miRTarBase - #MIRT142423


—
pre-miRNA Information
pre-miRNA hsa-mir-518a-1   
Genomic Coordinates chr19: 53731006 - 53731090
Synonyms MIRN518A-1, MIRN518A1, MIR518A1
Description Homo sapiens miR-518a-1 stem-loop
Comment The 5' mature product was previously named miR-527 in has a 1 nt 3' extension (A), which is incompatible with the genome sequence.
RNA Secondary Structure
Associated Diseases
pre-miRNA hsa-mir-518a-2   
Genomic Coordinates chr19: 53739333 - 53739419
Synonyms MIRN518A-2, MIRN518A2, MIR518A2
Description Homo sapiens miR-518a-2 stem-loop
Comment The 5' mature product was previously named miR-527 in has a 1 nt 3' extension (A), which is incompatible with the genome sequence.
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-518a-5p
Sequence 14| CUGCAAAGGGAAGCCCUUUC |33
Evidence Experimental
Experiments Array-cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs779337342 1 dbSNP
rs1220923096 2 dbSNP
rs748541083 3 dbSNP
rs1419564974 4 dbSNP
rs954777846 6 dbSNP
rs749384027 7 dbSNP
rs1466927206 9 dbSNP
rs1331417194 10 dbSNP
rs919574209 10 dbSNP
rs374228640 11 dbSNP
rs1442070388 13 dbSNP
rs759533489 16 dbSNP
rs1315177101 19 dbSNP
rs765231725 20 dbSNP
rs373104095 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TNRC6A   
Synonyms CAGH26, GW1, GW182, TNRC6
Description trinucleotide repeat containing 6A
Transcript NM_014494   
Expression
Putative miRNA Targets on TNRC6A
3'UTR of TNRC6A
(miRNA target sites are highlighted)		 
>TNRC6A|NM_014494|3'UTR
   1 CAGTGTAGATGCAGACTCACCGACCGGGACCTCAGACGCGAGGGAAAGGAGCACTAAGTGGGGCTCGCCGCCTGCAGCCA
  81 GGGGCCGCCTGTGGGAACAGCTATTCTCTGCACATTTTCCACTTTGTTTTCCCCAAAACATATCAGTTTGAATACTTGAA
 161 TCATGCAGGCCAATATTATAATGTGAAAAGGTATCTACTCTATTTACACTCCCAAATAGCGCCATACATGCTAAACCGTA
 241 GAGAATGAGCTCGCTTGTGTCTATTCATCATGTTTAGCCTTTGGATTCTTTTTTTTTTTTTCCTTCTATTCCTCCCCAAC
 321 CCCCCCCCCCGCCCCTTTTTTTCTCTCTTGCAAAACCATTTTTTGGGCTGATAACGTATGAGCTTTTCCCTTTGCACTGA
 401 ATGATGTTCTCTCCGTCTCATCGGCAGTATGGGGGGCAGCTGTCCCAGTGTCAATGTTTACTCAAGGGTGTTCTTAGGAG
 481 GCGTGCGCTCTCTACTATGCCTTGATGTTGCCTACCTTATTGTGGTATCGTGGAGTTTAAAAGATCAAGTTAGGATGCTG
 561 ACTTAGGATTATTAATGAAAGTGTTGCACCAGTTTTTTCATGTTGTAAAACTAAAGAATTTCGCTCTGCAGTTTGAAAAA
 641 CTGTGGCCACAGCTGTGACTTGCAGCCCACCTGCCACCCAGGACGGGCCCTGCACTTTGAATAGGCTTTCCATTTTGTTT
 721 TGGAGGTTCTCACTTTGAACCTTCTTGTTTACAGATTTTTTTGTTTGTTTTTTGAGAAAAAAAAATGTTTACTCTTCCAT
 801 CATTTAAAAAAAATGTAAAAGACAAAAAAAAAATGGAGGATGATTTAAAAGATGCTTTCTATCTCTGGGAAAAAGGAGCA
 881 GCATTTGGCCATGTTCTTTTGTTTTTCTATTCCTGTCCCAAATCAAAGAGCATGGTTCTCAGGAAAACCAGTTCCCCAGT
 961 TTAAAAAAAAAAAAAAAAATTCCTTGTAGTTTCTTAGAGGAAAAAAAGAAAAACCCCAACTTTTAGCACTGATACTACAT
1041 ATTGCTCTGTTAAAGAATTTTCTCTGCCAAAAAAAAAGAAAAAACAAAAAAACGCTTAAAGCTGGAGTTTGACATTCTGC
1121 TTTCAGATGCTGTCTTTTTATTAGTGAGTGATGATGGTTTGCTAATAATCAATAGGTAATAATTTTTTGTAATCCCATCA
1201 AGTGGCTCCATATGTTTCTGCTCTCTCGTGACTGTGTTAATGTTTAACTGTTGTACCTTAAAGCCGAAATCAGTAACTAT
1281 GCATACTGTAACCAAGGTATTGGGCTTACAGAGTTGTTTGTTGTATAAAGAAAATTTTAAATGTTGTTGCAAACTAACGA
1361 GTTACACCATTTTAAACTTTCTTTCCTCCCCCCTTTTTTTGCCCACAAATGGTATTATAATGCTTGCTTAGTCAAAGAAG
1441 AGAGACTAAACAAGGGTAAAAATTTTAACAGTACAGAATTTGCCATCATATCATTGCCTTGATTCTAACTGTTTGTGTCC
1521 TAAGATGCAAAAGAAGTCAGTGGCTTTTAACTGTTTACAAATAGAATGTGATTGTAAAATGTACAGTTTGGTTGTGTTTG
1601 AATTATGAAATTTCTTCAGATATAATAAACCATGACTTTTTGGCTGCTCAACATTAATTGTCTCCTTTTTGTGAATTTAT
1681 TTGTAGGCTCTTTTTTATAATGAAAGTTTCAAAGTTGCTATGTATGAGGGTTCTCATAGAGCAACCGATTAAAAATCTAA
1761 GCAAATATTTGAACATTTTATCTGAACTCATCACAATTTCACCCTGAAATAATGTGAGAACAATGGGAAACTGTAGCTTG
1841 CTCCTTCCCACCCTCTCTGAGCATCTTTGGGATCTTGTTGCTCAAAACTCTTCTGTGACTTCATCTTCCCCACCATTTGT
1921 GCCCATCTCAAGCCTCAGCAAGAAACCATGTGGAACATGAAGCTTAATGACTTGACAGTGTACTAGTGTTAAACTCTCAT
2001 ACCTCTGTTACAAAGCGAGAAACGCCACACCCGGACTGGCCTTTTCTTCCCCCTTCACGGCCCTCGCTTCTCCCTGCAGG
2081 AGCTCGGGGGCGAAACCTGTGTATGGATTTCAGTGTATGACTTCAGATCATGCTCCAACTTGCCAGGTGTGAGCTAATGT
2161 TGTCGGACACCTTACTATAAGCAAATGTTATTCAGTGCGTTCAATGTATATTGACTTCCATACTGGTTTTTCCAAAAACC
2241 AAAGGTAGCTTTGAAAAACCATGTCTGGAAATGTTTGGAGCGTTAAGCTGATTGACCTTCTGACCTTGGGGCTTTGAGTA
2321 GTATATAATTCATAACTGCGTTAATTGTATTGTTAAAGTGTTTGGGAGTTTTTTGCGCTTGTTATGTGGAAATAAAGTGT
2401 TTGATTTAAAATTTTTTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cuUUCCCGAAGGGAAACGUc 5'
            :||  :||||||||||| 
Target 5' atGAGCTTTTCCCTTTGCAc 3'
 378 - 397 166.00 -16.70
2 
miRNA  3' cuUUCCCGAAGGGAAACGUc 5'
            |||  :||| || |||| 
Target 5' taAAGAATTTCGCTCTGCAg 3'
 612 - 631 130.00 -14.10
3 
miRNA  3' cuUUCCCGAAGGGAAACGUc 5'
            ||  ||| ::|| |||| 
Target 5' ggAACAGCTATTCTCTGCAc 3'
 94 - 113 126.00 -8.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30133739 3 COSMIC
COSN26640182 23 COSMIC
COSN30104763 28 COSMIC
COSN30505010 36 COSMIC
COSN13661912 39 COSMIC
COSN26644775 41 COSMIC
COSN31554333 65 COSMIC
COSN30503522 79 COSMIC
COSN32052917 85 COSMIC
COSN13661913 87 COSMIC
COSN26999352 88 COSMIC
COSN31595426 90 COSMIC
COSN16357193 101 COSMIC
COSN28841103 135 COSMIC
COSN31609355 253 COSMIC
COSN20112785 302 COSMIC
COSN28764158 314 COSMIC
COSN28741179 319 COSMIC
COSN28201856 320 COSMIC
COSN32062117 331 COSMIC
COSN31489885 400 COSMIC
COSN30264726 455 COSMIC
COSN18723483 483 COSMIC
COSN31568063 539 COSMIC
COSN30164829 636 COSMIC
COSN31531085 656 COSMIC
COSN31514805 674 COSMIC
COSN29467725 686 COSMIC
COSN31544911 742 COSMIC
COSN4764850 759 COSMIC
COSN26641120 764 COSMIC
COSN29520813 786 COSMIC
COSN20112786 834 COSMIC
COSN29087179 834 COSMIC
COSN20112788 980 COSMIC
COSN21217512 1127 COSMIC
COSN31584939 1267 COSMIC
COSN31578808 1315 COSMIC
COSN4764851 1338 COSMIC
COSN31538589 1345 COSMIC
COSN28707833 1393 COSMIC
COSN29862008 1401 COSMIC
COSN15843887 1469 COSMIC
COSN30158089 1525 COSMIC
COSN31485454 1610 COSMIC
COSN9644646 1716 COSMIC
COSN31480798 1860 COSMIC
COSN8600964 2004 COSMIC
COSN26249795 2068 COSMIC
COSN31482383 2100 COSMIC
COSN30543619 2106 COSMIC
COSN31520214 2199 COSMIC
COSN31544906 2241 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs779177144 3 dbSNP
rs369775152 10 dbSNP
rs745470864 14 dbSNP
rs1270162234 15 dbSNP
rs1023970521 19 dbSNP
rs769330280 19 dbSNP
rs1332568239 20 dbSNP
rs374024750 21 dbSNP
rs16974119 22 dbSNP
rs980334569 23 dbSNP
rs746587478 26 dbSNP
rs201911975 27 dbSNP
rs1249311568 29 dbSNP
rs1456919705 37 dbSNP
rs1472753107 38 dbSNP
rs776682705 39 dbSNP
rs761484749 40 dbSNP
rs2303083 41 dbSNP
rs772893765 53 dbSNP
rs1262410290 54 dbSNP
rs1194061681 55 dbSNP
rs1448523272 57 dbSNP
rs1264052557 58 dbSNP
rs1355723935 60 dbSNP
rs908259934 60 dbSNP
rs1273937127 63 dbSNP
rs755389115 67 dbSNP
rs1178746567 68 dbSNP
rs1400927151 70 dbSNP
rs939862013 71 dbSNP
rs1385910230 79 dbSNP
rs1051658542 87 dbSNP
rs889777251 88 dbSNP
rs1463630403 91 dbSNP
rs919879189 92 dbSNP
rs942733243 104 dbSNP
rs1476262573 124 dbSNP
rs575497066 132 dbSNP
rs894481097 137 dbSNP
rs544392597 144 dbSNP
rs1172596956 145 dbSNP
rs1253892723 174 dbSNP
rs1014650402 183 dbSNP
rs904469402 190 dbSNP
rs1456507383 193 dbSNP
rs1257917848 194 dbSNP
rs531083358 198 dbSNP
rs1031494838 199 dbSNP
rs1273489577 205 dbSNP
rs1233010164 210 dbSNP
rs1371220917 214 dbSNP
rs1327503262 215 dbSNP
rs1373273486 221 dbSNP
rs1446212425 238 dbSNP
rs564258009 239 dbSNP
rs1399770712 248 dbSNP
rs1171732037 253 dbSNP
rs533190289 254 dbSNP
rs1395850221 256 dbSNP
rs1195751774 258 dbSNP
rs1437896123 261 dbSNP
rs1013986683 262 dbSNP
rs1033139033 268 dbSNP
rs1440009295 271 dbSNP
rs1277152639 286 dbSNP
rs1200166898 288 dbSNP
rs11335420 289 dbSNP
rs1237593304 289 dbSNP
rs1349064112 289 dbSNP
rs1375477054 290 dbSNP
rs1186400777 300 dbSNP
rs893270640 300 dbSNP
rs865915359 302 dbSNP
rs1357319424 303 dbSNP
rs1396688562 303 dbSNP
rs1374591517 304 dbSNP
rs1391307471 307 dbSNP
rs1307776778 308 dbSNP
rs1350104018 309 dbSNP
rs1056420243 311 dbSNP
rs1235153044 312 dbSNP
rs1279817104 313 dbSNP
rs1177809167 314 dbSNP
rs892440438 314 dbSNP
rs1346003910 316 dbSNP
rs200245697 318 dbSNP
rs1010087111 319 dbSNP
rs1402582098 319 dbSNP
rs1284561404 320 dbSNP
rs867798764 320 dbSNP
rs879222639 320 dbSNP
rs66925397 321 dbSNP
rs1206269601 322 dbSNP
rs878994148 322 dbSNP
rs1163153307 323 dbSNP
rs1260258273 323 dbSNP
rs1191907780 324 dbSNP
rs1251671369 324 dbSNP
rs1480222810 325 dbSNP
rs1175393120 326 dbSNP
rs1276230290 327 dbSNP
rs1288580366 327 dbSNP
rs1362463970 328 dbSNP
rs1433203814 329 dbSNP
rs1325246613 330 dbSNP
rs1462061800 330 dbSNP
rs1169181841 331 dbSNP
rs55802473 331 dbSNP
rs112183094 332 dbSNP
rs1192489844 336 dbSNP
rs1392815798 337 dbSNP
rs1411293353 338 dbSNP
rs1043624 346 dbSNP
rs1487331040 346 dbSNP
rs1043625 348 dbSNP
rs1024503036 358 dbSNP
rs1469426321 365 dbSNP
rs1170779300 366 dbSNP
rs1218008638 369 dbSNP
rs1307828716 373 dbSNP
rs1297516608 374 dbSNP
rs1355453287 374 dbSNP
rs760479079 376 dbSNP
rs1461831405 377 dbSNP
rs878866995 381 dbSNP
rs1001217039 395 dbSNP
rs1017156606 397 dbSNP
rs1302957628 403 dbSNP
rs1441655141 408 dbSNP
rs1373854047 415 dbSNP
rs546715936 416 dbSNP
rs973430665 420 dbSNP
rs918762935 421 dbSNP
rs779105071 424 dbSNP
rs576408519 431 dbSNP
rs1355459542 432 dbSNP
rs1302768802 436 dbSNP
rs1431804843 438 dbSNP
rs748894948 443 dbSNP
rs955755328 444 dbSNP
rs986891322 446 dbSNP
rs1394035647 450 dbSNP
rs1193935849 454 dbSNP
