTTGTGGTTTCCTCTATTTTGAATTTTTTGATCAAAAAACT
 161 GATTAGCAGAATATAGTTTGGAGTTTGGCTTCATCTTCCTGGGGTTCCCCTCACTCCCTTTTTTGTCAACCCCATCTGTA
 241 GCCTCTTCCTCTACTCAGGCAGTCGACCCGCCACGATGAGAAGTGGGACCAGCAGAGGGCGCCAACTTCAGGAGTCCGCT
 321 TTCCCACCAGGCTTCATTCACCCAGTGGACCTGAACTGTTTGGTAGAGCCACCCGGCCCTTCCTTCCTCATTGTTGTTTG
 401 GTATGCGCACAGTTCCTGTGGGACTGGGCCGTGAGTTTTCCATTGGAAAGAAGTTCAGTGGTCCCATTGTTAACTCAGCC
 481 TCAAATCTCAACTGTCAGGCCCTACAAAGAAAATGGAGAGCCTCTTCTGGTGGATGCTTTGCTCCCTCTGAGCTGCCCAT
 561 GCTGGTCTGGCAAACACACCTTTCTGCTTTGCCTTCACAAAAGTAATGTGTTCCCTTTCCCACCCCTTGCCTGACCCTCA
 641 GGGAGTCAGCCTGCTTCCATCCATGGGTGGGAAGACTTCAGCACAAAGGAAAGACTAATTCTTGTCAGGCATTTTTGAAA
 721 AGGCTGATTATGTGTATCAAGGTACAGCATCGTAGGGTTCCCCTAAACTTGCCCTGTTTTTGTTTTTTTAGTTTGTTATC
 801 CCCTTACTGAGCGGCCTCTACTAGGTGGCTGTGATTAAATGTCCCAAGCAAGGATAGGGAAGGGGAATGGTTGAGCCTCT
 881 GGAGATCATTGTAACCAATCCTGCCAGACCTGTTTGGGGCAGTGGGGAGCAAACCTAGATAAGGACCTGTTTGGGGCAGC
 961 AGGGAGCAAAATCTCCTTTAACAACCAAGCAGTTCCTCATTCACATCAACAGAGCGAGGCTGTGATAACTTAGGAGGCAG
1041 CAATCCTAATAGTCCTTCAGTGCATTTTAGTCTGTCTCCAACTGGACACCAGTAGGTAGTGTCAAGCCAGAGATTCGGGG
1121 CAGTAGATAAATGTTCATTTTACTGATGCACTTTAGTTTTTGGTCTGTTACCTGTTTTCCAGAAATTTGTGGCCTTTTAG
1201 GCGGGAGTTAGGCGACCAAACCAGTGAGAGCCCCAATCCCTGCAGTTTTGTGGCTTCAAGTGTGGGTGGACAGTCCTAAT
1281 GGGGATCTCCAGCTCCTTCCTGTGGGCTGCCACAGACAGCTACCCCCAGAAGGGTCAATGTTGGGAGTGGTTGTGGCTCT
1361 GAGCTGCTCTACAGAGCTTCAGTGTGAGAGGATCGAGCCATTGAAAGCTCATTACCAGTAGGACATAATTTTTGGCTCTC
1441 CCTATTCACAACCAGTGCACAGTTTGACACAGTGGCCTCAGGTTCACAGTGCACCATGTCACTGTGCTATCCTACGAAAT
1521 CATTTGTTTCTAAGTTGTGTTTATTCCTGGAGTGACATGCCACCCCGAATGGCTCACTTTCACTGAGGATGCTGTCCTCT
1601 GATTTAGCTGCTGCCTCCAGCCTCTGGCTTGAGAACTTACTAAAGGCACTTCCTTCCTGTTAAACCCCTGTTAACTCTCC
1681 ATAAATTTGGTGATTCTCTGCTAGGCCTAAGATTTTGAGTTAACATCTCTTGAAGCCAAACTCCACCTTCTGTGCTTTTT
1761 GCTTGGGATAATGGAGTTTTTCTTTAGAAACAGTGCCAAGAATGACAAGATATTAAAAAAAAAAAAGAAAGAAAAAAAAA
1841 AAAACACCTACTTTTAAAGAAAATACCTAACAGATTTTTAATATAGTTATCTCTACCACTTTCTTTTCTAGTTTCTTGAT
1921 TTTCAGCTCAGGCTGCATTCTAACTCATACTGTGAAGACAAAGGTGTTTTTGATTCAGAAATATATGAAATCTGCATAGT
2001 CTTAATTTGTAAAAAATAAAGAAAATTCCTTAACCTTTA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' caCAGAUAUGAGACGGUGAAAu 5'
            || ||| |||| ||||||| 
Target 5' taGT-TAT-CTCTACCACTTTc 3'
 1884 - 1903 166.00 -14.00
2 
miRNA  3' cacAGAUAUGAGAC---------GGUGAAAu 5'
             |:|:||||:||         |:|:||| 
Target 5' gctTTTGTACTTTGTGGTTTCCTCTATTTTg 3'
 110 - 140 127.00 -11.90
3 
miRNA  3' caCAGAUAUGA-GAC--GGUGAAAu 5'
            ||: || :| |||   |||||| 
Target 5' atGTTCATTTTACTGATGCACTTTa 3'
 1131 - 1155 126.00 -10.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26574151 7 COSMIC
COSN30476933 38 COSMIC
COSN30484838 56 COSMIC
COSN30503568 181 COSMIC
COSN30196542 480 COSMIC
COSN19079035 814 COSMIC
COSN1575560 855 COSMIC
COSN1575561 868 COSMIC
COSN20109549 1301 COSMIC
COSN20109550 1761 COSMIC
COSN24544451 1824 COSMIC
COSN7373020 1828 COSMIC
COSN18880343 1832 COSMIC
COSN31550068 1834 COSMIC
COSN20343009 1866 COSMIC
COSN29516671 1985 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs757804497 3 dbSNP
rs1265100477 5 dbSNP
rs1439380306 6 dbSNP
rs1220465306 7 dbSNP
rs1182192253 8 dbSNP
rs1232066179 12 dbSNP
rs781633038 14 dbSNP
rs745385517 15 dbSNP
rs1418020351 19 dbSNP
rs370807894 20 dbSNP
rs1460413872 21 dbSNP
rs113280849 24 dbSNP
rs541981821 27 dbSNP
rs774851770 33 dbSNP
rs368576424 35 dbSNP
rs768385751 36 dbSNP
rs1408298737 38 dbSNP
rs1333129556 43 dbSNP
rs1301679783 44 dbSNP
rs754060331 44 dbSNP
rs774227524 44 dbSNP
rs1295292007 46 dbSNP
rs761478739 50 dbSNP
rs371163791 51 dbSNP
rs562249578 55 dbSNP
rs1308088650 64 dbSNP
rs1411194634 72 dbSNP
rs528037654 78 dbSNP
rs28932169 80 dbSNP
rs1015841671 87 dbSNP
rs1379089233 95 dbSNP
rs1430741676 100 dbSNP
rs899959941 105 dbSNP
rs1194510519 111 dbSNP
rs1368455801 112 dbSNP
rs1490245190 116 dbSNP
rs961393398 143 dbSNP
rs995611990 144 dbSNP
rs1165908553 150 dbSNP
rs1436100406 154 dbSNP
rs1048948344 155 dbSNP
rs1220250512 163 dbSNP
rs570462555 165 dbSNP
rs919898773 175 dbSNP
rs773354341 184 dbSNP
rs1287724714 200 dbSNP
rs1004203101 205 dbSNP
rs1383484146 207 dbSNP
rs1308219741 209 dbSNP
rs1024950882 210 dbSNP
rs112133089 210 dbSNP
rs376714994 210 dbSNP
rs17123947 213 dbSNP
rs1381991826 214 dbSNP
rs11540522 218 dbSNP
rs1243443647 219 dbSNP
rs74087196 230 dbSNP
rs1034196902 234 dbSNP
rs958778442 235 dbSNP
rs989953456 236 dbSNP
rs1173945323 239 dbSNP
rs1056331231 243 dbSNP
rs1021773925 244 dbSNP
rs1259252558 246 dbSNP
rs375526408 249 dbSNP
rs535649050 250 dbSNP
rs1205846848 257 dbSNP
rs1232367807 257 dbSNP
rs977067892 261 dbSNP
rs912205773 262 dbSNP
rs1033229596 265 dbSNP
rs957890352 267 dbSNP
rs149823084 270 dbSNP