rs911319646 455 dbSNP
rs1216538980 461 dbSNP
rs942681028 471 dbSNP
rs150174727 472 dbSNP
rs1043710560 475 dbSNP
rs560234888 482 dbSNP
rs748479348 483 dbSNP
rs986856173 484 dbSNP
rs925320403 486 dbSNP
rs935916126 487 dbSNP
rs1306676095 488 dbSNP
rs1202224529 490 dbSNP
rs768415036 491 dbSNP
rs961113049 493 dbSNP
rs1274921731 495 dbSNP
rs1053470297 501 dbSNP
rs1300428240 505 dbSNP
rs973937835 515 dbSNP
rs1375291052 516 dbSNP
rs1173839740 522 dbSNP
rs891612633 528 dbSNP
rs1212451751 530 dbSNP
rs1378122104 531 dbSNP
rs774123661 532 dbSNP
rs1419159061 545 dbSNP
rs1250582823 546 dbSNP
rs1252509111 550 dbSNP
rs1180107051 554 dbSNP
rs919767756 561 dbSNP
rs1280835270 562 dbSNP
rs1045459530 572 dbSNP
rs1350267630 576 dbSNP
rs905612639 577 dbSNP
rs1001166125 579 dbSNP
rs1238343129 587 dbSNP
rs1476136599 592 dbSNP
rs1016604529 593 dbSNP
rs1186712229 596 dbSNP
rs962411048 600 dbSNP
rs1309777551 601 dbSNP
rs990772995 602 dbSNP
rs1355198123 603 dbSNP
rs1313814681 624 dbSNP
rs994414411 625 dbSNP
rs1417043104 627 dbSNP
rs1358160109 642 dbSNP
rs1418388093 650 dbSNP
rs1453838739 671 dbSNP
rs917798146 685 dbSNP
rs1428236724 686 dbSNP
rs1168997978 688 dbSNP
rs528845451 690 dbSNP
rs1474869754 694 dbSNP
rs548967496 699 dbSNP
rs950109451 702 dbSNP
rs772615375 713 dbSNP
rs1487190785 718 dbSNP
rs1397236345 728 dbSNP
rs1045691501 730 dbSNP
rs1204839267 737 dbSNP
rs1462418602 738 dbSNP
rs1351449665 742 dbSNP
rs1325899374 748 dbSNP
rs10055 749 dbSNP
rs1242727201 756 dbSNP
rs1348185379 760 dbSNP
rs138636233 775 dbSNP
rs1054429219 777 dbSNP
rs1235463688 777 dbSNP
rs1294450392 777 dbSNP
rs1382476630 777 dbSNP
rs934753446 777 dbSNP
rs955539099 778 dbSNP
rs893323279 790 dbSNP
rs1270953756 803 dbSNP
rs1476713169 806 dbSNP
rs997395454 806 dbSNP
rs1372326954 808 dbSNP
rs1278892086 816 dbSNP
rs193262905 817 dbSNP
rs1294908218 822 dbSNP
rs1447748229 824 dbSNP
rs1468102165 824 dbSNP
rs35671423 824 dbSNP
rs397829930 824 dbSNP
rs879188852 824 dbSNP
rs1335300558 825 dbSNP
rs1274340571 826 dbSNP
rs1216171426 837 dbSNP
rs1337822459 841 dbSNP
rs1228645980 855 dbSNP
rs911268276 856 dbSNP
rs1439451872 861 dbSNP
rs185042220 862 dbSNP
rs1394663434 865 dbSNP
rs1327798740 868 dbSNP
rs1287689755 874 dbSNP
rs1464042197 875 dbSNP
rs891351489 892 dbSNP
rs551689737 900 dbSNP
rs1168241207 904 dbSNP
rs1448181302 914 dbSNP
rs1374943373 926 dbSNP
rs1192052129 932 dbSNP
rs964105251 934 dbSNP
rs1215907557 958 dbSNP
rs1241098031 959 dbSNP
rs1253750783 960 dbSNP
rs116438855 963 dbSNP
rs1233158764 963 dbSNP
rs1304927273 963 dbSNP
rs1371061099 963 dbSNP
rs35913858 963 dbSNP
rs397855166 963 dbSNP
rs72532675 963 dbSNP
rs869109492 963 dbSNP
rs1443973774 964 dbSNP
rs1484689270 966 dbSNP
rs1335026341 978 dbSNP
rs1189706489 980 dbSNP
rs1411435639 981 dbSNP
rs1399884866 985 dbSNP
rs1007431921 994 dbSNP
rs571483770 998 dbSNP
rs1434391880 1001 dbSNP
rs1395946878 1009 dbSNP
rs36060292 1009 dbSNP
rs1195537307 1020 dbSNP
rs1468673016 1024 dbSNP
rs1232754449 1028 dbSNP
rs1420460636 1033 dbSNP
rs979524988 1035 dbSNP
rs773704200 1052 dbSNP
rs1015259110 1068 dbSNP
rs1348102276 1069 dbSNP
rs201286178 1069 dbSNP
rs960999801 1069 dbSNP
rs925267973 1070 dbSNP
rs935357786 1076 dbSNP
rs1349402290 1078 dbSNP
rs3088119 1079 dbSNP
rs1280061563 1081 dbSNP
rs1053012958 1082 dbSNP
rs1353308819 1086 dbSNP
rs80182361 1087 dbSNP
rs949325592 1094 dbSNP
rs949873439 1095 dbSNP
rs553837294 1097 dbSNP
rs1399015013 1113 dbSNP
rs1407396849 1118 dbSNP
rs1159627021 1121 dbSNP
rs934638250 1122 dbSNP
rs905730506 1127 dbSNP
rs1187594811 1129 dbSNP
rs1054481936 1130 dbSNP
rs1486210117 1130 dbSNP
rs893197533 1135 dbSNP
rs1001284153 1141 dbSNP
rs770506862 1143 dbSNP
rs1398381340 1144 dbSNP
rs539021916 1145 dbSNP
rs1355820914 1149 dbSNP
rs1050344747 1157 dbSNP
rs1037812917 1163 dbSNP
rs898153033 1166 dbSNP
rs1413973224 1167 dbSNP
rs1282307294 1168 dbSNP
rs1292606364 1173 dbSNP
rs1352763474 1177 dbSNP
rs1357201992 1180 dbSNP
rs1304809600 1181 dbSNP
rs1428941427 1190 dbSNP
rs868060435 1192 dbSNP
rs1008493554 1193 dbSNP
rs760639252 1200 dbSNP
rs1458888549 1208 dbSNP
rs1025872658 1209 dbSNP
rs1164901670 1215 dbSNP
rs1475736868 1224 dbSNP
rs189025884 1228 dbSNP
rs1008362925 1229 dbSNP
rs1474849791 1241 dbSNP
rs1212555989 1242 dbSNP
rs1018393872 1258 dbSNP
rs964203326 1265 dbSNP
rs1257839390 1266 dbSNP
rs995144566 1267 dbSNP
rs1486182883 1272 dbSNP
rs1187710977 1276 dbSNP
rs979473104 1284 dbSNP
rs1293113046 1294 dbSNP
rs765241966 1294 dbSNP
rs191600386 1298 dbSNP
rs1361449008 1299 dbSNP
rs988548091 1320 dbSNP
rs1271002663 1324 dbSNP
rs868193337 1326 dbSNP
rs1026764020 1342 dbSNP
rs79620110 1344 dbSNP
rs77976341 1345 dbSNP
rs76813619 1346 dbSNP
rs1417980432 1350 dbSNP
rs959365363 1359 dbSNP
rs949999100 1360 dbSNP
rs1168730341 1364 dbSNP
rs1175716637 1365 dbSNP
rs981397617 1370 dbSNP
rs927095140 1380 dbSNP
rs1413875062 1386 dbSNP
rs1452031872 1387 dbSNP
rs1251884340 1388 dbSNP
rs1331951228 1388 dbSNP
rs937188457 1388 dbSNP
rs1025222558 1389 dbSNP
rs1469729596 1390 dbSNP
rs1038099680 1393 dbSNP
rs1273940023 1394 dbSNP
rs1307915253 1394 dbSNP
rs35836582 1394 dbSNP
rs970546130 1395 dbSNP
rs1278940799 1401 dbSNP
rs1368857721 1402 dbSNP
rs1302689379 1407 dbSNP
rs977996672 1408 dbSNP
rs1373975437 1413 dbSNP
rs1235901186 1418 dbSNP
rs898257964 1419 dbSNP
rs1355517260 1428 dbSNP
rs1346721124 1445 dbSNP
rs1432423160 1449 dbSNP
rs923830155 1456 dbSNP
rs576394480 1462 dbSNP
rs956068707 1470 dbSNP
rs1200171330 1472 dbSNP
rs929619405 1474 dbSNP
rs1480834616 1476 dbSNP
rs1234453386 1477 dbSNP
rs184118898 1479 dbSNP
rs1208482486 1481 dbSNP
rs1345910110 1486 dbSNP
rs1279916649 1489 dbSNP
rs1439978852 1490 dbSNP
rs1314067826 1493 dbSNP
rs1305447370 1498 dbSNP
rs551106658 1505 dbSNP
rs745330343 1505 dbSNP
rs990088164 1506 dbSNP
rs914699235 1511 dbSNP
rs1413360103 1516 dbSNP
rs1374426911 1528 dbSNP
rs188128492 1529 dbSNP
rs1467105435 1531 dbSNP
rs890831582 1538 dbSNP
rs1361631637 1541 dbSNP
rs752758385 1545 dbSNP
rs1158272973 1554 dbSNP
rs1195591684 1556 dbSNP
rs1395846010 1566 dbSNP
rs369706946 1567 dbSNP
rs1018509781 1570 dbSNP
rs1185479729 1575 dbSNP
rs577904467 1577 dbSNP
rs1257046007 1580 dbSNP
rs1171094173 1581 dbSNP
rs1001006648 1582 dbSNP
rs1484272608 1586 dbSNP
rs1259094537 1591 dbSNP
rs1238432731 1592 dbSNP
rs1254576901 1595 dbSNP
rs1318009435 1595 dbSNP
rs1398333611 1597 dbSNP
rs763086256 1600 dbSNP
rs912726818 1601 dbSNP
rs1313109035 1602 dbSNP
rs540438858 1624 dbSNP
rs1328057259 1627 dbSNP
rs1287711695 1628 dbSNP
rs1037302188 1630 dbSNP
rs988275384 1633 dbSNP
rs1162764718 1639 dbSNP
rs867034602 1640 dbSNP
rs995195575 1647 dbSNP
rs1418387312 1650 dbSNP
rs1025392096 1652 dbSNP
rs1048533370 1653 dbSNP
rs1303510028 1665 dbSNP
rs1259956439 1674 dbSNP
rs1425718331 1674 dbSNP
rs1204585074 1676 dbSNP
rs764190009 1701 dbSNP
rs1270544261 1703 dbSNP
rs894929421 1707 dbSNP
rs559946325 1713 dbSNP
rs181078542 1738 dbSNP
rs186087349 1745 dbSNP
rs927210752 1746 dbSNP
rs999302180 1747 dbSNP
rs190211962 1748 dbSNP
rs957943606 1755 dbSNP
rs1366786657 1761 dbSNP
rs937134435 1766 dbSNP
rs531231431 1772 dbSNP
rs767953715 1779 dbSNP
rs973905177 1780 dbSNP
rs919653203 1783 dbSNP
rs1164742472 1787 dbSNP
rs954032781 1795 dbSNP
rs551653455 1797 dbSNP
rs929708337 1802 dbSNP
rs1450165106 1804 dbSNP
rs1250045572 1808 dbSNP
rs1257912741 1813 dbSNP
rs141990413 1824 dbSNP
rs1046833720 1829 dbSNP
rs985968369 1831 dbSNP
rs912200437 1832 dbSNP
rs534084985 1837 dbSNP
rs943719294 1854 dbSNP
rs1211953285 1856 dbSNP
rs912621448 1877 dbSNP
rs1250379287 1886 dbSNP
rs1228768420 1889 dbSNP
rs547586241 1892 dbSNP
rs1300550772 1908 dbSNP
rs1439522197 1910 dbSNP
rs1253689036 1933 dbSNP
rs1432721363 1937 dbSNP
rs944218049 1939 dbSNP
rs1389433601 1946 dbSNP
rs1395594813 1947 dbSNP
rs900094758 1964 dbSNP
rs1454602530 1970 dbSNP
rs778941746 1971 dbSNP
rs1430583523 1979 dbSNP
rs1054352714 1980 dbSNP
rs1171802186 1983 dbSNP
rs1453894137 1995 dbSNP
rs918883359 1997 dbSNP
rs1201695252 2004 dbSNP
rs74015711 2013 dbSNP
rs1010049554 2017 dbSNP
rs879110567 2018 dbSNP
rs1277780139 2024 dbSNP
rs1326565656 2025 dbSNP
rs756705994 2025 dbSNP
rs1276545028 2030 dbSNP
rs1002226022 2033 dbSNP
rs1034228659 2034 dbSNP
rs1411464524 2042 dbSNP
rs1372588567 2044 dbSNP
rs1311344241 2045 dbSNP
rs1319826413 2049 dbSNP
rs1046598573 2052 dbSNP
rs1174812412 2058 dbSNP
rs1469000729 2059 dbSNP
rs958620645 2060 dbSNP
rs1363729406 2062 dbSNP
rs1183293171 2066 dbSNP
rs1326671550 2067 dbSNP
rs906271272 2073 dbSNP
rs1280057997 2079 dbSNP
rs999354569 2082 dbSNP
rs1030783889 2087 dbSNP
rs536766085 2092 dbSNP
rs1011241283 2093 dbSNP
rs1353371676 2099 dbSNP
rs1291662241 2100 dbSNP
rs919753426 2102 dbSNP
rs951273652 2106 dbSNP
rs1028888050 2117 dbSNP
rs954198787 2125 dbSNP
rs556411473 2131 dbSNP
rs576382001 2132 dbSNP
rs201860970 2139 dbSNP
rs1416224219 2142 dbSNP
rs1187698419 2150 dbSNP
rs1208159015 2158 dbSNP
rs1472885192 2158 dbSNP
rs912332484 2165 dbSNP
rs557866811 2166 dbSNP
rs1020141264 2167 dbSNP
rs943668363 2170 dbSNP
rs1445964771 2176 dbSNP
rs748807150 2178 dbSNP
rs1210585543 2189 dbSNP
rs539078650 2199 dbSNP
rs1272246284 2200 dbSNP
rs763085702 2202 dbSNP
rs146301282 2205 dbSNP
rs868243154 2207 dbSNP
rs1054065308 2218 dbSNP
rs1476094545 2218 dbSNP
rs892616522 2225 dbSNP
rs1165511560 2232 dbSNP
rs867028679 2236 dbSNP
rs1009753061 2240 dbSNP
rs1459234854 2245 dbSNP
rs1046897220 2259 dbSNP
rs578002884 2263 dbSNP
rs1164470514 2274 dbSNP
rs540403665 2281 dbSNP
rs1002171897 2283 dbSNP
rs553951215 2284 dbSNP
rs1474792352 2309 dbSNP
rs1455882908 2317 dbSNP
rs182444420 2326 dbSNP
rs1467028526 2328 dbSNP
rs576336798 2333 dbSNP
rs916823819 2334 dbSNP
rs947733138 2337 dbSNP
rs778408080 2340 dbSNP
rs747858867 2341 dbSNP
rs771725778 2350 dbSNP
rs772996631 2355 dbSNP
rs770332920 2359 dbSNP
rs906325421 2360 dbSNP
rs542683022 2363 dbSNP
rs1437409643 2364 dbSNP
rs1338855621 2366 dbSNP
rs1293510254 2367 dbSNP
rs1052093331 2369 dbSNP
rs951265383 2372 dbSNP
rs562488289 2377 dbSNP
rs1294396439 2378 dbSNP
rs531196991 2386 dbSNP
rs1010712481 2387 dbSNP
rs1029354482 2398 dbSNP
rs1242618088 2409 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cuuucccGAAGGGAAACGUc 5'
                 :||||||||||| 
Target 5' -----cuUUUCCCUUUGCAc 3'
 		1 - 15
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions C8166 , TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3 PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset GSM4903825
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / PID14_NS
Location of target site NM_014494 | 3UTR | AUGAGCUUUUCCCUUUGCACUGAAUGAUGUUCUCUCCGUCUCAUCGGCAGUAUGGGGGGCAGCUGUCCCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161237
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_014494 | 3UTR | CUUGCAAAACCAUUUUUUGGGCUGAUAACGUAUGAGCUUUUCCCUUUGCACUGAAUGAUGUUCUCUCCGUCUCAUCGGCAGUAUGGGGGGCAGCUGUCCCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4903834
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_b
Location of target site NM_014494 | 3UTR | CUUGCAAAACCAUUUUUUGGGCUGAUAACGUAUGAGCUUUUCCCUUUGCACUGAAUGAUGUUCUCUCCGUCUCAUCGGCAGUAUGGGGGGCAGCUGUCCCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM4903835
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_c
Location of target site NM_014494 | 3UTR | UCUCUUGCAAAACCAUUUUUUGGGCUGAUAACGUAUGAGCUUUUCCCUUUGCACUGAAUGAUGUUCUCUCCGUCUCAUCGGCAGUAUGGGGGGCAGCUGUCCCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM4903836
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_a
Location of target site NM_014494 | 3UTR | CUCUCUUGCAAAACCAUUUUUUGGGCUGAUAACGUAUGAGCUUUUCCCUUUGCACUGAAUGAUGUUCUCUCCGUCUCAUCGGCAGUAUGGGGGGCAGCUGUCCCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM4903837
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_b
Location of target site NM_014494 | 3UTR | UCUCUUGCAAAACCAUUUUUUGGGCUGAUAACGUAUGAGCUUUUCCCUUUGCACUGAAUGAUGUUCUCUCCGUCUCAUCGGCAGUAUGGGGGGCAGCUGUCCCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM4903838
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_c
Location of target site NM_014494 | 3UTR | AAACCAUUUUUUGGGCUGAUAACGUAUGAGCUUUUCCCUUUGCACUGAAUGAUGUUCUCUCCGUCUCAUCGGCAGUAUGGGGGGCAGCUGUCCCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000395799.3 | 3UTR | CUUUUCCCUUUGCACUGAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000395799.3 | 3UTR | CUUUUCCCUUUGCACUGAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset GSM1462572
Method / RBP PAR-CLIP / AGO2
Cell line / Condition C8166 / C8166 NL4-3
Location of target site ENST00000395799.3 | 3UTR | CUUUUCCCUUUGCACUGAAUGAUGUUCUCUCCG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
CLIP-seq Support 11 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000395799.3 | 3UTR | AUGAGCUUUUCCCUUUGCACUGAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer 0.63 4.8e-4 0.563 2.1e-3 24 Click to see details
GSE38226 Liver fibrosis -0.373 4.8e-2 -0.010 4.8e-1 21 Click to see details
GSE42095 Differentiated embryonic stem cells 0.261 1.1e-1 0.161 2.3e-1 23 Click to see details
GSE28260 Renal cortex and medulla 0.157 3.0e-1 0.203 2.5e-1 13 Click to see details
GSE26953 Aortic valvular endothelial cells -0.105 3.1e-1 -0.085 3.5e-1 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.097 3.2e-1 -0.176 2.0e-1 25 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.099 3.4e-1 0.050 4.2e-1 20 Click to see details
GSE14794 Lymphoblastoid cells 0.007 4.7e-1 0.001 5.0e-1 90 Click to see details
GSE32688 Pancreatic cancer 0.003 4.9e-1 0.019 4.6e-1 32 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC -0.932 0.12 -0.500 0.33 3 Click to see details
BRCA -0.148 0.43 0.000 0.5 4 Click to see details
BRCA -0.148 0.43 0.000 0.5 4 Click to see details
BRCA -0.148 0.43 0.000 0.5 4 Click to see details
BRCA -0.148 0.43 0.000 0.5 4 Click to see details
BRCA -0.148 0.43 0.000 0.5 4 Click to see details
BRCA -0.148 0.43 0.000 0.5 4 Click to see details
BRCA -0.148 0.43 0.000 0.5 4 Click to see details
152 hsa-miR-518a-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT004667 MCL1 MCL1, BCL2 family apoptosis regulator 3 1
MIRT060823 CEP350 centrosomal protein 350 2 2
MIRT072482 RAB8B RAB8B, member RAS oncogene family 2 2
MIRT076138 WDR81 WD repeat domain 81 2 2
MIRT076233 SMCR8 Smith-Magenis syndrome chromosome region, candidate 8 2 6
MIRT082391 HNRNPUL1 heterogeneous nuclear ribonucleoprotein U like 1 2 4
MIRT090336 SEC61A1 Sec61 translocon alpha 1 subunit 2 8
MIRT091943 ZBTB47 zinc finger and BTB domain containing 47 2 6
MIRT092025 ABHD5 abhydrolase domain containing 5 2 6
MIRT095381 UBE2D2 ubiquitin conjugating enzyme E2 D2 2 2
MIRT142423 TNRC6A trinucleotide repeat containing 6A 2 6
MIRT149875 LDLR low density lipoprotein receptor 2 2
MIRT168656 MAPK14 mitogen-activated protein kinase 14 2 2
MIRT178931 C11ORF57 chromosome 11 open reading frame 57 2 2
MIRT179070 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 6
MIRT193027 TMOD3 tropomodulin 3 2 8
MIRT195757 ATMIN ATM interactor 2 6
MIRT210001 LIMD1 LIM domains containing 1 2 2
MIRT211285 ANKRD50 ankyrin repeat domain 50 2 2
MIRT217608 NUS1 NUS1 dehydrodolichyl diphosphate synthase subunit 2 2
MIRT230978 PRRG4 proline rich and Gla domain 4 2 2
MIRT248250 SP1 Sp1 transcription factor 2 2
MIRT249362 BCL2L2-PABPN1 BCL2L2-PABPN1 readthrough 2 2
MIRT257798 CDC5L cell division cycle 5 like 2 4
MIRT267984 UCK2 uridine-cytidine kinase 2 2 2
MIRT301220 SH3BP4 SH3 domain binding protein 4 2 2
MIRT312573 G3BP1 G3BP stress granule assembly factor 1 2 4
MIRT315532 MARCKS myristoylated alanine rich protein kinase C substrate 2 2
MIRT343048 ABHD2 abhydrolase domain containing 2 2 2
MIRT442635 TBC1D12 TBC1 domain family member 12 2 2
MIRT443425 MAPT microtubule associated protein tau 2 2
MIRT444153 ZNF701 zinc finger protein 701 2 2
MIRT444501 ZNF525 zinc finger protein 525 2 2
MIRT445203 CRYBG3 crystallin beta-gamma domain containing 3 2 2
MIRT447064 MCC mutated in colorectal cancers 2 4
MIRT448126 CCDC80 coiled-coil domain containing 80 2 2
MIRT460408 TNFRSF10B TNF receptor superfamily member 10b 2 4
MIRT462941 ZNF800 zinc finger protein 800 2 12
MIRT463576 ZBTB38 zinc finger and BTB domain containing 38 2 2
MIRT466375 TGOLN2 trans-golgi network protein 2 2 4
MIRT469271 RHOB ras homolog family member B 2 8
MIRT469301 RGS16 regulator of G protein signaling 16 2 2
MIRT469804 RAB14 RAB14, member RAS oncogene family 2 2
MIRT470063 PTGES2 prostaglandin E synthase 2 2 2
MIRT470994 PITPNA phosphatidylinositol transfer protein alpha 2 2
MIRT474951 KCTD10 potassium channel tetramerization domain containing 10 2 4
MIRT475189 IMPDH1P11 inosine monophosphate dehydrogenase 1 pseudogene 11 2 6
MIRT475864 H3F3C H3 histone family member 3C 2 10
MIRT475898 H3F3B H3 histone family member 3B 2 8
MIRT481940 ANKRD11 ankyrin repeat domain 11 2 2
MIRT485556 FOXQ1 forkhead box Q1 2 2
MIRT491004 ATF7IP activating transcription factor 7 interacting protein 2 2
MIRT492192 SOCS1 suppressor of cytokine signaling 1 2 4
MIRT493272 LPP LIM domain containing preferred translocation partner in lipoma 2 2
MIRT495273 NICN1 nicolin 1 2 4
MIRT495675 PRKD3 protein kinase D3 2 2
MIRT497541 PPTC7 PTC7 protein phosphatase homolog 2 2
MIRT500398 ZMAT3 zinc finger matrin-type 3 2 8
MIRT500484 ZBTB4 zinc finger and BTB domain containing 4 2 6
MIRT500586 UQCRFS1 ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1 2 4
MIRT500635 TUBB2A tubulin beta 2A class IIa 2 8
MIRT501641 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT501769 NRBF2 nuclear receptor binding factor 2 2 6
MIRT503666 SLC46A1 solute carrier family 46 member 1 2 2
MIRT504322 ASGR2 asialoglycoprotein receptor 2 2 6
MIRT505177 VMA21 VMA21, vacuolar ATPase assembly factor 2 4
MIRT506341 NUP54 nucleoporin 54 2 6
MIRT506435 NACC2 NACC family member 2 2 2
MIRT506667 LZIC leucine zipper and CTNNBIP1 domain containing 2 4
MIRT510974 PFN2 profilin 2 2 6
MIRT511142 MRPL17 mitochondrial ribosomal protein L17 2 8
MIRT512601 EFCAB1 EF-hand calcium binding domain 1 2 4
MIRT521037 SLC30A4 solute carrier family 30 member 4 2 2
MIRT525736 SOD2 superoxide dismutase 2 2 2
MIRT526751 GAS7 growth arrest specific 7 2 2
MIRT526903 ZNF772 zinc finger protein 772 2 6
MIRT527346 FAM69C family with sequence similarity 69 member C 2 2
MIRT531901 GLP2R glucagon like peptide 2 receptor 2 2