rs145793344 271 dbSNP
rs891323225 272 dbSNP
rs1278436532 275 dbSNP
rs561092199 277 dbSNP
rs1444800151 278 dbSNP
rs193229068 294 dbSNP
rs931456458 302 dbSNP
rs1048503683 304 dbSNP
rs1389017356 306 dbSNP
rs1161102772 307 dbSNP
rs1454861472 307 dbSNP
rs887204438 316 dbSNP
rs1288969494 318 dbSNP
rs940063719 319 dbSNP
rs1182490734 325 dbSNP
rs1015748219 330 dbSNP
rs961636779 334 dbSNP
rs1046437652 337 dbSNP
rs11540521 340 dbSNP
rs906501775 342 dbSNP
rs1465750939 343 dbSNP
rs756337260 344 dbSNP
rs1262863717 345 dbSNP
rs577186951 355 dbSNP
rs1214170124 362 dbSNP
rs148039038 362 dbSNP
rs995726517 368 dbSNP
rs11540524 375 dbSNP
rs377472837 376 dbSNP
rs1312298505 379 dbSNP
rs1011810084 380 dbSNP
rs986312442 384 dbSNP
rs1365926969 386 dbSNP
rs1021426613 388 dbSNP
rs1305106380 390 dbSNP
rs1344411321 391 dbSNP
rs758287644 391 dbSNP
rs7688 393 dbSNP
rs1426790331 397 dbSNP
rs1383398113 401 dbSNP
rs1019247964 402 dbSNP
rs746928453 408 dbSNP
rs975728622 409 dbSNP
rs376195970 410 dbSNP
rs562348470 412 dbSNP
rs1247665270 417 dbSNP
rs1222700726 422 dbSNP
rs931553895 427 dbSNP
rs527866919 431 dbSNP
rs757217150 432 dbSNP
rs780627389 435 dbSNP
rs940097923 438 dbSNP
rs1342759152 443 dbSNP
rs1457591087 444 dbSNP
rs745362216 452 dbSNP
rs541739077 463 dbSNP
rs776254207 463 dbSNP
rs1360930281 464 dbSNP
rs937989378 467 dbSNP
rs3782324 469 dbSNP
rs1364017687 472 dbSNP
rs1159119303 482 dbSNP
rs1302591889 482 dbSNP
rs1427992639 487 dbSNP
rs532966401 491 dbSNP
rs1467834844 492 dbSNP
rs1043621009 493 dbSNP
rs925005972 505 dbSNP
rs1011466236 508 dbSNP
rs11540523 516 dbSNP
rs932297026 524 dbSNP
rs1043283897 526 dbSNP
rs902989966 530 dbSNP
rs998594865 535 dbSNP
rs549751405 538 dbSNP
rs1202133751 539 dbSNP
rs1019319291 544 dbSNP
rs769478257 545 dbSNP
rs890890644 551 dbSNP
rs1375738568 554 dbSNP
rs965044222 558 dbSNP
rs1392195910 559 dbSNP
rs1282654057 562 dbSNP
rs775154572 565 dbSNP
rs1283676895 576 dbSNP
rs1321506162 580 dbSNP
rs748891900 584 dbSNP
rs138542934 588 dbSNP
rs897290359 597 dbSNP
rs953079774 601 dbSNP
rs1307454988 607 dbSNP
rs529039057 615 dbSNP
rs1296586591 616 dbSNP
rs908746648 616 dbSNP
rs1461918905 620 dbSNP
rs774770768 624 dbSNP
rs1360292521 629 dbSNP
rs548786076 631 dbSNP
rs188209222 634 dbSNP
rs762283660 636 dbSNP
rs1479633549 640 dbSNP
rs995800562 640 dbSNP
rs961537182 641 dbSNP
rs1027644700 646 dbSNP
rs534487502 657 dbSNP
rs759373952 659 dbSNP
rs1252030989 661 dbSNP
rs1193639330 663 dbSNP
rs982218735 666 dbSNP
rs928018755 674 dbSNP
rs938078894 675 dbSNP
rs140221298 680 dbSNP
rs1182445554 685 dbSNP
rs1263727776 686 dbSNP
rs1205502396 691 dbSNP
rs1267806118 693 dbSNP
rs566829279 699 dbSNP
rs1240014609 700 dbSNP
rs1035665988 702 dbSNP
rs960120254 707 dbSNP
rs915204587 710 dbSNP
rs1390944917 711 dbSNP
rs1383650957 713 dbSNP
rs1429864562 714 dbSNP
rs1409326813 717 dbSNP
rs769821742 725 dbSNP
rs1468703231 730 dbSNP
rs947299343 743 dbSNP
rs1167987897 745 dbSNP
rs1160444978 748 dbSNP
rs1453990175 752 dbSNP
rs1042946980 753 dbSNP
rs1356071962 758 dbSNP
rs768043631 761 dbSNP
rs1462369148 779 dbSNP
rs1185288177 780 dbSNP
rs988815749 781 dbSNP
rs1242300848 783 dbSNP
rs1302769345 791 dbSNP
rs773201944 791 dbSNP
rs571169929 795 dbSNP
rs879062090 799 dbSNP
rs1238644360 804 dbSNP
rs998627335 813 dbSNP
rs966508033 814 dbSNP
rs77031795 821 dbSNP
rs1319354077 822 dbSNP
rs1384320562 824 dbSNP
rs145607842 829 dbSNP
rs932562064 838 dbSNP
rs576020279 842 dbSNP
rs1049875303 844 dbSNP
rs912196853 864 dbSNP
rs1165008201 879 dbSNP
rs1442670060 885 dbSNP
rs1242511282 886 dbSNP
rs1308432192 887 dbSNP
rs943773037 888 dbSNP
rs1290541775 890 dbSNP
rs996570358 891 dbSNP
rs1490591397 896 dbSNP
rs1294033706 900 dbSNP
rs1224012104 901 dbSNP
rs931457578 903 dbSNP
rs997175657 907 dbSNP
rs148057357 913 dbSNP
rs1001758423 916 dbSNP
rs1399011296 916 dbSNP
rs1365854984 923 dbSNP
rs1304411555 926 dbSNP
rs535589055 931 dbSNP
rs555558279 935 dbSNP
rs1036101283 936 dbSNP
rs572622942 940 dbSNP
rs1476359854 944 dbSNP
rs550787678 948 dbSNP
rs754130110 952 dbSNP
rs1162742919 953 dbSNP
rs961564671 967 dbSNP
rs966540555 973 dbSNP
rs982289011 979 dbSNP
rs1490194411 986 dbSNP
rs979693610 989 dbSNP
rs928090777 990 dbSNP
rs565162499 994 dbSNP
rs1338095053 996 dbSNP
rs541232316 998 dbSNP
rs1269950185 1003 dbSNP
rs766233742 1016 dbSNP
rs959722078 1017 dbSNP
rs1303763736 1020 dbSNP
rs569422961 1023 dbSNP
rs1402723663 1026 dbSNP
rs1348735889 1027 dbSNP
rs1329014158 1030 dbSNP
rs915262239 1034 dbSNP
rs1411586840 1035 dbSNP
rs184002835 1040 dbSNP
rs1169665152 1042 dbSNP
rs1042976685 1044 dbSNP
rs954108107 1046 dbSNP
rs1197450554 1047 dbSNP
rs1480238516 1049 dbSNP
rs1233523788 1057 dbSNP
rs1184133220 1059 dbSNP