MIRT532367 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT534253 SLC12A7 solute carrier family 12 member 7 2 2
MIRT534744 RAVER2 ribonucleoprotein, PTB binding 2 2 4
MIRT535341 PFN1 profilin 1 2 2
MIRT535972 MESDC1 talin rod domain containing 1 2 2
MIRT536508 KCTD15 potassium channel tetramerization domain containing 15 2 2
MIRT536885 HIC2 HIC ZBTB transcriptional repressor 2 2 2
MIRT537039 GRAMD4 GRAM domain containing 4 2 2
MIRT537425 FBXL7 F-box and leucine rich repeat protein 7 2 2
MIRT544578 AP5Z1 adaptor related protein complex 5 zeta 1 subunit 2 4
MIRT546423 SNX5 sorting nexin 5 2 2
MIRT546754 RLIM ring finger protein, LIM domain interacting 2 2
MIRT547985 HCFC2 host cell factor C2 2 4
MIRT548408 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 2 2
MIRT549445 ACSL4 acyl-CoA synthetase long chain family member 4 2 2
MIRT549671 ZNF598 zinc finger protein 598 2 2
MIRT550526 MYZAP myocardial zonula adherens protein 2 2
MIRT551214 CIDEC cell death inducing DFFA like effector c 2 2
MIRT552307 ZXDA zinc finger, X-linked, duplicated A 2 4
MIRT552430 ZNF460 zinc finger protein 460 2 2
MIRT553198 UBE2A ubiquitin conjugating enzyme E2 A 2 2
MIRT553337 TRPC3 transient receptor potential cation channel subfamily C member 3 2 4
MIRT554807 REL REL proto-oncogene, NF-kB subunit 2 2
MIRT555180 PRUNE2 prune homolog 2 2 2
MIRT556151 MECP2 methyl-CpG binding protein 2 2 2
MIRT557863 FGFR1OP FGFR1 oncogene partner 2 2
MIRT562085 KIAA0895 KIAA0895 2 2
MIRT563332 RPLP0 ribosomal protein lateral stalk subunit P0 2 2
MIRT565309 TMEM41A transmembrane protein 41A 2 2
MIRT566135 RACGAP1 Rac GTPase activating protein 1 2 2
MIRT567024 KLHL15 kelch like family member 15 2 2
MIRT567242 HSPA13 heat shock protein family A (Hsp70) member 13 2 2
MIRT568560 AKAP10 A-kinase anchoring protein 10 2 2
MIRT570683 FZD5 frizzled class receptor 5 2 2
MIRT572221 BTN3A3 butyrophilin subfamily 3 member A3 2 2
MIRT573305 AKR7A2 aldo-keto reductase family 7 member A2 2 2
MIRT575743 Zfp618 zinc finger protein 618 1 1
MIRT613461 B3GNT6 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 6 2 2
MIRT614734 STAT5A signal transducer and activator of transcription 5A 2 2
MIRT615118 BCL11B B-cell CLL/lymphoma 11B 2 2
MIRT623238 MLLT6 MLLT6, PHD finger containing 2 2
MIRT623487 KCTD11 potassium channel tetramerization domain containing 11 2 2
MIRT623990 FAM104A family with sequence similarity 104 member A 2 2
MIRT624011 EPHB1 EPH receptor B1 2 2
MIRT626278 PEX26 peroxisomal biogenesis factor 26 2 2
MIRT631416 CRLS1 cardiolipin synthase 1 2 4
MIRT641135 ZBTB33 zinc finger and BTB domain containing 33 2 2
MIRT647830 RAB23 RAB23, member RAS oncogene family 2 2
MIRT649064 HSD17B12 hydroxysteroid 17-beta dehydrogenase 12 2 2
MIRT650284 PYCARD PYD and CARD domain containing 2 2
MIRT651512 WNT4 Wnt family member 4 2 2
MIRT651852 UNC5D unc-5 netrin receptor D 2 2
MIRT652215 TRIM33 tripartite motif containing 33 2 2
MIRT654704 PRRC2B proline rich coiled-coil 2B 2 2
MIRT656793 KNTC1 kinetochore associated 1 2 2
MIRT656926 KIAA1462 junctional cadherin 5 associated 2 2
MIRT659158 DCTN5 dynactin subunit 5 2 2
MIRT663086 METTL10 EEF1A lysine methyltransferase 2 2 2
MIRT676044 AUTS8 Autism, susceptibility to, 8 2 2
MIRT680129 ADRBK2 G protein-coupled receptor kinase 3 2 2
MIRT689531 KIAA0513 KIAA0513 2 2
MIRT691474 FOXRED2 FAD dependent oxidoreductase domain containing 2 2 2
MIRT692505 SPIN4 spindlin family member 4 2 2
MIRT702405 KITLG KIT ligand 2 2
MIRT704532 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 2 2
MIRT714231 ARMC10 armadillo repeat containing 10 2 2
MIRT718761 HOOK3 hook microtubule tethering protein 3 2 2
MIRT725422 HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 2 2
MIRT732176 PIK3C2A phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha 4 1
MIRT732272 CCL2 C-C motif chemokine ligand 2 2 1
MIRT732706 GZMB granzyme B 3 0
MIRT735791 CCR6 C-C motif chemokine receptor 6 3 0
MIRT756341 MMP2 matrix metallopeptidase 2 2 1
MIRT756342 MMP9 matrix metallopeptidase 9 2 1
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-518a-5p (-)-eburnamonine 71203 NSC322920 sensitive
hsa-miR-518a-5p (1'R,3'S,3'aS,8'bS)-1',3'-diphenylspiro[1,3-dihydroindene-2,2'-3,3a,4,8b-tetrahydro-1H-cyclopenta[a]indene]-1,4'-diol 385850 NSC677249 sensitive
hsa-miR-518a-5p (1-(((2-amino-6-chloro-4-pyrimidinyl)amino)methyl)-3-isopropylcyclobutyl)methanol 385230 NSC676343 sensitive
hsa-miR-518a-5p (10,13-dimethyl-3-oxo-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-17-yl) 3-methylidene-2-oxo-6-oxabicyclo[3.1.0]hexane-1-carboxylate 495432 NSC654893 sensitive
hsa-miR-518a-5p (2E)-2-[(3,4-dichlorophenyl)methylidene]-6-[(dimethylamino)methyl]cyclohexan-1-one;hydrochloride 5468455 NSC670688 sensitive
hsa-miR-518a-5p (2e,4e,6z,8e)-n-(1,3-benzodioxol-5-yl)-3,7-dimethyl-9-(2,6,6-trimethylcyclohexen-1-yl)nona-2,4,6,8-tetraenamide 24202490 NSC672131 sensitive
hsa-miR-518a-5p (2E,6E)-2,6-bis[(4-bromophenyl)methylidene]cyclohexan-1-one 5716584 NSC632831 sensitive
hsa-miR-518a-5p (2s)-1-[(2-phenylmethoxynaphtho[1,2-f][1,3]benzodioxol-5-yl)methyl]piperidine-2-carboxylic acid 24205345 NSC735209 resistant
hsa-miR-518a-5p (3e)-3-[(2-chloro-1-phenylindol-3-yl)methylidene]-5-methoxy-6-methyl-1h-indol-2-one 5471471 NSC711611 sensitive
hsa-miR-518a-5p (3e)-3-[(2,6-dimethylimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471419 NSC711074 sensitive
hsa-miR-518a-5p (3e)-5-methoxy-3-[(6-phenyl-2,3-dihydroimidazo[2,1-b][1,3]thiazol-5-yl)methylidene]-1h-indol-2-one 5471411 NSC711066 sensitive
hsa-miR-518a-5p (3Z)-1,1-dimethyl-3-[5-sulfanylidene-4-[(3,4,5-trimethoxyphenyl)methyl]-1,2,4-dithiazolidin-3-ylidene]thiourea 5914108 NSC645621 sensitive
hsa-miR-518a-5p (3z)-5-chloro-3-[(2,6-dimethylimidazo[2,1-b][1,3,4]thiadiazol-5-yl)methylidene]-1h-indol-2-one 24205825 NSC736807 sensitive
hsa-miR-518a-5p (4-methoxyphenyl)(2,3,4-trimethoxyphenyl)methanone 240478 NSC46683 sensitive
hsa-miR-518a-5p (4aR,9aR)-9-(4-methylphenyl)sulfonyl-3,4,4a,9a-tetrahydrocarbazole 372866 NSC648556 sensitive
hsa-miR-518a-5p (4e)-4-(3h-1,3-benzothiazol-2-ylidene)-1-[4-(difluoromethylsulfanyl)phenyl]-5-iminopyrrolidin-2-one 135543874 NSC744116 sensitive
hsa-miR-518a-5p (4S,5R)-4-(2-methylpropyl)-3-[(1R)-1-phenylethyl]-5-phenylmethoxyoxathiazinane 2,2-dioxide 390837 NSC688895 sensitive
hsa-miR-518a-5p (5E)-3-(4-chlorophenyl)-5-[(3-phenoxyphenyl)methylidene]-2-phenyl-1,3-thiazolidin-4-one 5470253 NSC699081 sensitive
hsa-miR-518a-5p (5E)-3-(4-methoxyphenyl)-1,1-dioxo-2-phenyl-5-[(3,4,5-trimethoxyphenyl)methylidene]-1,3-thiazolidin-4-one 5470267 NSC699095 sensitive
hsa-miR-518a-5p (5e)-3-benzyl-5-benzylidene-2-(3,4,5-trimethoxyphenyl)-1,3-thiazolidin-4-one 5470510 NSC702359 sensitive
hsa-miR-518a-5p (5z)-3-[4-benzoyl-2-[(4z)-5-oxo-2-phenyl-4-[(3,4,5-trimethoxyphenyl)methylidene]imidazol-1-yl]phenyl]-2-phenyl-5-[(3,4,5-trimethoxyphenyl)methylidene]imidazol-4-one NSC711885 sensitive
hsa-miR-518a-5p (6-acetamido-7-methyl-5,8-dioxo-2,3-dihydro-1H-pyrrolo[1,2-a]benzimidazol-3-yl) 2-methoxyacetate 374010 NSC651084 sensitive
hsa-miR-518a-5p (6aS)-3-[5-[4-(2-diethoxyphosphorylethyl)piperazin-1-yl]pentoxy]-2-methoxy-6a,7,8,9-tetrahydropyrrolo[2,1-c][1,4]benzodiazepin-11-one 25113728 NSC744025 sensitive
hsa-miR-518a-5p (7-acetamido-2-acetyloxy-1-methoxy-10-methylsulfanyl-9-oxo-6,7-dihydro-5H-benzo[a]heptalen-3-yl) acetate 435732 NSC374980 sensitive
hsa-miR-518a-5p (7ar)-1,6-bis(4-methoxyphenyl)-7a-phenyltetrahydroimidazo[1,5-b][1,2,4]oxadiazol-2(1h)-one 402882 NSC717189 sensitive
hsa-miR-518a-5p (8R,9S,10R,13S,14S,16E)-10,13-dimethyl-16-[[3-(2-morpholin-4-ylethoxy)phenyl]methylidene]-1,2,6,7,8,9,11,12,14,15-decahydrocyclopenta[a]phenanthrene-3,17-dione 24205793 NSC736753 sensitive
hsa-miR-518a-5p (8R,9S,13S,14S,17S)-13-methyl-2-(2,2,2-trifluoroethoxy)-6,7,8,9,11,12,14,15,16,17-decahydrocyclopenta[a]phenanthrene-3,17-diol 386444 NSC678473 sensitive
hsa-miR-518a-5p (8R,9S,13S,14S,17S)-3,17-dihydroxy-13-methyl-2-(2,2,2-trifluoroethoxy)-8,9,11,12,14,15,16,17-octahydro-7H-cyclopenta[a]phenanthren-6-one 387663 NSC681684 sensitive
hsa-miR-518a-5p (e)-1-(2,5-dimethoxyphenyl)-3-(2-fluoro-4,5-dihydroxyphenyl)prop-2-en-1-one 5471282 NSC710266 sensitive
hsa-miR-518a-5p (e)-1-(3,5-ditert-butyl-4-hydroxyphenyl)-3-(3,4-dimethoxyphenyl)prop-2-en-1-one 5471156 NSC709100 sensitive
hsa-miR-518a-5p (E)-1-(7-fluoro-3-methylquinoxalin-2-yl)-3-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 45029310 NSC746087 sensitive
hsa-miR-518a-5p (e)-1-(benzenesulfonyl)-3-(2-phenyl-1h-indol-3-yl)prop-2-en-1-one 54613416 NSC749193 sensitive
hsa-miR-518a-5p (E)-1-[4-(quinazolin-4-ylamino)phenyl]-3-(2,4,6-trimethoxyphenyl)prop-2-en-1-one 155816064 NSC760015 sensitive
hsa-miR-518a-5p (e)-1-[4-[[4-(4-chloroanilino)-6-(4-fluoroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-3-[4-(dimethylamino)phenyl]prop-2-en-1-one 45028715 NSC743884 sensitive
hsa-miR-518a-5p (e)-1-[4-[[4,6-bis(4-fluoroanilino)-1,3,5-triazin-2-yl]amino]phenyl]-3-(4-methoxyphenyl)prop-2-en-1-one 24205905 NSC737224 sensitive
hsa-miR-518a-5p (E)-3-(6-thiophen-2-ylimidazo[2,1-b][1,3]thiazol-5-yl)-1-(3,4,5-trimethoxyphenyl)prop-2-en-1-one 50908742 NSC750743 sensitive
hsa-miR-518a-5p (E)-3-[4-(dimethylamino)phenyl]-1-(4-hydroxyphenyl)prop-2-en-1-one 5468166 NSC665694 sensitive
hsa-miR-518a-5p (E)-N-ethyl-3-(4-methoxyphenyl)-2-(3,4,5-trimethoxyphenyl)prop-2-enamide 5388754 NSC638409 sensitive
hsa-miR-518a-5p (Z)-3-amino-1-(5-amino-3-phenylpyrazol-1-yl)-3-phenylprop-2-en-1-one 21825201 NSC749518 sensitive
hsa-miR-518a-5p (z) 3,3',4,5-tetramethoxystilbene 5388774 NSC638492 sensitive
hsa-miR-518a-5p .beta.-phenylethyl 2,4,5-trihydroxycinnamate 5933247 NSC666592 sensitive
hsa-miR-518a-5p [(1r,2r,3r,4r,6r,8s,9e,12s,13s,14r,15s)-3,4,6,12,13-pentaacetyloxy-4,8,11,11-tetramethyl-14-(2-methylpropoxy)-7,18-dioxo-19-oxatricyclo[13.4.0.02,6]nonadec-9-en-15-yl] benzoate 5469441 NSC688228 sensitive
hsa-miR-518a-5p [(1s,2s,3r,4s,7r,9s,10s,12r,15s)-4,12-diacetyloxy-1,9-dihydroxy-15-[(2r,3s)-2-hydroxy-3-(3-methylbutanoylamino)-3-phenylpropanoyl]oxy-10,14,17,17-tetramethyl-11-oxo-6-oxatetracyclo[11.3.1.03,10.04,7]h 6712271 NSC664404 sensitive
hsa-miR-518a-5p [(3bR,9aS,11aS)-2-(2-hydroxy-5-oxo-2H-furan-3-yl)-3b,6,6,9a-tetramethyl-2,3,3a,4,5,5a,7,8,9,9b,10,11-dodecahydronaphtho[2,1-e][1]benzofuran-11a-yl]methyl acetate 378635 NSC661428 sensitive
hsa-miR-518a-5p [(3s,8r,9s,10r,13s,14s,16e)-16-(1-acetyloxy-2,2,2-trifluoroethylidene)-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1h-cyclopenta[a]phenanthren-3-yl] acetate 5351782 NSC45238 sensitive
hsa-miR-518a-5p [(8R,9S,13S,14S)-2-ethoxy-3-hydroxy-13-methyl-6,7,8,9,11,12,14,15,16,17-decahydrocyclopenta[a]phenanthren-17-yl] [(8S,9R,13R,14R)-2-ethoxy-3-hydroxy-13-methyl-6,7,8,9,11,12,14,15,16,17-decahydrocyclopenta[a]phenanthren-17-yl] sulfite;ethyl acetate 389907 NSC686560 sensitive
hsa-miR-518a-5p [(E)-[3-(methylamino)pyridin-2-yl]methylideneamino]thiourea 9555629 NSC266748 resistant
hsa-miR-518a-5p [1-[[(2-amino-6-chloropyrimidin-4-yl)amino]methyl]-3-(2-phenylethyl)cyclobutyl]methanol 385232 NSC676345 sensitive
hsa-miR-518a-5p [3-(4-fluorophenyl)-8,9-dimethyl-2-oxo-5H-pyrano[3,2-c]chromen-5-yl] acetate 45113107 NSC747825 sensitive
hsa-miR-518a-5p [3,4,5-triacetyloxy-6-(1-cyano-2-sulfanylidene-4-thiophen-2-yl-5,6-dihydrobenzo[f]isoquinolin-3-yl)oxan-2-yl]methyl acetate 386291 NSC678049 sensitive
hsa-miR-518a-5p [4-amino-2-[(4-chlorophenyl)amino]thiazol-5-yl]-(4-methoxyphenyl)methanone 399621 NSC710530 sensitive
hsa-miR-518a-5p [4-amino-2-[(4-methoxyphenyl)amino]thiazol-5-yl]-(2-furyl)methanone 399017 NSC709438 sensitive
hsa-miR-518a-5p [5-(n-[(z)-n-(dimethylcarbamothioyl)-c-methylsulfanylcarbonimidoyl]anilino)-1,2,4-dithiazol-3-ylidene]-dimethylazanium;iodide 9569862 NSC622588 sensitive
hsa-miR-518a-5p [acetyl-[5-(trityloxymethyl)spiro[3a,5,6,6a-tetrahydrofuro[2,3-d][1,3]dioxole-2,1'-cyclopentane]-6-yl]amino] acetate 374290 NSC651809 sensitive
hsa-miR-518a-5p {2-[(benzylamino)methyl]-1h-indole-1,3-diyl}bis(phenylmethanone) 374841 NSC653267 sensitive
hsa-miR-518a-5p 1-(1-naphthylmethylene)-4-(1-naphthyl)semicarbazide 5859414 NSC680931 sensitive
hsa-miR-518a-5p 1-(2-naphthylmethyl)-4-[1-(2-naphthylmethyl)-4-piperidyl]piperidine hydrochloride 393913 NSC696885 sensitive
hsa-miR-518a-5p 1-(3-methoxyphenyl)-4-phenyl-[1,2,4]triazolo[4,3-a]quinoxaline 399100 NSC709516 sensitive
hsa-miR-518a-5p 1-(4-chlorophenyl)-1'-methyl-3,3-diphenylspiro[azetidine-4,3'-indole]-2,2'-dione 16096361 NSC737780 sensitive
hsa-miR-518a-5p 1-(6-bromo-2-chloroquinolin-3-yl)-n-(4-chlorophenyl)methanimine 402198 NSC716089 sensitive
hsa-miR-518a-5p 1-(9-methoxy-11,12-dihydro-6h-indolo[1,2-b][2]benzazepin-13-yl)ethanone 365697 NSC633551 sensitive
hsa-miR-518a-5p 1-(acetyloxy)-2-(2-(1-(acetyloxy)-1h-benzimidazol-2-yl)phenyl)-1h-benzimidazole 355531 NSC609356 sensitive
hsa-miR-518a-5p 1-(naphthalen-1-ylmethyl)-4-[1-(naphthalen-1-ylmethyl)piperidin-4-yl]piperidine 364095 NSC669995 sensitive
hsa-miR-518a-5p 1-[(e)-1,3-benzodioxol-5-ylmethylideneamino]-3-(2-chlorophenyl)urea 9572409 NSC715192 sensitive
hsa-miR-518a-5p 1-[[2-(4-chlorophenyl)-4-methylidene-5-oxooxolan-2-yl]methyl]-5-methylpyrimidine-2,4-dione 381501 NSC668257 sensitive
hsa-miR-518a-5p 1-[2-(3-chlorophenyl)-2-oxoethyl]-2-acetylbenzimidazole 46911792 NSC748533 sensitive
hsa-miR-518a-5p 1-[4-[(1,3-dihydroxy-2-methylpropan-2-yl)amino]butyl]-5,10-dihydroxynaphtho[2,3-f]indole-4,11-dione 406504 NSC724631 sensitive
hsa-miR-518a-5p 1-[5-[[[4-chlorobutyl(methyl)amino]-[(5-nitrofuran-2-yl)methoxy]phosphoryl]oxymethyl]-2,5-dihydrofuran-2-yl]-5-methylpyrimidine-2,4-dione 404846 NSC721390 sensitive
hsa-miR-518a-5p 1-[6-[[tert-butyl(dimethyl)silyl]oxymethyl]-2,2-dimethyl-3a,4,6,6a-tetrahydrofuro[3,4-d][1,3]dioxol-4-yl]-5-hex-1-ynyl-6-iodopyrimidine-2,4-dione 45028649 NSC743556 sensitive
hsa-miR-518a-5p 1-benzyl-2-methyl-1-(2-phenylethyl)-4,5-dihydroimidazol-1-ium 413544 NSC49460 sensitive
hsa-miR-518a-5p 1-benzyl-3-[[5-(4-chlorophenyl)-7-(p-tolyl)pyrrolo[2,3-d]pyrimidin-4-yl]amino]thiourea 3001721 NSC667707 sensitive
hsa-miR-518a-5p 1-benzyl-3-hexadecyl-2-methylimidazolium chloride 44219704 NSC745343 sensitive
hsa-miR-518a-5p 11h-benzo[a]carbazole-1,4-dione, 7,11-dimethyl- 371271 NSC645330 sensitive
hsa-miR-518a-5p 15-phenyl-13,14,17-triazatetracyclo[8.7.0.02,7.011,16]heptadeca-1(10),2,4,6,8,11(16),14-heptaen-12-one 135426789 NSC718581 sensitive
hsa-miR-518a-5p 16-methoxy-4-(4-methoxyphenyl)-9-propan-2-yl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 390916 NSC689137 sensitive
hsa-miR-518a-5p 17-methyl-13,14,17-triazatetracyclo[8.7.0.02,7.011,16]heptadeca-1(10),2,4,6,8,11(16),14-heptaen-12-one 403909 NSC719502 resistant
hsa-miR-518a-5p 1h-benzimidazole, 5,5'-dithiobis[2-(trifluoromethyl)- (9ci) NSC659162 sensitive
hsa-miR-518a-5p 2',6'-dibromo-2-(methoxymethyl)spiro[7,8-dihydro-6h-thieno[3,2-g]quinoline-5,4'-cyclohexa-2,5-diene]-1',4,9-trione 375900 NSC656211 sensitive
hsa-miR-518a-5p 2-(1-methylindol-3-yl)-4-(1-methylpyrrolo[2,3-b]pyridin-3-yl)-1,3-thiazole 60147980 NSC753377 sensitive
hsa-miR-518a-5p 2-(1h-benzimidazol-2-yl)-3,4,5,6-tetrachlorobenzohydrazide 402423 NSC716354 sensitive
hsa-miR-518a-5p 2-(2-naphthyl)-5-methyl-1,8-naphthyridin-4(1h)-one 386570 NSC679018 sensitive
hsa-miR-518a-5p 2-(2-naphthyl)-5,7-dimethyl-1,8-naphthyridin-4(1h)-one 5468909 NSC679021 sensitive
hsa-miR-518a-5p 2-(3-(2-methoxy-4-(4-methylene-5-oxotetrahydro-2-furanyl)phenoxy)propyl)-1h-isoindole-1,3(2h)-dione 381521 NSC668277 sensitive
hsa-miR-518a-5p 2-(4-bromophenyl)-1,3-dichloro-5,6-dimethoxy-1h-indene 360785 NSC623166 sensitive
hsa-miR-518a-5p 2-(4-chlorophenyl)-1-methylene-3-phenyl-pyrazino[1,2-a]benzimidazole 390230 NSC687522 resistant
hsa-miR-518a-5p 2-(4-hydroxy-3,5-dimethoxyphenyl)-9,9-dimethyl-5,8,10,14,16-pentaoxatetracyclo[9.7.0.03,7.013,17]octadeca-1(18),3(7),11,13(17)-tetraen-4-one 382068 NSC669382 sensitive
hsa-miR-518a-5p 2-(4-methoxyphenyl)-4-(1-methylpyrrolo[2,3-b]pyridin-3-yl)-1,3-thiazole 54613605 NSC749862 sensitive
hsa-miR-518a-5p 2-(5-chloro-2-methylanilino)-6-(trifluoromethyl)pyridine-3-carboxamide 24204601 NSC732287 resistant
hsa-miR-518a-5p 2-(6-benzoyl-1h-benzimidazol-2-yl)-3,4,5,6-tetrachloro-n-(furan-2-yl)benzamide 402231 NSC716122 sensitive
hsa-miR-518a-5p 2-(6-bromo-2-chloroquinolin-3-yl)-2-[(4-methoxyphenyl)amino]acetamide 402332 NSC716223 sensitive
hsa-miR-518a-5p 2-(8-(4-methoxyphenyl)-7-methyl-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-6-yl)hydrazinecarboxamide NSC667911 sensitive
hsa-miR-518a-5p 2-(naphthalen-2-ylamino)-1,2-diphenylethanone 411561 NSC34924 sensitive
hsa-miR-518a-5p 2-(trifluoromethyl)benzimidazo[2,1-b][1,3,5]benzothiadiazepin-12(13h)-imine 383194 NSC671313 sensitive
hsa-miR-518a-5p 2-[(2-aminophenyl)sulfanylmethyl]-3-methoxy-xanthen-9-one 330512 NSC319447 sensitive
hsa-miR-518a-5p 2-[(3,4-dicloro)anilino]-3-phenyl-5,7-diamino quinoxaline 24203444 NSC728037 sensitive
hsa-miR-518a-5p 2-[(dimethylamino)methyl]-1-(2-methylphenyl)prop-2-en-1-one;hydrochloride 13958695 NSC382002 sensitive
hsa-miR-518a-5p 2-[(dimethylamino)methyl]-3-[(Z)-heptadec-10-enyl]-5-methoxybenzene-1,4-diol;hydrochloride 5387959 NSC630004 sensitive
hsa-miR-518a-5p 2-[[(2-aminobenzoyl)oxy-dibutyl-stannyl]amino]benzoic acid 16684416 NSC628572 sensitive
hsa-miR-518a-5p 2-[[(e)-(4-methoxyphenyl)iminocarbamoyl]amino]-4-methyl-pentanamide 390563 NSC688071 sensitive
hsa-miR-518a-5p 2-[[6-[[bis(carboxymethyl)amino]methyl]-4-[2-[4-(2-phenylethynyl)phenyl]ethynyl]pyridin-2-yl]methyl-(carboxymethyl)amino]acetic acid 369524 NSC641379 resistant
hsa-miR-518a-5p 2-[2-(4-chlorobenzoyl)benzimidazol-1-yl]-1-(4-methoxyphenyl)ethanone 45029097 NSC745455 sensitive
hsa-miR-518a-5p 2-[2-[(e)-[2-(2-hydroxy-1h-indol-3-yl)indol-3-ylidene]amino]oxyethoxy]-6-(hydroxymethyl)oxane-3,4,5-triol 135436306 NSC717859 resistant
hsa-miR-518a-5p 2-[2-[(E)-benzylideneamino]-6-phenylpyrimidin-4-yl]-4-chlorophenol 135509207 NSC678883 resistant
hsa-miR-518a-5p 2-[4-[5-(3,4-dimethoxyphenyl)imidazol-1-yl]phenyl]-5,7-dimethoxy-1,3-benzothiazole 60147635 NSC751902 sensitive
hsa-miR-518a-5p 2-[5-(2,2-dimethyl-1,3-dioxolan-4-yl)-2,2-dimethyl-1,3-dioxolan-4-yl]-6-methoxy-3-nitro-2H-chromene 358300 NSC618261 sensitive