rs985357796 1060 dbSNP
rs924545256 1065 dbSNP
rs188543212 1071 dbSNP
rs1261676986 1076 dbSNP
rs550713077 1077 dbSNP
rs1366547548 1081 dbSNP
rs1279600067 1088 dbSNP
rs1443804090 1090 dbSNP
rs1333497914 1097 dbSNP
rs544116927 1100 dbSNP
rs1040859258 1107 dbSNP
rs1245652579 1117 dbSNP
rs900972219 1118 dbSNP
rs1174089416 1119 dbSNP
rs932429490 1123 dbSNP
rs539942980 1133 dbSNP
rs1160539622 1140 dbSNP
rs181888694 1144 dbSNP
rs1237647985 1146 dbSNP
rs1184687683 1149 dbSNP
rs1290235719 1154 dbSNP
rs528870261 1160 dbSNP
rs1241678599 1162 dbSNP
rs905990244 1165 dbSNP
rs371280494 1166 dbSNP
rs1284458670 1167 dbSNP
rs1225144627 1170 dbSNP
rs373885498 1173 dbSNP
rs1307910170 1176 dbSNP
rs1453264446 1180 dbSNP
rs1384960568 1182 dbSNP
rs117948747 1188 dbSNP
rs551243245 1189 dbSNP
rs1393387303 1202 dbSNP
rs897428900 1203 dbSNP
rs757191414 1204 dbSNP
rs1035193167 1208 dbSNP
rs1383156384 1214 dbSNP
rs1446286642 1215 dbSNP
rs571109254 1217 dbSNP
rs959559331 1229 dbSNP
rs991351450 1231 dbSNP
rs111798126 1234 dbSNP
rs1487135988 1237 dbSNP
rs968480974 1241 dbSNP
rs550446144 1244 dbSNP
rs1312785758 1254 dbSNP
rs978083340 1260 dbSNP
rs1227677617 1261 dbSNP
rs569744587 1263 dbSNP
rs1362326731 1266 dbSNP
rs1290475598 1270 dbSNP
rs1346258721 1277 dbSNP
rs535453055 1286 dbSNP
rs555845944 1296 dbSNP
rs1363823174 1297 dbSNP
rs904629806 1297 dbSNP
rs1164604477 1298 dbSNP
rs3832814 1299 dbSNP
rs573092648 1303 dbSNP
rs1185210612 1317 dbSNP
rs1385429893 1318 dbSNP
rs923904521 1319 dbSNP
rs934587623 1320 dbSNP
rs572401399 1321 dbSNP
rs1263184178 1324 dbSNP
rs878987790 1327 dbSNP
rs1297417337 1328 dbSNP
rs185233746 1333 dbSNP
rs1221538268 1339 dbSNP
rs370768170 1341 dbSNP
rs1363725692 1350 dbSNP
rs1049973172 1352 dbSNP
rs1293072637 1354 dbSNP
rs7297617 1360 dbSNP
rs1329702468 1362 dbSNP
rs1202950223 1371 dbSNP
rs190500256 1374 dbSNP
rs972403947 1378 dbSNP
rs1465398507 1381 dbSNP
rs1462469213 1383 dbSNP
rs918220251 1386 dbSNP
rs544153688 1394 dbSNP
rs941062570 1395 dbSNP
rs755644398 1396 dbSNP
rs983883290 1402 dbSNP
rs563941758 1419 dbSNP
rs779472145 1426 dbSNP
rs1480904917 1439 dbSNP
rs1252949426 1441 dbSNP
rs927486600 1445 dbSNP
rs1317000512 1450 dbSNP
rs575791440 1452 dbSNP
rs1225562743 1457 dbSNP
rs368008253 1458 dbSNP
rs1057338722 1459 dbSNP
rs917518568 1460 dbSNP
rs1003831463 1471 dbSNP
rs1469416409 1481 dbSNP
rs1375662515 1483 dbSNP
rs1035274795 1487 dbSNP
rs946272861 1488 dbSNP
rs1174891454 1489 dbSNP
rs1407283977 1492 dbSNP
rs1409008614 1493 dbSNP
rs1179117097 1494 dbSNP
rs1396947100 1497 dbSNP
rs904494196 1500 dbSNP
rs1375628471 1503 dbSNP
rs895327908 1506 dbSNP
rs1328645058 1510 dbSNP
rs1174941614 1514 dbSNP
rs768282075 1516 dbSNP
rs779193301 1517 dbSNP
rs1176638094 1520 dbSNP
rs1050527822 1542 dbSNP
rs1439571736 1545 dbSNP
rs1205371740 1550 dbSNP
rs889649063 1562 dbSNP
rs1006708227 1567 dbSNP
rs542215097 1568 dbSNP
rs1280994087 1572 dbSNP
rs1307248629 1575 dbSNP
rs755596000 1577 dbSNP
rs748511321 1582 dbSNP
rs559405735 1584 dbSNP
rs528224667 1598 dbSNP
rs1384238677 1605 dbSNP
rs1339081709 1606 dbSNP
rs11540519 1607 dbSNP
rs1030995948 1612 dbSNP
rs551448292 1614 dbSNP
rs1301830986 1632 dbSNP
rs1428694047 1635 dbSNP
rs1454006073 1638 dbSNP
rs1365012678 1639 dbSNP
rs752640648 1649 dbSNP
rs966017011 1655 dbSNP
rs772281679 1657 dbSNP
rs1156371690 1662 dbSNP
rs994044912 1663 dbSNP
rs1385837893 1665 dbSNP
rs1025351783 1668 dbSNP
rs1440417198 1669 dbSNP
rs952403662 1677 dbSNP
rs564774135 1678 dbSNP
rs1283933641 1694 dbSNP
rs1239581309 1695 dbSNP
rs1360287600 1697 dbSNP
rs7297969 1699 dbSNP
rs1317725902 1702 dbSNP
rs927044412 1713 dbSNP
rs932534753 1723 dbSNP
rs958677028 1725 dbSNP
rs1382428774 1726 dbSNP
rs1272042190 1728 dbSNP
rs1436226275 1730 dbSNP
rs544874901 1734 dbSNP
rs150562807 1740 dbSNP
rs1365668476 1741 dbSNP
rs909664850 1747 dbSNP
rs1367673487 1756 dbSNP
rs3832813 1756 dbSNP
rs386376459 1756 dbSNP
rs1197416420 1763 dbSNP
rs1432036207 1766 dbSNP
rs941095302 1772 dbSNP
rs550485249 1777 dbSNP
rs1467026969 1782 dbSNP
rs567189440 1791 dbSNP
rs1193685618 1795 dbSNP
rs535851909 1800 dbSNP
rs1430500422 1801 dbSNP
rs966085622 1807 dbSNP
rs1394773196 1810 dbSNP
rs1412051343 1812 dbSNP
rs1309445266 1813 dbSNP
rs549155324 1814 dbSNP
rs1325032314 1815 dbSNP
rs1362787493 1815 dbSNP
rs1389987376 1815 dbSNP
rs3210523 1815 dbSNP
rs917382791 1815 dbSNP
rs1403751870 1816 dbSNP
rs1466956402 1819 dbSNP
rs1193143901 1821 dbSNP
rs1280836468 1821 dbSNP
rs1271135714 1822 dbSNP
rs1271521676 1822 dbSNP
rs1480919262 1822 dbSNP
rs77091058 1822 dbSNP
rs1196892954 1823 dbSNP
rs1274261626 1823 dbSNP
rs1198085933 1824 dbSNP
rs555664960 1824 dbSNP
rs878997390 1824 dbSNP