hsa-miR-518a-5p 2-[5-[4-[5-[4-(6-morpholin-4-yl-1H-benzimidazol-2-yl)phenoxy]pentyl]piperazin-1-yl]pentyl]benzo[de]isoquinoline-1,3-dione 44219118 NSC743432 sensitive
hsa-miR-518a-5p 2-acetyl-1,2-dihydroellipticine 376328 NSC657149 resistant
hsa-miR-518a-5p 2-amino-4-(2-hydroxy-4-methylphenyl)-5-phenylpyrimidine 392744 NSC693547 sensitive
hsa-miR-518a-5p 2-amino-5-[[5-amino-3,4-dicyano-1-(4-fluorophenyl)pyrrol-2-yl]disulfanyl]-1-(4-fluorophenyl)pyrrole-3,4-dicarbonitrile 396951 NSC704171 sensitive
hsa-miR-518a-5p 2-benzylsulfanyl-1-(4-methoxyphenyl)-4-(3,4,5-trimethoxyphenyl)imidazole 45027957 NSC740259 sensitive
hsa-miR-518a-5p 2-chloro-5,8-dihydroxy-3-(4-nitrophenoxy)naphthalene-1,4-dione 135409136 NSC658872 sensitive
hsa-miR-518a-5p 2-ethyl-n-phenyl-5,6,7,8-tetrahydrothieno[2,3-b]quinolin-4-amine 365483 NSC633116 sensitive
hsa-miR-518a-5p 2-ethylaminoestradiol 384235 NSC673652 sensitive
hsa-miR-518a-5p 2-isopropyl-11-oxo-n-[2-(4-phenylpiperazin-1-yl)ethyl]-11h-pyrido[2,1-b]quinazoline-8-carboxamide 353192 NSC600684 sensitive
hsa-miR-518a-5p 2-isoquinolin-2-ium-2-yl-1-phenanthren-3-ylethanone;iodide 5351160 NSC35489 sensitive
hsa-miR-518a-5p 2-methoxy-3-{[3-(4-methoxyphenyl)-3,3a,4,5-tetrahydro-2h-benzo[g]indazol-2-yl]sulfonyl}benzoic acid 403620 NSC718688 sensitive
hsa-miR-518a-5p 2-methoxy-4-(7-methyl-6-(4-morpholinyl)-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-8-yl)phenol 380573 NSC666223 sensitive
hsa-miR-518a-5p 2-methyl-1-[10-[(2-methylquinolin-4-yl)amino]decyl]quinolin-1-ium-4-amine;chloride;hydrochloride 387885 NSC682096 sensitive
hsa-miR-518a-5p 2-methyl-5-nitro-n-[4-(5-phenyl-4,5-dihydro-1,2-oxazol-3-yl)phenyl]benzenesulfonamide 402358 NSC716270 sensitive
hsa-miR-518a-5p 2-n-[3-(diethylaminomethyl)-4-methoxyphenyl]-4-n-[4-(dimethylamino)cyclohexyl]quinazoline-2,4-diamine;hydrochloride 54610390 NSC174030 sensitive
hsa-miR-518a-5p 2-n,4-n-bis(4-chlorophenyl)-6-n-[4-[5-(4-methoxyphenyl)-1,2-oxazol-3-yl]phenyl]-1,3,5-triazine-2,4,6-triamine 45028705 NSC743874 sensitive
hsa-miR-518a-5p 2-naphthalen-2-yl-1h-[1,8]naphthyridin-4-one 386569 NSC679017 sensitive
hsa-miR-518a-5p 2-phenyl-3-(1-piperidyl)-4-[?]yl-thietane 1,1-dioxide 421543 NSC135371 sensitive
hsa-miR-518a-5p 2,2'-spirobi[3,6,7,8-tetrahydro-1H-cyclopenta[g]naphthalene]-5,5'-dione 382634 NSC670283 sensitive
hsa-miR-518a-5p 2,2'-spirobi[indane]-5,5'-dicarbaldehyde 382743 NSC670421 sensitive
hsa-miR-518a-5p 2,2'(1h,1'h)-spirobi[s-indacen]-1-one, 4'-acetyl-3,3',5,5',6,6',7,7'-octahydro- 382664 NSC670312 sensitive
hsa-miR-518a-5p 2,3-dibenzoyloxy-4-hydroxy-4-oxobutanoate;(2,5-dimethylphenyl)-(4-methylphenyl)-phenylsulfanium 5351228 NSC116693 sensitive
hsa-miR-518a-5p 2,5-cyclohexadiene-1,4-dione, 2,3-dimethoxy-5-(2-naphthalenylthio)- 314728 NSC234214 sensitive
hsa-miR-518a-5p 2,5-dibenzyl-2-undecyloctahydro-1h-pyrrolo[3,4-c]pyridin-2-ium bromide 378731 NSC661832 sensitive
hsa-miR-518a-5p 2,6-dimethoxy-4-(7-methyl-6-(1-piperidinyl)-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-8-yl)phenol 383126 NSC671167 sensitive
hsa-miR-518a-5p 2,6-epoxy-2h-1-benzoxocin-5(6h)-one, 6,8-dimethyl- 434882 NSC359892 sensitive
hsa-miR-518a-5p 2,6,13,17-tetrazaheptacyclo[15.12.0.01,25.03,16.05,14.07,12.018,23]nonacosa-3,5,7,9,11,13,15,18(23)-octaene 378784 NSC661960 sensitive
hsa-miR-518a-5p 2,7-bis(methoxycarbonylmethyl)-10-methylphenothiazine 384444 NSC674225 sensitive
hsa-miR-518a-5p 3-(2-quinolyl)-6-(3,4,5-trimethoxyphenyl)pyridine-2,4-diol 135429924 NSC612223 sensitive
hsa-miR-518a-5p 3-(3-fluorophenyl)-n-pyridin-3-yl-2h-pyrazolo[3,4-d][1,3]thiazol-5-amine 60147811 NSC752461 sensitive
hsa-miR-518a-5p 3-(4-chlorophenoxy)-4-[4-(2-dimethylaminoethyloxy)phenyl]-7-methoxy-chromen-2-one 395152 NSC699452 sensitive
hsa-miR-518a-5p 3-(4-methoxy-2-methylphenyl)naphthol [2,1-c]furan-1(3h)-one 369148 NSC640735 sensitive
hsa-miR-518a-5p 3-(4-methoxyphenyl)-1-[(e)-2-(2-thienyl)vinyl]pyrazino[1,2-a]benzimidazole 5471218 NSC709480 sensitive
hsa-miR-518a-5p 3-(4-methoxyphenyl)-1-methylidene-2-phenylpyrazino[1,2-a]benzimidazole 390235 NSC687527 sensitive
hsa-miR-518a-5p 3-[(2,3-dimethoxyphenyl)methyl]-7,8-dimethoxy-5-methylsulfanyl-2,5-dihydro-1H-3-benzazepin-4-one 359177 NSC619859 sensitive
hsa-miR-518a-5p 3-[2-(1h-indol-3-yl)-2-oxoethyl]quinoxalin-2(1h)-one 400273 NSC711806 sensitive
hsa-miR-518a-5p 3-acetyl-3a-chloro-5,11b-dihydroxy-2-methyl-1-(4-methylphenyl)naphtho[2,3-g]indole-6,11-dione 405625 NSC722995 sensitive
hsa-miR-518a-5p 3-chloroindolo[2,1-b]quinazoline-6,12-dione 396706 NSC703315 sensitive
hsa-miR-518a-5p 3-chloropyrido[1,2-a]benzimidazole-1,4-dicarbonitrile 378325 NSC660334 sensitive
hsa-miR-518a-5p 3-methyl-5-[(2,3,4,5,6-pentafluorophenyl)-[2,3,5,6-tetrafluoro-4-[(3-methyl-1,2-oxazol-5-yl)methyl]phenyl]methyl]-1,2-oxazole 380224 NSC665700 sensitive
hsa-miR-518a-5p 3-nitro-n-[2-[2-[(3-nitroacridin-9-yl)amino]phenyl]phenyl]acridin-9-amine 3694250 NSC645158 sensitive
hsa-miR-518a-5p 3-oxospiro[1H-indene-2,6'-2,3,5,7-tetrahydro-1H-s-indacene]-4'-carboxylic acid 384728 NSC674964 sensitive
hsa-miR-518a-5p 3-phenyl-4-[(e)-(3,4,5-trimethoxyphenyl)methylideneamino]-1h-1,2,4-triazol-5-one 9556392 NSC702400 sensitive
hsa-miR-518a-5p 3-pyridinecarboxamide, n-[3-(phenylsulfonyl)-2-thienyl]- 393673 NSC696049 sensitive
hsa-miR-518a-5p 3,19-(4-acetamido)benzylidineandrographolide 54612901 NSC747452 sensitive
hsa-miR-518a-5p 3,4,7-trichloro-n,n-bis(2-chloroethyl)-11-oxobenzo[d][1,3,6,2]benzodioxathiaphosphocin-11-amine 382835 NSC670664 sensitive
hsa-miR-518a-5p 3,8-dimethyl-1,2-naphthoquinone 373912 NSC650935 sensitive
hsa-miR-518a-5p 4-(2-(((6-bromo-1,3-benzodioxol-5-yl)methyl)amino)ethyl)phenol 290548 NSC154572 sensitive
hsa-miR-518a-5p 4-(2-oxo-2-phenylethoxy)-2h-1-benzopyran-2-one 386272 NSC678029 resistant
hsa-miR-518a-5p 4-(3h-[1,3]thiazolo[3,4-a]benzimidazol-1-yl)phenyl acetate 384820 NSC675272 sensitive
hsa-miR-518a-5p 4-(4-chlorophenyl)-N-(2-methoxyphenyl)-3-prop-2-enyl-1,3-thiazol-2-imine;hydrobromide 396119 NSC701666 sensitive
hsa-miR-518a-5p 4-(5-(4-(hydroxy(oxido)amino)phenyl)-2-furyl)-2-(4-toluidino)-1,3-thiazole 367868 NSC638034 sensitive
hsa-miR-518a-5p 4-(dimethylamino)-9-ethyl-16-methyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 397883 NSC706739 sensitive
hsa-miR-518a-5p 4-[(4-bromophenyl)diazenyl]benzene-1,3-diol NSC402590 sensitive
hsa-miR-518a-5p 4-[(4z)-5-oxo-4-[(4-phenoxyphenyl)methylidene]-2-phenylimidazol-1-yl]-n-(1,3-thiazol-2-yl)benzenesulfonamide 5472414 NSC718649 sensitive
hsa-miR-518a-5p 4-[(e)-2-[3-(3-chlorophenyl)-6a,10b-dimethyl-8-methylidene-1,4a,5,6,7,9,10,10a-octahydronaphtho[2,1-d][1,3]dioxin-7-yl]ethenyl]-2h-furan-5-one 54613026 NSC750039 sensitive
hsa-miR-518a-5p 4-[(e)-2-[3-(4-chlorophenyl)-6a,10b-dimethyl-8-methylidene-1,4a,5,6,7,9,10,10a-octahydronaphtho[2,1-d][1,3]dioxin-7-yl]ethenyl]-2h-furan-5-one 54613025 NSC750038 sensitive
hsa-miR-518a-5p 4-[(z)-indolo[1,2-b]indazol-11-ylidenemethyl]-n,n-dimethylaniline 5472473 NSC719163 sensitive
hsa-miR-518a-5p 4-[2-[4-[3-(4-chlorophenyl)-1-methylene-pyrazino[1,2-a]benzimidazol-2-yl]phenoxy]ethyl]morpholine 399072 NSC709483 sensitive
hsa-miR-518a-5p 4-[2-[4-[3-(4-methoxyphenyl)-1-methylene-pyrazino[1,2-a]benzimidazol-2-yl]phenoxy]ethyl]morpholine 399071 NSC709482 sensitive
hsa-miR-518a-5p 4-[3-[5-[2-(4-carboxyphenyl)prop-2-enyl]-1,3-dimethyl-2,4,6-trioxo-1,3-diazinan-5-yl]prop-1-en-2-yl]benzoic acid 24205530 NSC736104 sensitive
hsa-miR-518a-5p 4-[4-(3-methoxyphenyl)piperazin-1-yl]-5H-pyrrolo[3,2-d]pyrimidine 155815900 NSC754824 sensitive
hsa-miR-518a-5p 4-[6-(4-fluoro-3-phenoxyphenyl)-[1,2,4]triazolo[3,4-b][1,3,4]thiadiazol-3-yl]phenol 135585388 NSC726267 resistant
hsa-miR-518a-5p 4-acetylspiro[1,3,5,6,7,8-hexahydrocyclopenta[b]naphthalene-2,2'-3,6,7,8-tetrahydro-1h-cyclopenta[g]naphthalene]-5'-one 382750 NSC670428 sensitive
hsa-miR-518a-5p 4-benzyl-1-(2-chlorophenyl)-[1,2,4]triazolo[4,3-a]quinoxaline 46945878 NSC761676 sensitive
hsa-miR-518a-5p 4-methyl-1,1-diphenyl-1,2,3,4-tetrahydrobenzo(h)phosphinolinium hexafluorophosphate 498151 NSC245398 sensitive
hsa-miR-518a-5p 4-methylsulfanyl-N-[(3,4,5-trimethoxyphenyl)methyl]aniline 373808 NSC650772 sensitive
hsa-miR-518a-5p 4-morpholinecarbodithioic acid, antimony complex NSC625498 sensitive
hsa-miR-518a-5p 4-n-[12-[(5-amino-6-chloropyrimidin-4-yl)amino]dodecyl]-6-chloropyrimidine-4,5-diamine 358989 NSC619196 sensitive
hsa-miR-518a-5p 4-thiomorpholinecarbodithioic acid, antimony complex NSC625497 sensitive
hsa-miR-518a-5p 4,5,15,16-tetraphenyl-10-(2,4,6-triphenylpyridin-1-ium-1-yl)-3,6,14,17-tetraoxa-23-azatricyclo[17.3.1.18,12]tetracosa-1(23),8(24),9,11,19,21-hexaen-24-olate 16129807 NSC674178 sensitive
hsa-miR-518a-5p 5-(dithiolan-3-yl)-N-(3-methoxy-13-methyl-6,7,8,9,11,12,14,15,16,17-decahydrocyclopenta[a]phenanthren-17-yl)pentanamide 24205571 NSC736179 sensitive
hsa-miR-518a-5p 5-[2-(2,5-dimethoxyphenyl)ethynyl]-N-[2-(4-fluorophenyl)ethyl]-2-methoxybenzamide 403660 NSC718728 sensitive
hsa-miR-518a-5p 5-[2-(2,5-dimethoxyphenyl)ethynyl]-N-hexyl-2-methoxybenzamide 403659 NSC718727 sensitive
hsa-miR-518a-5p 5-[2-[3-phenylpropyl(propyl)amino]ethyl]-1,3-dihydrobenzimidazole-2-thione 3005423 NSC699427 sensitive
hsa-miR-518a-5p 5-[3-[(7-chloroquinolin-4-yl)amino]phenyl]-3-(3,4,5-trimethoxyphenyl)-3,4-dihydropyrazole-2-carbaldehyde 72374830 NSC762542 sensitive
hsa-miR-518a-5p 5-[5-(5-formyl-4-propyl-1h-pyrrol-2-yl)-2-thienyl]-3-propyl-1h-pyrrole-2-carbaldehyde 374810 NSC653147 sensitive
hsa-miR-518a-5p 5-{[2-(cyclobutylcarbonyl)-6-methoxy-1,2,3,4,5,8-hexahydroisoquinolin-1-yl]methyl}-2-methoxyphenol 401790 NSC715520 sensitive
hsa-miR-518a-5p 5-acetylspiro[1,3-dihydroindene-2,6'-2,3,5,7-tetrahydro-s-indacene]-1'-one 382730 NSC670408 sensitive
hsa-miR-518a-5p 5-benzyl-5h-benzo[b]phosphindole 5-oxide 380786 NSC666496 sensitive
hsa-miR-518a-5p 5-chroman-6-yl-2-(4-pyridyl)oxazole 380226 NSC665702 sensitive
hsa-miR-518a-5p 5-fluoro-2-deoxycytidine 240980 NSC48006 resistant
hsa-miR-518a-5p 5-hydroxy-3-phenylpyrano[3,2-c]chromen-2(5h)-one 24205741 NSC736555 sensitive
hsa-miR-518a-5p 5-methyl-2-{[(2)-3-phenylprop-2-enoyl]amino}benzamide 53329052 NSC748147 sensitive
hsa-miR-518a-5p 5,5,6'-trimethyl-3-phenylspiro[1,3-oxazolidine-4,2'-chromene]-2-thione 392265 NSC692406 sensitive
hsa-miR-518a-5p 5a-methoxy-9-(2-methoxyphenyl)-5a,6,8a,9-tetrahydro-8h-[1,3]dioxolo[4,5-g]furo[3,4-b]chromen-8-one 380086 NSC665484 sensitive
hsa-miR-518a-5p 6-(2-hydroxyethyl)indeno[1,2-c]isoquinoline-5,11-dione 334474 NSC339705 resistant
hsa-miR-518a-5p 6-bromo-1-(4-methylphenyl)sulfonyl-2,3-dihydroquinolin-4-one 395752 NSC700552 sensitive
hsa-miR-518a-5p 6-chloro-1-(2-nitrophenyl)sulfonyl-3,4-dihydro-2h-quinoline 380120 NSC665522 sensitive
hsa-miR-518a-5p 6-chloro-3-[(Z)-[2-(4-methoxyphenyl)benzimidazol-5-ylidene]methyl]-1H-indol-2-ol 155806854 NSC763703 sensitive
hsa-miR-518a-5p 6,6-dimethyl-1-[3-[(3-nitrophenyl)methoxy]phenyl]-1,3,5-triazine-2,4-diamine 419053 NSC109836 sensitive
hsa-miR-518a-5p 6,7-dimethyl-5,8-diazatetracyclo[10.2.2.02,11.04,9]hexadeca-2,4,6,8,10,13-hexaene-3,10-diol 135409115 NSC658387 sensitive
hsa-miR-518a-5p 7'-but-3-en-2-yl-7'-(3-phenylmethoxypropyl)spiro[1,3-dioxolane-2,2'-3,4,7a,8,9,10-hexahydro-1h-cyclopenta[i]indolizine]-6'-thione 361486 NSC624523 sensitive
hsa-miR-518a-5p 7-[(2-methoxyphenyl)methyl]-6-phenyl-4,5-dihydropyrrolo[3,4-g][1,2]benzoxazole 60148267 NSC754073 sensitive
hsa-miR-518a-5p 7-[(3-fluorophenyl)methoxy]-9-[(3-fluorophenyl)methyl]-2-[(4-fluorophenyl)methyl]-1-methylpyrido[3,4-b]indol-2-ium 54766740 NSC760181 sensitive
hsa-miR-518a-5p 7-benzyl-3-[(e)-3-oxo-3-phenylprop-1-enyl]-16-thia-2,4,5,7-tetrazatetracyclo[7.7.0.02,6.010,15]hexadeca-1(9),3,5,10(15)-tetraen-8-one 45028585 NSC743396 sensitive
hsa-miR-518a-5p 7-chloro-10,11-dimethoxy-2,8-diazatricyclo[7.3.1.05,13]trideca-1(12),5,7,9(13),10-pentaene-3,4-dione 397794 NSC706232 sensitive
hsa-miR-518a-5p 7-chloro-5-hydroxy-2-methoxy-2,4-dimethyl-1H-benzo[e][1]benzofuran-6,9-dione 359534 NSC620517 sensitive
hsa-miR-518a-5p 7,16-bis((2-methoxy-1-naphthyl)methyl)-1,4,10,13-tetraoxa-7,16-diazacyclooctadecane 374351 NSC651922 sensitive
hsa-miR-518a-5p 7,17-dimethoxy-10,14-dithia-3,12-diaza-1-azoniapentacyclo[11.7.0.03,11.04,9.015,20]icosa-1(13),4(9),5,7,11,15(20),16,18-octaene;iodide 404661 NSC721084 sensitive
hsa-miR-518a-5p 8-(1,3-benzodioxol-5-yl)-3-methoxy-2,5,12,14-tetraoxatetracyclo[7.7.0.03,7.011,15]hexadeca-1(16),9,11(15)-trien-6-one 380098 NSC665496 sensitive
hsa-miR-518a-5p 8-(6-fluorohexyl)-3-methyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380336 NSC665863 resistant
hsa-miR-518a-5p 8-[3-(1,3-dioxolan-2-yl)-2-(4-fluorophenyl)propyl]-3-ethyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380308 NSC665789 resistant
hsa-miR-518a-5p 8-benzyl-1-phenyl-3-oxa-1,8-diazaspiro[4.5]decan-4-one 380263 NSC665741 sensitive
hsa-miR-518a-5p 8-chloro-7-methyl-n-(4-methylphenyl)-5,5-dioxo-[1,2,4]triazolo[4,3-b][1,4,2]benzodithiazin-3-amine 400656 NSC713018 sensitive
hsa-miR-518a-5p 8(5h)-quinolinone, 7-chloro-5-[[4-(diethylamino)-2-methylphenyl]imino]- 363174 NSC627778 sensitive
hsa-miR-518a-5p 9-(2,4-dimethoxyphenyl)-6,9-dihydro-8h-[1,3]dioxolo[4,5-g]furo[3,4-b]chromen-8-one 380092 NSC665490 sensitive
hsa-miR-518a-5p 9-[(2e)-2-(4-chlorophenyl)-2-hydroxyiminoethoxy]chromeno[3,4-b]chromene-6,12-dione 9572588 NSC721045 sensitive
hsa-miR-518a-5p 9-[2-(2,5-dimethylpyrrol-1-yl)phenyl]-7-hydroxy-5,6-di(propan-2-yloxy)-3-oxa-1-azatricyclo[6.3.1.04,12]dodeca-4,6,8(12),10-tetraen-2-one 389261 NSC685014 sensitive
hsa-miR-518a-5p 9-acridinamine, n-(4-ethoxyphenyl)-, monohydrochloride 2788193 NSC165714 sensitive
hsa-miR-518a-5p 9-isobutyl-6-(((2-methyl-1-naphthyl)methyl)thio)-9h-purin-2-amine 244996 NSC56452 sensitive
hsa-miR-518a-5p 9,11-dimethyl-1h-benzo[a]carbazole-1,4(11h)-dione 378584 NSC661224 sensitive
hsa-miR-518a-5p A15655 262000 NSC95170 sensitive
hsa-miR-518a-5p Acetic acid, [1,4,7,10-tetraazacyclododecane-1,7-diyl]bis 387352 NSC681105 sensitive
hsa-miR-518a-5p Aminothiadiazines 135550831 NSC742088 sensitive
hsa-miR-518a-5p Artelasticin 5471311 NSC710342 sensitive
hsa-miR-518a-5p Azur i 68275 NSC9598 sensitive
hsa-miR-518a-5p Baccharin 5358645 NSC269757 sensitive
hsa-miR-518a-5p Benzo[1,2-c:4,5-c']dipyrrole-1,3,5,7(2h,6h)-tetraimine 359178 NSC619860 sensitive
hsa-miR-518a-5p Benzyl (2r)-1-[3-methyl-2-[methyl-[3-methyl-2-[methyl-[(2s)-2-[methyl-[(2r)-3-methyl-2-[(2-methylpropan-2-yl)oxycarbonylamino]butanoyl]amino]-3-phenylpropanoyl]amino]butanoyl]amino]butanoyl]pyrrolidin 54608164 NSC653627 sensitive
hsa-miR-518a-5p Benzyl (2s)-2-[methyl-[(2s)-1-[(2s)-3-methyl-2-[methyl-[3-methyl-2-[methyl-[(2s)-3-methyl-2-[(2-methylpropan-2-yl)oxycarbonylamino]butanoyl]amino]butanoyl]amino]butanoyl]pyrrolidine-2-carbonyl]amino]- 6712043 NSC653624 sensitive
hsa-miR-518a-5p Benzyl 2-(dibenzylamino)-3-phenylpropanoate 375616 NSC655438 sensitive
hsa-miR-518a-5p Benzyl 3-methyl-2-[methyl-[2-[methyl-[3-methyl-2-[(2-methylpropan-2-yl)oxycarbonylamino]butanoyl]amino]-3-phenylpropanoyl]amino]butanoate 375406 NSC655092 sensitive
hsa-miR-518a-5p Bis(trifluoromethylsulfonyl)azanide;trihexyl(tetradecyl)phosphanium 11181836 NSC747251 sensitive
hsa-miR-518a-5p Blastmycin 245869 NSC58239 sensitive
hsa-miR-518a-5p Bromocriptine methanesulfonate 31100 NSC169774 sensitive
hsa-miR-518a-5p C12h8n2o2s 3838042 NSC675587 sensitive
hsa-miR-518a-5p C22h12f6o6s2 389883 NSC686511 sensitive
hsa-miR-518a-5p Caracemide 54747 NSC253272 sensitive
hsa-miR-518a-5p Carbon monoxide; cyclopentane; 1-ethoxy-3a-methyl-azulen-4-one; iron 499038 NSC649307 sensitive
hsa-miR-518a-5p Chimaphilin 101211 NSC400245 sensitive
hsa-miR-518a-5p Chloroplatinum(1+); 2-diphenylphosphanyl-n,n-dimethyl-ethanamine 499568 NSC685470 sensitive
hsa-miR-518a-5p Copper;(ne,3z)-n-[1-(6-methylpyridazin-3-yl)ethylidene]-3-azabicyclo[3.2.2]nonane-3-carbohydrazonothioate 9578854 NSC633271 sensitive
hsa-miR-518a-5p Cuspidatin c 5459164 NSC636859 sensitive
hsa-miR-518a-5p Di-n-octyl-secalonsaure a 430141 NSC268925 sensitive
hsa-miR-518a-5p Dichlorobisoxinatotitanium(iv) NSC635157 sensitive
hsa-miR-518a-5p Diethyl 2-((4-(((3-chloro-2-phenyl-6-quinoxalinyl)methyl)amino)benzoyl)amino)pentanedioate 373186 NSC649150 sensitive
hsa-miR-518a-5p Diethyl 2-[[4-[3-phenyl-6-(trifluoromethyl)quinoxalin-2-yl]oxybenzoyl]amino]pentanedioate 390814 NSC688816 resistant
hsa-miR-518a-5p Diethyl 4-hydroxy-2-(4-methoxyphenyl)-6-oxo-4-phenyl-1,3-cyclohexanedicarboxylate 386764 NSC679443 sensitive
hsa-miR-518a-5p Diethylcyanine 5717105 NSC97374 sensitive
hsa-miR-518a-5p Dimethyl (E)-2-(2,4,6,8-tetramethylazulen-1-yl)but-2-enedioate 5468210 NSC666123 sensitive
hsa-miR-518a-5p Dromostanolone propionate 224004 NSC12198 sensitive
hsa-miR-518a-5p Eh00008 354026 NSC603974 sensitive
hsa-miR-518a-5p Ethyl (E)-3-(6-methoxy-1-thiophen-3-yl-3,4-dihydronaphthalen-2-yl)prop-2-enoate 24205739 NSC736553 sensitive
hsa-miR-518a-5p Ethyl 1-[2-oxo-2-[(4-oxo-6-phenoxy-3-phenylquinazolin-7-yl)amino]ethyl]piperidine-4-carboxylate 54613378 NSC747174 sensitive
hsa-miR-518a-5p Ethyl 1-methyl-5-[(1-methyl-5-nitroindole-2-carbonyl)amino]indole-2-carboxylate 24204472 NSC732001 resistant
hsa-miR-518a-5p Ethyl 4-[[(5s,5as)-9-(4-hydroxy-3,5-dimethoxyphenyl)-8-oxo-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-5-yl]amino]piperidine-1-carboxylate;hydrochloride 375038 NSC653864 resistant
hsa-miR-518a-5p Ethyl 4,5,15,16-tetramethoxy-10-azatetracyclo[7.7.1.02,7.013,17]heptadeca-1,3,5,7,9(17),13,15-heptaene-10-carboxylate 285758 NSC143241 sensitive
hsa-miR-518a-5p Ethyl 6-methyl-2-(4-methylbenzyl)-1-oxo-2-indanecarboxylate 382681 NSC670329 sensitive
hsa-miR-518a-5p Geldanamycin analog 5358467 NSC255104 sensitive
hsa-miR-518a-5p Glemyyhyohrblt-uhfffaoysa-n 381505 NSC668261 sensitive
hsa-miR-518a-5p Go-y103 1352182 NSC677240 sensitive
hsa-miR-518a-5p Gsk718429a 44587530 NSC756188 sensitive
hsa-miR-518a-5p Gw794607x 9604926 NSC756355 sensitive
hsa-miR-518a-5p Herveline o 5459269 NSC676002 sensitive
hsa-miR-518a-5p Heteromine a 391982 NSC691767 sensitive
hsa-miR-518a-5p Hymenialdisine 135413546 NSC607173 sensitive
hsa-miR-518a-5p Indanthren corinth rk 5351878 NSC74702 sensitive