rs1332698604 1825 dbSNP
rs534839621 1825 dbSNP
rs1233886546 1826 dbSNP
rs1342465279 1826 dbSNP
rs777476590 1826 dbSNP
rs370800854 1827 dbSNP
rs67548374 1827 dbSNP
rs1063466 1828 dbSNP
rs796338406 1828 dbSNP
rs1184588681 1829 dbSNP
rs1337189874 1829 dbSNP
rs1237927962 1830 dbSNP
rs1280251810 1830 dbSNP
rs1462955266 1830 dbSNP
rs140131076 1831 dbSNP
rs1292621134 1832 dbSNP
rs1360711904 1832 dbSNP
rs1413898693 1832 dbSNP
rs1453032852 1832 dbSNP
rs1491293118 1832 dbSNP
rs58387198 1832 dbSNP
rs1036772273 1833 dbSNP
rs199853731 1833 dbSNP
rs1160579059 1834 dbSNP
rs1275586626 1834 dbSNP
rs1380174027 1835 dbSNP
rs1490258032 1835 dbSNP
rs199875731 1836 dbSNP
rs796917689 1836 dbSNP
rs1271142746 1838 dbSNP
rs1236097805 1839 dbSNP
rs1207567262 1840 dbSNP
rs1433908491 1842 dbSNP
rs938979794 1842 dbSNP
rs1041950460 1843 dbSNP
rs1193082012 1843 dbSNP
rs77128574 1843 dbSNP
rs1057146581 1844 dbSNP
rs1246625097 1845 dbSNP
rs895412917 1845 dbSNP
rs1012874398 1846 dbSNP
rs1447539886 1848 dbSNP
rs1346068886 1850 dbSNP
rs1300307020 1856 dbSNP
rs1043908644 1860 dbSNP
rs1359987566 1864 dbSNP
rs1164712419 1865 dbSNP
rs1049986 1866 dbSNP
rs544239127 1872 dbSNP
rs1370737338 1874 dbSNP
rs759900274 1884 dbSNP
rs1472245314 1891 dbSNP
rs1263394148 1892 dbSNP
rs1050968805 1899 dbSNP
rs1423618883 1900 dbSNP
rs1486983032 1900 dbSNP
rs1222213940 1912 dbSNP
rs1284700093 1912 dbSNP
rs1031028502 1926 dbSNP
rs1300672962 1935 dbSNP
rs889226704 1938 dbSNP
rs1008949807 1941 dbSNP
rs1040900392 1942 dbSNP
rs966048240 1947 dbSNP
rs537605405 1962 dbSNP
rs1280268316 1976 dbSNP
rs61401764 1979 dbSNP
rs182479619 1980 dbSNP
rs1398401745 1981 dbSNP
rs1339915508 1983 dbSNP
rs1392256381 1984 dbSNP
rs997542021 1985 dbSNP
rs3210539 1986 dbSNP
rs187055776 1992 dbSNP
rs1029383746 1993 dbSNP
rs1426237635 1996 dbSNP
rs543305737 1997 dbSNP
rs1195320390 1998 dbSNP
rs994117586 2001 dbSNP
rs552737309 2002 dbSNP
rs1025553115 2012 dbSNP
rs1489188120 2014 dbSNP
rs952506564 2016 dbSNP
rs1005236095 2018 dbSNP
rs1034402170 2019 dbSNP
rs572784294 2034 dbSNP
rs1259820370 2036 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cacaGAUAUGAGACGGUGAAAu 5'
              :||| |||| ||||||| 
Target 5' ----UUAU-CUCUACCACUUUc 3'
 		1 - 17
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 7009.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 7009.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset GSM4903828
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / PID21_9124
Location of target site NM_003217 | 3UTR | UUACUGAUGCACUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161237
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_001098576 | 3UTR | AGAUAAAUGUUCAUUUUACUGAUGCACUUUAGUUUUUGGUCUGUUACCUGUUUUCCAGAAAUUUGUGGCCUUUUAGGCGGGAGUUAGGCGACCAAACCAGUGAGAGCCCCAAUCCCUGCAGUUUUGUGGCUUCAAGUGUGGGUGGACAGUCCUAAUGGGGAUCUCCAGCUCCUUCCUGUGGGCUGCCACAGACAGCUACCCCCAGAAGGGUCAAUGUUGGGAGUGGUUGUGGCUCUGAGCUGCUCUACAGAGCUUCAGUGUGAGAGGAUCGAGCCAUUGAAAGCUCAUUACCAGUAGGACAUAAUUUUUGGCUCUCCCUAUUCACAACCAGUGCACAGUUUGACACAGUGGCCUCAGGUUCACAGUGCACCAUGUCACUGUGCUAUCCUACGAAAUCAUUUGUUUCUAAGUUGUGUUUAUUCCUGGAGUGACAUGCCACCCCGAAUGGCUCACUUUCACUGAGGAUGCUGUCCUCUGAUUUAGCUGCUGCCUCCAGCCUCUGGCUUGAGAACUUACUAAAGGCACUUCCUUCCUGUUAAACCCCUGUUAACUCUCCAUAAAUUUGGUGAUUCUCUGCUAGGCCUAAGAUUUUGAGUUAACAUCUCUUGAAGCCAAACUCCACCUUCUGUGCUUUUUGCUUGGGAUAAUGGAGUUUUUCUUUAGAAACAGUGCCAAGAAUGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4903834
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_b
Location of target site NM_001098576 | 3UTR | AAGCCAGAGAUUCGGGGCAGUAGAUAAAUGUUCAUUUUACUGAUGCACUUUAGUUUUUGGUCUGUUACCUGUUUUCCAGAAAUUUGUGGCCUUUUAGGCGGGAGUUAGGCGACCAAACCAGUGAGAGCCCCAAUCCCUGCAGUUUUGUGGCUUCAAGUGUGGGUGGACAGUCCUAAUGGGGAUCUCCAGCUCCUUCCUGUGGGCUGCCACAGACAGCUACCCCCAGAAGGGUCAAUGUUGGGAGUGGUUGUGGCUCUGAGCUGCUCUACAGAGCUUCAGUGUGAGAGGAUCGAGCCAUUGAAAGCUCAUUACCAGUAGGACAUAAUUUUUGGCUCUCCCUAUUCACAACCAGUGCACAGUUUGACACAGUGGCCUCAGGUUCACAGUGCACC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM4903835
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_c
Location of target site NM_001098576 | 3UTR | CGGGGCAGUAGAUAAAUGUUCAUUUUACUGAUGCACUUUAGUUUUUGGUCUGUUACCUGUUUUCCAGAAAUUUGUGGCCUUUUAGGCGGGAGUUAGGCGACCAAACCAGUGAGAGCCCCAAUCCCUGCAGUUUUGUGGCUUCAAGUGUGGGUGGACAGUCCUAAUGGGGAUCUCCAGCUCCUUCCUGUGGGCUGCCACAGACAGCUACCCCCAGAAGGGUCAAUGUUGGGAGUGGUUGUGGCUCUGAGCUGCUCUACAGAGCUUCAGUGUGAGAGGAUCGAGCCAUUGAAAGCUCAUUACCAGUAGGACAUAAUUUUUGGCUCUCCCUAUUCACAACCAGUGCACAGUUUGACACAGUGGCCUCAGGUUCACAGUGCACCAUGUCACUGUGCUAUCCUACGAAAUCAUUUGUUUCUAAGUUGUGUUUAUUCCUGGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM4903836
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_a
Location of target site NM_001098576 | 3UTR | AGAGAUUCGGGGCAGUAGAUAAAUGUUCAUUUUACUGAUGCACUUUAGUUUUUGGUCUGUUACCUGUUUUCCAGAAAUUUGUGGCCUUUUAGGCGGGAGUUAGGCGACCAAACCAGUGAGAGCCCCAAUCCCUGCAGUUUUGUGGCUUCAAGUGUGGGUGGACAGUCCUAAUGGGGAUCUCCAGCUCCUUCCUGUGGGCUGCCACAGACAGCUACCCCCAGAAGGGUCAAUGUUGGGAGUGGUUGUGGCUCUGAGCUGCUCUACAGAGCUUCAGUGUGAGAGGAUCGAGCCAUUGAAAGCUCAUUACCAGUAGGACAUAAUUUUUGGCUCUCCCUAUUCACAACCAGUGCACAGUUUGACACAGUGGCCUCAGGUUCACAGUGCACCAUGUCACUGUGCUAUCCUACGAAAUCAUUUGUUUCUAAGUUGUGUUUAUUCCUGGAGUGACAUGCCACCCCGAAUGGCUCACUUUCACUGAGGAUGCUGUCCUCUGAUUUAGCUGCUGCCUCCAGCCUCUGGCUUGAGAACUUACUAAAGGCACUUCCUUCCUGUUAAACCCCUGUUAACUCUCCAUAAAUUUGGUGAUUCUCUGCUAGGCCUAAGAUUUUGAGUUAACAUCUCUUGAAGCCAAACUCCACCUUCUGUGCUUUUUGCUUGGGAUAAUGGAGUUUUUCUUUAGAAACA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM4903837
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_b
Location of target site NM_001098576 | 3UTR | GGGCAGUAGAUAAAUGUUCAUUUUACUGAUGCACUUUAGUUUUUGGUCUGUUACCUGUUUUCCAGAAAUUUGUGGCCUUUUAGGCGGGAGUUAGGCGACCAAACCAGUGAGAGCCCCAAUCCCUGCAGUUUUGUGGCUUCAAGUGUGGGUGGACAGUCCUAAUGGGGAUCUCCAGCUCCUUCCUGUGGGCUGCCACAGACAGCUACCCCCAGAAGGGUCAAUGUUGGGAGUGGUUGUGGCUCUGAGCUGCUCUACAGAGCUUCAGUGUGAGAGGAUCGAGCCAUUGAAAGCUCAUUACCAGUAGGACAUAAUUUUUGGCUCUCCCUAUUCACAACCAGUGCACAGUUUGACACAGUGGCCUCAGGUUCACAGUGCACCAUGUCACUGUGCUAUCCUACGAAAUCAUUUGUUUCUAAGUUGUGUUUAUUCCUGGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM4903838
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_c
Location of target site NM_001098576 | 3UTR | UCGGGGCAGUAGAUAAAUGUUCAUUUUACUGAUGCACUUUAGUUUUUGGUCUGUUACCUGUUUUCCAGAAAUUUGUGGCCUUUUAGGCGGGAGUUAGGCGACCAAACCAGUGAGAGCCCCAAUCCCUGCAGUUUUGUGGCUUCAAGUGUGGGUGGACAGUCCUAAUGGGGAUCUCCAGCUCCUUCCUGUGGGCUGCCACAGACAGCUACCCCCAGAAGGGUCAAUGUUGGGAGUGGUUGUGGCUCUGAGCUGCUCUACAGAGCUUCAGUGUGAGAGGAUCGAGCCAUUGAAAGCUCAUUACCAGUAGGACAUAAUUUUUGGCUCUCCCUAUUCACAACCAGUGCACAGUUUGACACAGUGGCCUCAGGUUCACAGUGCACCAUGUCACUGUGCUAUCCUACGAAAUCAUUUGUUUCUAAGUUGUGUUUAUUCCUGGAGUGACAUGCCACCCCGAAUGGCUCACUUUCACUGAGGAUGCUGUCCUCUGAUUUAGCUGCUGCCUCCAGCCUCUGGCUUGAGAACUUACUAAAGGCACUUCCUUCCUGUUAAACCCCUGUUAACUCUCCAUAAAUUUGGUGAUUCUCUGCUAGGCCUAAGAUUUUGAGUUAACAUCUCUUGAAGCCAAACUCCACCUUCUGUGCUUUUUGCUUGGGAUAAUGGAGUUUUUCUUUAGAAACA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000423828.1 | 3UTR | UUAUCUCUACCACUUUCUUUUCUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000423828.1 | 3UTR | UUAUCUCUACCACUUUCUUUUCUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000423828.1 | 3UTR | UUAUCUCUACCACUUUCUUUUCUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 11 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000423828.1 | 3UTR | CUCUACCACUUUCUUUUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 12 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000423828.1 | 3UTR | AUAGUUAUCUCUACCACUUUCUUUUCUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 13 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000423828.1 | 3UTR | UUAUCUCUACCACUUUCUUUUCUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
276 hsa-miR-4796-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT057030 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT065682 ACVR1B activin A receptor type 1B 2 6
MIRT066973 ATXN7L3B ataxin 7 like 3B 2 2
MIRT068903 TPRG1L tumor protein p63 regulated 1 like 2 2
MIRT069713 FOXJ3 forkhead box J3 2 2
MIRT072259 B2M beta-2-microglobulin 2 10
MIRT074331 TNRC6A trinucleotide repeat containing 6A 2 10
MIRT075132 C16ORF70 chromosome 16 open reading frame 70 2 4
MIRT077079 KRT10 keratin 10 2 8
MIRT084604 BCL2L11 BCL2 like 11 2 8
MIRT088056 UBXN2A UBX domain protein 2A 2 4
MIRT103212 SP4 Sp4 transcription factor 2 6
MIRT108733 XIAP X-linked inhibitor of apoptosis 2 2
MIRT135263 TMBIM6 transmembrane BAX inhibitor motif containing 6 2 8
MIRT140170 SPRED1 sprouty related EVH1 domain containing 1 2 2
MIRT173042 YTHDF3 YTH N6-methyladenosine RNA binding protein 3 2 2
MIRT182530 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT184890 ULK1 unc-51 like autophagy activating kinase 1 2 2
MIRT187490 PCBP2 poly(rC) binding protein 2 2 4
MIRT188195 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 2
MIRT190442 EIF5 eukaryotic translation initiation factor 5 2 2
MIRT201089 ZNF805 zinc finger protein 805 2 2
MIRT213239 REST RE1 silencing transcription factor 2 2
MIRT213335 KIAA0232 KIAA0232 2 2
MIRT220130 CAV1 caveolin 1 2 2
MIRT257298 FOXC1 forkhead box C1 2 2
MIRT260352 XRCC6 X-ray repair cross complementing 6 2 6
MIRT262478 KLF6 Kruppel like factor 6 2 2
MIRT263459 SAMD8 sterile alpha motif domain containing 8 2 2
MIRT291952 TPM4 tropomyosin 4 2 2
MIRT295277 LZIC leucine zipper and CTNNBIP1 domain containing 2 4
MIRT300679 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT322414 PPP2R2A protein phosphatase 2 regulatory subunit Balpha 2 2
MIRT338103 CLIC4 chloride intracellular channel 4 2 4
MIRT361507 AP1S1 adaptor related protein complex 1 sigma 1 subunit 2 2
MIRT365827 ZBTB33 zinc finger and BTB domain containing 33 2 4
MIRT371746 ATXN1 ataxin 1 2 2
MIRT375470 NFAT5 nuclear factor of activated T-cells 5 2 6
MIRT387879 MKNK2 MAP kinase interacting serine/threonine kinase 2 2 6
MIRT395213 PRKCB protein kinase C beta 2 2
MIRT407418 IGFBP5 insulin like growth factor binding protein 5 2 2
MIRT442641 TBC1D12 TBC1 domain family member 12 2 2
MIRT442757 NRIP3 nuclear receptor interacting protein 3 2 2
MIRT443435 MAPT microtubule associated protein tau 2 2
MIRT443707 LLPH LLP homolog, long-term synaptic facilitation 2 2
MIRT444306 SREK1IP1 SREK1 interacting protein 1 2 2
MIRT447332 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 2 2
MIRT448310 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT448362 TSR1 TSR1, ribosome maturation factor 2 6
MIRT448388 TP53INP1 tumor protein p53 inducible nuclear protein 1 2 2
MIRT448640 NPNT nephronectin 2 2
MIRT450184 TMEM9B TMEM9 domain family member B 2 2
MIRT452303 EIF5AL1 eukaryotic translation initiation factor 5A-like 1 2 2
MIRT453732 RAP1GDS1 Rap1 GTPase-GDP dissociation stimulator 1 2 2
MIRT455237 KIAA2013 KIAA2013 2 2
MIRT456354 CITED2 Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 2 2 2
MIRT457591 NCOA3 nuclear receptor coactivator 3 2 2
MIRT458288 FUT10 fucosyltransferase 10 2 2
MIRT458694 MRI1 methylthioribose-1-phosphate isomerase 1 2 2
MIRT462073 CCDC77 coiled-coil domain containing 77 2 2
MIRT462122 AKR7A2 aldo-keto reductase family 7 member A2 2 2
MIRT463267 ZFYVE9 zinc finger FYVE-type containing 9 2 2
MIRT465103 TSC22D3 TSC22 domain family member 3 2 4
MIRT465108 TSC22D2 TSC22 domain family member 2 2 4
MIRT465228 TRIP10 thyroid hormone receptor interactor 10 2 2
MIRT465830 TMEM64 transmembrane protein 64 2 2
MIRT466450 TFAM transcription factor A, mitochondrial 2 8
MIRT467464 SNAPIN SNAP associated protein 2 2
MIRT467490 SMIM13 small integral membrane protein 13 2 6
MIRT467890 SLC22A23 solute carrier family 22 member 23 2 2
MIRT468846 RRM2 ribonucleotide reductase regulatory subunit M2 2 2
MIRT469699 RAB5B RAB5B, member RAS oncogene family 2 8
MIRT469853 PXK PX domain containing serine/threonine kinase like 2 8
MIRT470265 PRR14L proline rich 14 like 2 2
MIRT471136 PHF19 PHD finger protein 19 2 2
MIRT471265 PGM2L1 phosphoglucomutase 2 like 1 2 2
MIRT471917 NSUN4 NOP2/Sun RNA methyltransferase family member 4 2 2
MIRT472051 NPAT nuclear protein, coactivator of histone transcription 2 2
MIRT472161 NIN ninein 2 4
MIRT472339 NETO2 neuropilin and tolloid like 2 2 4
MIRT473262 MIDN midnolin 2 10
MIRT473326 MEX3A mex-3 RNA binding family member A 2 2
MIRT474868 KDM5B lysine demethylase 5B 2 2
MIRT475050 JOSD1 Josephin domain containing 1 2 2
MIRT475467 HSPA8 heat shock protein family A (Hsp70) member 8 2 6
MIRT475695 HHIPL1 HHIP like 1 2 2
MIRT476905 FBXL5 F-box and leucine rich repeat protein 5 2 12
MIRT477187 F3 coagulation factor III, tissue factor 2 8
MIRT477281 ERGIC2 ERGIC and golgi 2 2 2
MIRT478551 CTNND1 catenin delta 1 2 2
MIRT479035 COIL coilin 2 10
MIRT479059 CNOT6L CCR4-NOT transcription complex subunit 6 like 2 8
MIRT479263 CHSY1 chondroitin sulfate synthase 1 2 2
MIRT479801 CCND1 cyclin D1 2 12
MIRT479847 CCDC86 coiled-coil domain containing 86 2 2
MIRT480522 C11orf30 EMSY, BRCA2 interacting transcriptional repressor 2 10
MIRT480556 BZW1 basic leucine zipper and W2 domains 1 2 2
MIRT481340 ATL3 atlastin GTPase 3 2 2
MIRT481960 ANKH ANKH inorganic pyrophosphate transport regulator 2 8
MIRT482135 AKAP11 A-kinase anchoring protein 11 2 12
MIRT482474 ADAR adenosine deaminase, RNA specific 2 4
MIRT484824 ZNFX1 zinc finger NFX1-type containing 1 2 2
MIRT484911 ZFYVE26 zinc finger FYVE-type containing 26 2 4
MIRT485188 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 4
MIRT485366 MYLIP myosin regulatory light chain interacting protein 2 12
MIRT488821 TBC1D28 TBC1 domain family member 28 2 2
MIRT491802 ZFYVE21 zinc finger FYVE-type containing 21 2 8
MIRT492006 UGCG UDP-glucose ceramide glucosyltransferase 2 2
MIRT492365 SEMA7A semaphorin 7A (John Milton Hagen blood group) 2 2
MIRT493389 KIAA0513 KIAA0513 2 6
MIRT493667 HBP1 HMG-box transcription factor 1 2 2
MIRT494068 DUSP2 dual specificity phosphatase 2 2 4
MIRT494384 SOLH calpain 15 2 2
MIRT494426 BTG2 BTG anti-proliferation factor 2 2 4
MIRT494775 ANKRD33B ankyrin repeat domain 33B 2 10
MIRT498159 FEM1C fem-1 homolog C 2 8
MIRT499904 KIAA1191 KIAA1191 2 4
MIRT500763 TMEM127 transmembrane protein 127 2 6
MIRT501460 PTPN4 protein tyrosine phosphatase, non-receptor type 4 2 8
MIRT501955 MAPRE3 microtubule associated protein RP/EB family member 3 2 8
MIRT502367 GIGYF1 GRB10 interacting GYF protein 1 2 8
MIRT502400 GATA6 GATA binding protein 6 2 8
MIRT503444 GINS4 GINS complex subunit 4 2 4
MIRT503605 ZNF780A zinc finger protein 780A 2 2
MIRT503824 TMEM242 transmembrane protein 242 2 4
MIRT504095 C9orf40 chromosome 9 open reading frame 40 2 6
MIRT505278 TUBB2A tubulin beta 2A class IIa 2 2
MIRT505489 SRSF2 serine and arginine rich splicing factor 2 2 4
MIRT505740 SEPT2 septin 2 2 4
MIRT505976 RAB11FIP1 RAB11 family interacting protein 1 2 4
MIRT506228 PFKP phosphofructokinase, platelet 2 8
MIRT506431 NAGK N-acetylglucosamine kinase 2 6
MIRT506454 NACC2 NACC family member 2 2 4
MIRT506617 MARCH6 membrane associated ring-CH-type finger 6 2 8
MIRT506838 KIF23 kinesin family member 23 2 4
MIRT506865 KIAA1147 KIAA1147 2 2
MIRT507189 FZD9 frizzled class receptor 9 2 6
MIRT507235 FOXK2 forkhead box K2 2 4
MIRT507362 FAM129A family with sequence similarity 129 member A 2 6
MIRT507942 BTF3L4 basic transcription factor 3 like 4 2 6
MIRT508087 ANKRD52 ankyrin repeat domain 52 2 2
MIRT508134 AMD1 adenosylmethionine decarboxylase 1 2 2
MIRT511083 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 2 4
MIRT511257 KLHL36 kelch like family member 36 2 6
MIRT511610 HIST1H4H histone cluster 1 H4 family member h 2 2
MIRT511725 HIST1H2BF histone cluster 1 H2B family member f 2 2
MIRT512318 ACTR2 ARP2 actin related protein 2 homolog 2 6
MIRT513462 NARS asparaginyl-tRNA synthetase 2 6
MIRT513984 CEP97 centrosomal protein 97 2 2
MIRT513998 CENPQ centromere protein Q 2 4
MIRT514035 BNIP2 BCL2 interacting protein 2 2 2
MIRT514096 EPS15L1 epidermal growth factor receptor pathway substrate 15 like 1 2 6
MIRT514993 DNTTIP2 deoxynucleotidyltransferase terminal interacting protein 2 2 2
MIRT517016 COX19 COX19, cytochrome c oxidase assembly factor 2 2
MIRT524699 BTG3 BTG anti-proliferation factor 3 2 8
MIRT525199 ZNF93 zinc finger protein 93 2 2
MIRT527200 XIRP2 xin actin binding repeat containing 2 2 2
MIRT527469 CLEC12B C-type lectin domain family 12 member B 2 4
MIRT527888 SERF1B small EDRK-rich factor 1B 2 2
MIRT529344 SERF1A small EDRK-rich factor 1A 2 2
MIRT529493 TPD52L3 tumor protein D52 like 3 2 2
MIRT531821 ZNF264 zinc finger protein 264 2 6
MIRT531835 MTPAP mitochondrial poly(A) polymerase 2 4
MIRT532509 KCNN1 potassium calcium-activated channel subfamily N member 1 2 2
MIRT533390 U2SURP U2 snRNP associated SURP domain containing 2 6
MIRT533836 TGFBR2 transforming growth factor beta receptor 2 2 6
MIRT533876 TBL1XR1 transducin beta like 1 X-linked receptor 1 2 2
MIRT534005 SUV420H1 lysine methyltransferase 5B 2 2
MIRT534626 RNASEH1 ribonuclease H1 2 4
MIRT537731 ELAVL2 ELAV like RNA binding protein 2 2 2
MIRT537781 EIF4H eukaryotic translation initiation factor 4H 2 6
MIRT538716 CAPRIN2 caprin family member 2 2 4
MIRT541088 RLIM ring finger protein, LIM domain interacting 2 2
MIRT541284 GLO1 glyoxalase I 2 2
MIRT542058 SLC25A46 solute carrier family 25 member 46 2 2
MIRT542952 GDF11 growth differentiation factor 11 2 2
MIRT543506 PLS1 plastin 1 2 2
MIRT543578 RPF2 ribosome production factor 2 homolog 2 4
MIRT545201 HIST1H2BD histone cluster 1 H2B family member d 2 2
MIRT546254 TNFRSF21 TNF receptor superfamily member 21 2 2
MIRT546293 TMEM200C transmembrane protein 200C 2 4
MIRT546457 SLC5A3 solute carrier family 5 member 3 2 4
MIRT546494 SIK1 salt inducible kinase 1 2 2
MIRT546820 RAP2C RAP2C, member of RAS oncogene family 2 2
MIRT547080 PLRG1 pleiotropic regulator 1 2 2
MIRT548228 FJX1 four jointed box 1 2 4
MIRT548338 EPHA4 EPH receptor A4 2 2
MIRT548390 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 2 4
MIRT548463 EGLN3 egl-9 family hypoxia inducible factor 3 2 2
MIRT548862 CERCAM cerebral endothelial cell adhesion molecule 2 2
MIRT549821 LUZP2 leucine zipper protein 2 2 2
MIRT550092 TRAPPC2 trafficking protein particle complex 2 2 2
MIRT550241 PVR poliovirus receptor 2 4
MIRT551744 FMNL2 formin like 2 2 2
MIRT552203 F2RL3 F2R like thrombin or trypsin receptor 3 2 2
MIRT552639 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT552684 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 4
MIRT553031 USP48 ubiquitin specific peptidase 48 2 2
MIRT553474 TNKS2 tankyrase 2 2 2
MIRT554329 SH3GLB1 SH3 domain containing GRB2 like, endophilin B1 2 2
MIRT554411 SCD stearoyl-CoA desaturase 2 2
MIRT554474 SAMD12 sterile alpha motif domain containing 12 2 2
MIRT554529 RUFY2 RUN and FYVE domain containing 2 2 2
MIRT554554 RRN3 RRN3 homolog, RNA polymerase I transcription factor 2 2
MIRT554611 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT554744 RHOC ras homolog family member C 2 2
MIRT554802 RGMB repulsive guidance molecule family member b 2 4
MIRT555165 PTPDC1 protein tyrosine phosphatase domain containing 1 2 2
MIRT555192 PRUNE2 prune homolog 2 2 2
MIRT556143 MED17 mediator complex subunit 17 2 2
MIRT556591 LEPROT leptin receptor overlapping transcript 2 2
MIRT556903 ISOC1 isochorismatase domain containing 1 2 2
MIRT557756 FRS2 fibroblast growth factor receptor substrate 2 2 2
MIRT557828 FOXJ2 forkhead box J2 2 2
MIRT558220 EFCAB14 EF-hand calcium binding domain 14 2 4
MIRT558331 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 4
MIRT558934 CBX1 chromobox 1 2 2
MIRT559078 C19orf47 chromosome 19 open reading frame 47 2 4
MIRT559439 ARSJ arylsulfatase family member J 2 2
MIRT561376 TXNIP thioredoxin interacting protein 2 2
MIRT561644 RUNX3 runt related transcription factor 3 2 2
MIRT561741 PLAGL2 PLAG1 like zinc finger 2 2 2
MIRT562214 HMGB2 high mobility group box 2 2 2
MIRT562558 CCDC71L coiled-coil domain containing 71 like 2 4
MIRT562964 LRPAP1 LDL receptor related protein associated protein 1 2 2
MIRT563378 DSPP dentin sialophosphoprotein 2 2
MIRT566557 OTUD4 OTU deubiquitinase 4 2 2
MIRT566878 LRP12 LDL receptor related protein 12 2 2
MIRT567008 KLHL15 kelch like family member 15 2 2
MIRT567050 KCNB1 potassium voltage-gated channel subfamily B member 1 2 2
MIRT567112 ITGB1 integrin subunit beta 1 2 2
MIRT567542 FGFR1OP FGFR1 oncogene partner 2 2
MIRT567627 FAM210A family with sequence similarity 210 member A 2 2
MIRT567684 EIF4A2 eukaryotic translation initiation factor 4A2 2 2
MIRT567915 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT571014 CKAP2 cytoskeleton associated protein 2 2 2
MIRT571220 F2R coagulation factor II thrombin receptor 2 2
MIRT571678 RRAS2 RAS related 2 2 2
MIRT571693 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 2
MIRT571723 RPL17-C18orf32 RPL17-C18orf32 readthrough 2 2
MIRT571860 NKIRAS1 NFKB inhibitor interacting Ras like 1 2 2
MIRT572045 GPR137B G protein-coupled receptor 137B 2 2
MIRT572209 C18orf32 chromosome 18 open reading frame 32 2 2
MIRT573375 LIMA1 LIM domain and actin binding 1 2 2
MIRT573707 RBM12B RNA binding motif protein 12B 2 2
MIRT573915 SNAP47 synaptosome associated protein 47 2 2
MIRT574719 HAUS8 HAUS augmin like complex subunit 8 2 2
MIRT610998 BRI3BP BRI3 binding protein 2 2
MIRT615446 FAXC failed axon connections homolog 2 2
MIRT616437 FAM126B family with sequence similarity 126 member B 2 2
MIRT624424 CBX8 chromobox 8 2 2
MIRT625079 C15orf41 chromosome 15 open reading frame 41 2 2
MIRT628867 KCNE4 potassium voltage-gated channel subfamily E regulatory subunit 4 2 2
MIRT630570 SOWAHA sosondowah ankyrin repeat domain family member A 2 4
MIRT634454 PAK6 p21 (RAC1) activated kinase 6 2 2
MIRT640010 OSTM1 osteopetrosis associated transmembrane protein 1 2 2
MIRT641800 USP32 ubiquitin specific peptidase 32 2 2
MIRT663408 SYT17 synaptotagmin 17 2 2
MIRT664793 LIAS lipoic acid synthetase 2 4
MIRT672157 PLEKHH1 pleckstrin homology, MyTH4 and FERM domain containing H1 2 2
MIRT679620 RRP36 ribosomal RNA processing 36 2 2
MIRT682524 GJD3 gap junction protein delta 3 2 2
MIRT684063 FOLR1 folate receptor 1 2 2
MIRT688711 CPS1 carbamoyl-phosphate synthase 1 2 2
MIRT691249 DFNB59 pejvakin 2 2
MIRT693152 THEM4 thioesterase superfamily member 4 2 2
MIRT693198 MKI67 marker of proliferation Ki-67 2 2
MIRT700440 PURB purine rich element binding protein B 2 2
MIRT701591 MYPN myopalladin 2 2
MIRT701966 MINK1 misshapen like kinase 1 2 2
MIRT702051 METTL21A methyltransferase like 21A 2 2
MIRT702588 JARID2 jumonji and AT-rich interaction domain containing 2 2 2
MIRT722312 DHCR24 24-dehydrocholesterol reductase 2 2
MIRT725222 PEA15 phosphoprotein enriched in astrocytes 15 2 2
MIRT755772 RAD51 RAD51 recombinase 5 1
MIRT755773 XRCC3 X-ray repair cross complementing 3 5 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4796-3p 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4796-3p Erlotinib 176870 NSC718781 approved sensitive High Non-Small Cell Lung Cancer tissue
hsa-miR-4796-3p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer tissue
hsa-miR-4796-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-4796-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-4796-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-4796-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (MGC-803)
hsa-miR-4796-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)

Error report submission