hsa-miR-518a-5p Inostamycin 368135 NSC638478 sensitive
hsa-miR-518a-5p Insariotoxin 6711181 NSC138780 sensitive
hsa-miR-518a-5p Iron;(ne,3z)-n-[1-(6-methylpyridazin-3-yl)ethylidene]-3-azabicyclo[3.2.2]nonane-3-carbohydrazonothioate 9578853 NSC633270 sensitive
hsa-miR-518a-5p Ixabepilone 6445540 NSC747973 sensitive
hsa-miR-518a-5p J3.572.907k 396709 NSC703318 sensitive
hsa-miR-518a-5p Juncusol deriv (compound 1) 24200489 NSC378135 sensitive
hsa-miR-518a-5p Kinetin riboside 3832 NSC120958 resistant
hsa-miR-518a-5p Kuc100204 378309 NSC660313 sensitive
hsa-miR-518a-5p Kuc100232 381132 NSC667449 sensitive
hsa-miR-518a-5p L-alpha-aminobutyric acid 1573 NSC659853 sensitive
hsa-miR-518a-5p Lapachone 3885 NSC629749 sensitive
hsa-miR-518a-5p Lmpk12050091 165203 NSC646923 sensitive
hsa-miR-518a-5p Ls-123342 5469111 NSC683328 sensitive
hsa-miR-518a-5p Ls-41225 57787 NSC664951 sensitive
hsa-miR-518a-5p Lychnopholide 49767028 NSC669145 sensitive
hsa-miR-518a-5p M-232 403374 NSC718170 sensitive
hsa-miR-518a-5p Maxima isoflavone d 343081 NSC382028 sensitive
hsa-miR-518a-5p Mecal 67686 NSC150555 sensitive
hsa-miR-518a-5p Melampodinin 5359028 NSC294600 sensitive
hsa-miR-518a-5p Methyl-[2-methyl-2-(4-methylphenyl)propyl]-diphenylphosphanium;iodide 20835892 NSC176098 sensitive
hsa-miR-518a-5p Methyl (2E)-2-methoxyimino-2-[2-[[2-(trifluoromethyl)phenoxy]methyl]phenyl]acetate 6520923 NSC720765 sensitive
hsa-miR-518a-5p Methyl (2s,3s)-2-(4-hydroxyphenyl)-5-[(e)-3-methoxy-3-oxoprop-1-enyl]-2,3-dihydro-1-benzofuran-3-carboxylate 5468718 NSC675006 sensitive
hsa-miR-518a-5p Methyl (e)-3-[2-[[methyl-(4-methylphenyl)-oxo-lambda6-sulfanylidene]amino]phenyl]prop-2-enoate 24202623 NSC716715 sensitive
hsa-miR-518a-5p Methyl (E)-4-[4,5-dichloro-2-[2-[methyl-[(1S,2S)-2-pyrrolidin-1-ylcyclohexyl]amino]-2-oxoethyl]anilino]-4-oxobut-2-enoate 54611534 NSC707465 sensitive
hsa-miR-518a-5p Methyl 10-acetyl-3-(4-methylphenyl)sulfonyl-9-(2-methylprop-1-enyl)-3,10-diazatricyclo[6.4.1.04,13]trideca-1,4,6,8(13),11-pentaene-11-carboxylate NSC621968 sensitive
hsa-miR-518a-5p Methyl 2-((1-oxo-1,2,3,5,6,7-hexahydro-s-indacen-2-yl)methyl)benzoate 382689 NSC670337 sensitive
hsa-miR-518a-5p Methyl 2-(2,3-dihydro-1H-inden-5-ylmethyl)-1-oxo-3,6,7,8-tetrahydro-as-indacene-2-carboxylate 385670 NSC677016 sensitive
hsa-miR-518a-5p Methyl 2-[(1r,2r,6s,7s)-3,5-dithiatricyclo[5.2.1.02,6]dec-8-en-4-ylidene]-1,3-dithiole-4-carboxylate 403847 NSC719381 sensitive
hsa-miR-518a-5p Methyl 2-[6-(4-aminobenzoyl)-1,3-benzodioxol-5-yl]acetate 404212 NSC720379 sensitive
hsa-miR-518a-5p Methyl 4-[(e)-(5-methyl-2-phenylpyrazol-3-yl)iminomethyl]benzoate 9572413 NSC715229 sensitive
hsa-miR-518a-5p Methyl 4-methyl-2-((6-methyl-1-oxo-2,3-dihydro-1h-inden-2-yl)methyl)benzoate 385695 NSC677041 sensitive
hsa-miR-518a-5p Methyl 7-oxospiro[1,2,3,5-tetrahydro-s-indacene-6,6'-2,3,5,7-tetrahydro-1h-s-indacene]-4'-carboxylate 382665 NSC670313 sensitive
hsa-miR-518a-5p Methyl N-(4-chlorophenyl)sulfonyl-N'-[3-[[[(4-chlorophenyl)sulfonylamino]-methylsulfanylmethylidene]amino]propyl]carbamimidothioate 382843 NSC670673 sensitive
hsa-miR-518a-5p Methyl n-[6-[(4-fluorophenyl)sulfonylamino]-1h-benzimidazol-2-yl]carbamate 404125 NSC720248 sensitive
hsa-miR-518a-5p Mitomycin 281834 NSC134727 resistant
hsa-miR-518a-5p N'-(4-chloroanilino)pyrazine-2-carboximidamide 9572225 NSC709079 sensitive
hsa-miR-518a-5p N'-[1-(1-benzothiophen-2-yl)cyclohexyl]-n-methylpropane-1,3-diamine;(e)-but-2-enedioic acid 54611499 NSC708074 sensitive
hsa-miR-518a-5p N'-[8-(4-hydroxy-3,5-dimethoxyphenyl)-7-methyl-7,8-dihydro-6h-[1,3]dioxolo[4,5-g]chromen-6-yl]-4-methylbenzenesulfonohydrazide 383134 NSC671175 sensitive
hsa-miR-518a-5p N-(2-aminophenyl)-4-[3-(3-methyl-2,5-dioxoimidazolidin-1-yl)prop-1-en-2-yl]benzamide 11682081 NSC736099 sensitive
hsa-miR-518a-5p N-(3-hydroxy-7-methyl-5,8-dioxo-2,3-dihydro-1H-pyrrolo[1,2-a]benzimidazol-6-yl)acetamide 374007 NSC651081 sensitive
hsa-miR-518a-5p N-(4-((4-anilino-1-benzyl-4-piperidinyl)ethynyl)-1-benzyl-4-piperidinyl)-n-phenylamine 379997 NSC665299 sensitive
hsa-miR-518a-5p N-(4-(1-adamantyl)-1,3-thiazol-2-yl)-7-hydroxy-2-oxo-2h-chromene-3-carboxamide 5466102 NSC675799 sensitive
hsa-miR-518a-5p N-[2-(1H-indol-3-yl)ethyl]-1,1-dioxo-2-(3-propan-2-yloxyphenyl)-4H-pyrido[4,3-e][1,2,4]thiadiazin-3-imine 135426715 NSC710895 sensitive
hsa-miR-518a-5p N-[4-chloro-2-(2-chlorobenzoyl)phenyl]-2-(4-pyridin-2-ylpiperazin-1-yl)acetamide 24206025 NSC737733 sensitive
hsa-miR-518a-5p N-[6'-(diethylamino)-3-oxospiro[2-benzofuran-1,9'-xanthene]-2'-yl]-N-phenylacetamide 389678 NSC686130 sensitive
hsa-miR-518a-5p N-anthracen-2-yl-8-chloro-5,5-dioxoimidazo[1,2-b][1,4,2]benzodithiazine-7-carboxamide 403255 NSC717956 sensitive
hsa-miR-518a-5p N-dam 152320 NSC653499 sensitive
hsa-miR-518a-5p N-methyl-1,5-bis(4-cyanophenoxy)-3-aza-pentane 45028719 NSC743907 sensitive
hsa-miR-518a-5p N,N-diethyl-4-[[4-(4-methylimidazo[4,5-b]pyridin-2-yl)phenyl]diazenyl]aniline;hydroiodide 366879 NSC635922 sensitive
hsa-miR-518a-5p N~2~,n~4~-di(1-adamantyl)-6-chloro-1,3,5-triazine-2,4-diamine 394865 NSC698954 sensitive
hsa-miR-518a-5p Nabor orange r 135436499 NSC4434 sensitive
hsa-miR-518a-5p Naphtho[2,3-f]quinoxaline-7,12-dione, 3-hydroxy-2-methyl- 371563 NSC645892 resistant
hsa-miR-518a-5p Neuro_000286 3004220 NSC636984 sensitive
hsa-miR-518a-5p None 12201866 NSC179207 sensitive
hsa-miR-518a-5p NSC310547 NSC310547 sensitive
hsa-miR-518a-5p NSC600301 NSC600301 sensitive
hsa-miR-518a-5p NSC621339 NSC621339 sensitive
hsa-miR-518a-5p NSC625492 NSC625492 sensitive
hsa-miR-518a-5p NSC657270 NSC657270 sensitive
hsa-miR-518a-5p NSC658455 NSC658455 sensitive
hsa-miR-518a-5p NSC676495 NSC676495 resistant
hsa-miR-518a-5p NSC699071 NSC699071 sensitive
hsa-miR-518a-5p NSC750717 NSC750717 sensitive
hsa-miR-518a-5p NSC751830 NSC751830 resistant
hsa-miR-518a-5p O-[5-(6-benzamidopurin-9-yl)-2-[[tert-butyl(dimethyl)silyl]oxymethyl]oxolan-3-yl] methylsulfanylmethanethioate 356579 NSC613002 sensitive
hsa-miR-518a-5p Paullone analog 47 396411 NSC702373 sensitive
hsa-miR-518a-5p Phenyl-[2-[2,3,4,5-tetrachloro-6-(5-phenyl-1,3,4-oxadiazol-2-yl)phenyl]-3h-benzimidazol-5-yl]methanone 402241 NSC716132 sensitive
hsa-miR-518a-5p Phosphonium, (3-bromopropyl)triphenyl- bromide 2723862 NSC84074 sensitive
hsa-miR-518a-5p Prumycin 5458561 NSC278619 resistant
hsa-miR-518a-5p Regid_for_cid_289745 289745 NSC151982 sensitive
hsa-miR-518a-5p Rozex 5280954 NSC15628 sensitive
hsa-miR-518a-5p Rsc002586 399616 NSC710525 sensitive
hsa-miR-518a-5p Simvastatin 54454 NSC633782 approved resistant
hsa-miR-518a-5p Spiro[3,6,7,8-tetrahydro-1h-cyclopenta[a]naphthalene-2,2'-3,6,7,8-tetrahydro-1h-cyclopenta[g]naphthalene]-5',9-dione 382635 NSC670284 sensitive
hsa-miR-518a-5p Spiro[as-indacene-2(1h),2'(1'h)-[s]indacen]-1-one, 4'-acetyl-3,3',5',6,6',7,7',8-octahydro- 385658 NSC677004 sensitive
hsa-miR-518a-5p Spiropitan 5265 NSC170983 resistant
hsa-miR-518a-5p Stk366297 242249 NSC50648 sensitive
hsa-miR-518a-5p Stk673166 NSC717468 sensitive
hsa-miR-518a-5p Stk766820 381153 NSC667471 sensitive
hsa-miR-518a-5p Stl323035 383655 NSC672073 sensitive
hsa-miR-518a-5p Stl338719 393017 NSC694265 resistant
hsa-miR-518a-5p Streptonigrin analog (meo-n3) 494043 NSC81052 sensitive
hsa-miR-518a-5p Sudan red 11980862 NSC11241 sensitive
hsa-miR-518a-5p Tannic acid 16134267 NSC758670 resistant
hsa-miR-518a-5p Tetraoxo[?]dione 388215 NSC682809 sensitive
hsa-miR-518a-5p Tetratert-butyl 8,11-dimethoxytricyclo[4.3.3.01,6]dodeca-7,10-diene-7,9,10,12-tetracarboxylate 362411 NSC626176 sensitive
hsa-miR-518a-5p Thioperoxydicarbonic diamide, tetramethyl- 5455 NSC622696 sensitive
hsa-miR-518a-5p Tolonium chloride 7083 NSC36758 sensitive
hsa-miR-518a-5p Tp4ek NSC676497 resistant
hsa-miR-518a-5p Tributyrin 6050 NSC661583 sensitive
hsa-miR-518a-5p Triciribine phosphate 43860 NSC280594 resistant
hsa-miR-518a-5p Triphenyl(2-triphenylphosphaniumylethyl)phosphanium 2785216 NSC64111 sensitive
hsa-miR-518a-5p Tunicamycin 16727450 NSC177382 resistant
hsa-miR-518a-5p Ver a 5351232 NSC126728 sensitive
hsa-miR-518a-5p Vorinostat 5311 NSC701852 approved sensitive
hsa-miR-518a-5p Z198955462 135528004 NSC744178 sensitive
hsa-miR-518a-5p Z28714792 2671841 NSC746248 sensitive
hsa-miR-518a-5p Zinc pyrithione NSC68093 sensitive
hsa-miR-518a-5p Imatinib 5291 NSC743414 approved sensitive Low Gastrointestinal Stromal Tumor tissue and cell line (882R-NC, 882R-OE, 882R-KD)
hsa-miR-518a-5p Ponatinib 24826799 NSC758487 approved sensitive High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-518a-5p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-518a-5p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-518a-5p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-518a-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-518a-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-518a-5p Sunitinib 5329102 NSC750690 approved sensitive tissue
hsa-miR-518a-5p 4-Hydroxytamoxifen+Tamoxifen sensitive cell line (LY2)
hsa-miR-518a-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-518a-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission