pre-miRNA Information
pre-miRNA hsa-mir-497   
Genomic Coordinates chr17: 7017911 - 7018022
Synonyms MIRN497, hsa-mir-497, MIR497
Description Homo sapiens miR-497 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-497-3p
Sequence 64| CAAACCACACUGUGGUGUUAGA |85
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 3 17 - 7017957 29233923 MiREDiBase
A-to-I 4 17 - 7017956 29233923 MiREDiBase
A-to-I 20 17 - 7017940 24964909, 25521855, 27229138, 29165639, 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1413601274 5 dbSNP
rs1028648384 6 dbSNP
rs1479092960 9 dbSNP
rs1261056598 10 dbSNP
rs997278260 11 dbSNP
rs1324708562 13 dbSNP
rs755634302 21 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol KPNA2   
Synonyms IPOA1, QIP2, RCH1, SRP1-alpha, SRP1alpha
Description karyopherin subunit alpha 2
Transcript NM_002266   
Expression
Putative miRNA Targets on KPNA2
3'UTR of KPNA2
(miRNA target sites are highlighted)
>KPNA2|NM_002266|3'UTR
   1 ATCATGTAGCTGAGACATAAATTTGTTGTGTACTACGTTTGGTATTTTGTCTTATTGTTTCTCTACTAAGAACTCTTTCT
  81 TAAATGTGGTTTGTTACTGTAGCACTTTTTACACTGAAACTATACTTGAACAGTTCCAACTGTACATACATACTGTATGA
 161 AGCTTGTCCTCTGACTAGGTTTCTAATTTCTATGTGGAATTTCCTATCTTGCAGCATCCTGTAAATAAACATTCAAGTCC
 241 ACCCTTTTCTTGACTTCACCATGAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1
miRNA  3' agaUUGUGGUG----UCACACCAAAc 5'
             ||| |: :    | |||||||| 
Target 5' aagAACTCTTTCTTAAATGTGGTTTg 3'
68 - 93 149.00 -12.70
2
miRNA  3' agAUUGUGGUGUCACACC--AAAc 5'
            |||: :| :| |||||  ||| 
Target 5' tcTAATTTC-TA-TGTGGAATTTc 3'
182 - 203 114.00 -8.63
3
miRNA  3' agauUGUGGUGUCACACCAAAc 5'
              ::||:|| || |||| | 
Target 5' ttgtGTACTAC-GTTTGGTATt 3'
26 - 46 101.00 -10.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31526962 14 COSMIC
COSN28883648 35 COSMIC
COSN26981806 38 COSMIC
COSN30103536 46 COSMIC
COSN30152099 62 COSMIC
COSN30466523 62 COSMIC
COSN30450845 76 COSMIC
COSN30137318 154 COSMIC
COSN1726642 162 COSMIC
COSN30165274 176 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs782120137 1 dbSNP
rs370784503 2 dbSNP
rs1395945357 3 dbSNP
rs781892184 4 dbSNP
rs1059433 16 dbSNP
rs782492864 21 dbSNP
rs1327123620 22 dbSNP
rs782453419 29 dbSNP
rs782097803 34 dbSNP
rs781838071 36 dbSNP
rs1059424 37 dbSNP
rs374156722 38 dbSNP
rs368012017 40 dbSNP
rs1179297095 43 dbSNP
rs1802811 55 dbSNP
rs570294765 56 dbSNP
rs1467046931 66 dbSNP
rs1272505346 67 dbSNP
rs1205443660 68 dbSNP
rs1352644687 85 dbSNP
rs1262707719 104 dbSNP
rs1237206297 113 dbSNP
rs1335221469 114 dbSNP
rs557497772 116 dbSNP
rs183137047 126 dbSNP
rs1369335129 128 dbSNP
rs1325846653 131 dbSNP
rs1401641907 132 dbSNP
rs1387681746 136 dbSNP
rs1156419866 137 dbSNP
rs1452668442 140 dbSNP
rs1194919789 143 dbSNP
rs1395332291 143 dbSNP
rs1452037560 149 dbSNP
rs1252281812 154 dbSNP
rs1193894607 156 dbSNP
rs1448485762 162 dbSNP
rs547066305 166 dbSNP
rs1281943437 170 dbSNP
rs1204352639 174 dbSNP
rs568499907 175 dbSNP
rs1353203667 180 dbSNP
rs1281306258 186 dbSNP
rs1236518877 189 dbSNP
rs1345894059 193 dbSNP
rs1303312097 204 dbSNP
rs1432164527 207 dbSNP
rs14515 213 dbSNP
rs1328543556 217 dbSNP
rs376076055 237 dbSNP
rs782398118 238 dbSNP
rs1375605478 258 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 3838.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714647. RNA binding protein: AGO2. Condition:mildMNase ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 3838.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000330459.3 | 3UTR | UAUUGUUUCUCUACUAAGAACUCUUUCUUAAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000330459.3 | 3UTR | UCUUAUUGUUUCUCUACUAAGAACUCUUUCUUAAAUGUGGUUUGUUACUGUAGCACUUUUUACACUGAAACUAUACUUGAACA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000330459.3 | 3UTR | UUGUCUUAUUGUUUCUCUACUAAGAACUCUUUCUUAAAUGUGGUUUGUUACUGUAGCACUUUUUACACUGAAACUAUACUUGAACAGUUCCAACUGUACAUACAUACUGUAUGAAGCUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM714647
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / mildMNase, repB
Location of target site ENST00000330459.3 | 3UTR | AUGUGGUUUGUUACUGUAGCACUUUUUACACUGAAACUAUACUUGAACAGUUCCAACUGUAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000330459.3 | 3UTR | AAAUGUGGUUUGUUACUGUAGCACUUUUUACACUGAAACUAUACUUGAACAGUUCCAACUGUACAUACAUACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000330459.3 | 3UTR | UUUGUUACUGUAGCACUUUUUACACUGAAACUAUACUUGAACAGUUCCAACUGUACAUACAUACUGUAUGAAGCUUGUCCUCUGACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28260 Renal cortex and medulla 0.664 6.7e-3 0.570 2.1e-2 13 Click to see details
GSE42095 Differentiated embryonic stem cells -0.491 8.7e-3 -0.304 7.9e-2 23 Click to see details
GSE26953 Aortic valvular endothelial cells -0.387 3.1e-2 -0.194 1.8e-1 24 Click to see details
GSE38226 Liver fibrosis 0.367 5.1e-2 0.414 3.1e-2 21 Click to see details
GSE21687 Ependynoma primary tumors -0.192 6.4e-2 -0.211 4.7e-2 64 Click to see details
GSE28544 Breast cancer -0.309 7.1e-2 -0.225 1.5e-1 24 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.23 1.6e-1 -0.224 1.7e-1 20 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.107 3.1e-1 0.097 3.2e-1 25 Click to see details
GSE32688 Pancreatic cancer 0.081 3.3e-1 0.001 5.0e-1 32 Click to see details
GSE19350 CNS germ cell tumors 0.001 5.0e-1 -0.049 4.4e-1 12 Click to see details
GSE19350 CNS germ cell tumors 0.001 5.0e-1 -0.049 4.4e-1 12 Click to see details
GSE19350 CNS germ cell tumors 0.001 5.0e-1 -0.049 4.4e-1 12 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
CHOL -0.678 0.07 -0.771 0.04 6 Click to see details
LUSC -0.27 0.07 -0.238 0.1 30 Click to see details
UCEC -0.36 0.09 0.024 0.46 16 Click to see details
KICH 0.372 0.09 0.186 0.25 15 Click to see details
BRCA 0.18 0.13 0.221 0.08 42 Click to see details
KIRP 0.25 0.14 0.318 0.08 21 Click to see details
LUAD 0.538 0.23 0.000 0.5 4 Click to see details
PRAD -0.095 0.26 -0.257 0.04 46 Click to see details
ESCA -0.226 0.27 -0.224 0.27 10 Click to see details
KIRC 0.091 0.28 0.137 0.19 43 Click to see details
HNSC 0.096 0.35 0.055 0.41 18 Click to see details
LIHC -0.071 0.35 0.003 0.49 30 Click to see details
BLCA -0.205 0.4 0.400 0.3 4 Click to see details
THCA 0.026 0.43 0.002 0.49 45 Click to see details
PAAD -0.054 0.47 0.000 0.5 4 Click to see details
STAD -0.014 0.48 -0.017 0.47 21 Click to see details
STAD -0.014 0.48 -0.017 0.47 21 Click to see details
STAD -0.014 0.48 -0.017 0.47 21 Click to see details
STAD -0.014 0.48 -0.017 0.47 21 Click to see details
95 hsa-miR-497-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT092955 CYP2U1 cytochrome P450 family 2 subfamily U member 1 2 4
MIRT124568 PRRC2B proline rich coiled-coil 2B 2 2
MIRT125196 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 4
MIRT147296 KPNA2 karyopherin subunit alpha 2 2 8
MIRT163999 KIAA1109 KIAA1109 2 4
MIRT252495 NWD1 NACHT and WD repeat domain containing 1 2 2
MIRT357969 GRPEL2 GrpE like 2, mitochondrial 2 2
MIRT443007 TRIOBP TRIO and F-actin binding protein 2 2
MIRT443524 NETO1 neuropilin and tolloid like 1 2 2
MIRT443573 EVX2 even-skipped homeobox 2 2 2
MIRT443656 BACH1 BTB domain and CNC homolog 1 2 2
MIRT460670 KRT10 keratin 10 2 8
MIRT464761 UBE2N ubiquitin conjugating enzyme E2 N 2 2
MIRT465032 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT465040 TTC39C tetratricopeptide repeat domain 39C 2 2
MIRT468667 SEC62 SEC62 homolog, preprotein translocation factor 2 2
MIRT473694 MAPK8 mitogen-activated protein kinase 8 2 4
MIRT477618 EFNA3 ephrin A3 2 2
MIRT480506 C11orf57 chromosome 11 open reading frame 57 2 2
MIRT480592 BUB3 BUB3, mitotic checkpoint protein 2 2
MIRT486915 ZNF398 zinc finger protein 398 2 6
MIRT487770 ANKEF1 ankyrin repeat and EF-hand domain containing 1 2 16
MIRT493265 MDFIC MyoD family inhibitor domain containing 2 2
MIRT495271 SLC1A2 solute carrier family 1 member 2 2 4
MIRT495309 CHST12 carbohydrate sulfotransferase 12 2 2
MIRT496681 DPP6 dipeptidyl peptidase like 6 2 4
MIRT496891 FOXP1 forkhead box P1 2 2
MIRT497330 IRF4 interferon regulatory factor 4 2 2
MIRT498272 KIAA1644 KIAA1644 2 2
MIRT498634 CHD4 chromodomain helicase DNA binding protein 4 2 10
MIRT500581 USP53 ubiquitin specific peptidase 53 2 2
MIRT500751 TMPPE transmembrane protein with metallophosphoesterase domain 2 6
MIRT509668 ZNF354B zinc finger protein 354B 2 10
MIRT510919 PSMA2 proteasome subunit alpha 2 2 4
MIRT519118 CEP76 centrosomal protein 76 2 2
MIRT526193 ABCG2 ATP binding cassette subfamily G member 2 (Junior blood group) 2 2
MIRT526746 HLA-DOB major histocompatibility complex, class II, DO beta 2 2
MIRT527270 FBLN2 fibulin 2 2 2
MIRT528198 PLEKHM2 pleckstrin homology and RUN domain containing M2 2 2
MIRT528330 TBC1D22B TBC1 domain family member 22B 2 2
MIRT530346 GABRB3 gamma-aminobutyric acid type A receptor beta3 subunit 2 2
MIRT533627 TMX3 thioredoxin related transmembrane protein 3 2 2
MIRT533738 TMEM200C transmembrane protein 200C 2 2
MIRT533779 TMEM133 transmembrane protein 133 2 2
MIRT534317 SKIDA1 SKI/DACH domain containing 1 2 2
MIRT538438 COG5 component of oligomeric golgi complex 5 2 2
MIRT539156 AREL1 apoptosis resistant E3 ubiquitin protein ligase 1 2 2
MIRT539474 ADARB2 adenosine deaminase, RNA specific B2 (inactive) 2 2
MIRT539620 SHISA9 shisa family member 9 2 2
MIRT539650 BUB1 BUB1 mitotic checkpoint serine/threonine kinase 2 2
MIRT540346 OPHN1 oligophrenin 1 2 2
MIRT540412 PITPNC1 phosphatidylinositol transfer protein, cytoplasmic 1 2 2
MIRT541200 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 2
MIRT541395 CDC27 cell division cycle 27 2 2
MIRT546443 SNX5 sorting nexin 5 2 2
MIRT547369 MSI2 musashi RNA binding protein 2 2 2
MIRT553288 TSPAN3 tetraspanin 3 2 2
MIRT554402 SERP1 stress associated endoplasmic reticulum protein 1 2 2
MIRT557822 FOXN2 forkhead box N2 2 2
MIRT568530 ANP32E acidic nuclear phosphoprotein 32 family member E 2 2
MIRT569508 THYN1 thymocyte nuclear protein 1 2 2
MIRT570707 FAM69A family with sequence similarity 69 member A 2 2
MIRT608376 PIWIL2 piwi like RNA-mediated gene silencing 2 2 2
MIRT608483 NKTR natural killer cell triggering receptor 2 6
MIRT613533 TRA2B transformer 2 beta homolog 2 2
MIRT616601 ELP2 elongator acetyltransferase complex subunit 2 2 2
MIRT618166 DUSP18 dual specificity phosphatase 18 2 2
MIRT632059 CEP135 centrosomal protein 135 2 2
MIRT647379 ZDHHC23 zinc finger DHHC-type containing 23 2 2
MIRT648366 POTED POTE ankyrin domain family member D 2 2
MIRT651075 ZNF518B zinc finger protein 518B 2 4
MIRT653618 SLC30A4 solute carrier family 30 member 4 2 2
MIRT653636 SLC30A1 solute carrier family 30 member 1 2 2
MIRT654895 POU2F1 POU class 2 homeobox 1 2 2
MIRT656232 MFSD6 major facilitator superfamily domain containing 6 2 2
MIRT659880 CAPRIN1 cell cycle associated protein 1 2 2
MIRT660526 ARL4C ADP ribosylation factor like GTPase 4C 2 2
MIRT666286 SLC30A3 solute carrier family 30 member 3 2 2
MIRT686808 SNX2 sorting nexin 2 2 4
MIRT695302 TK1 thymidine kinase 1 2 2
MIRT699737 SERINC3 serine incorporator 3 2 2
MIRT700794 PIAS2 protein inhibitor of activated STAT 2 2 2
MIRT712270 PPP1CB protein phosphatase 1 catalytic subunit beta 2 2
MIRT712617 KNSTRN kinetochore localized astrin/SPAG5 binding protein 2 2
MIRT714264 RPL10A ribosomal protein L10a 2 2
MIRT715072 TMTC1 transmembrane and tetratricopeptide repeat containing 1 2 2
MIRT715386 TADA3 transcriptional adaptor 3 2 2
MIRT716397 NPAS1 neuronal PAS domain protein 1 2 2
MIRT725328 NFASC neurofascin 2 2
MIRT725503 GANAB glucosidase II alpha subunit 2 2
MIRT732913 IRAK2 interleukin 1 receptor associated kinase 2 3 0
MIRT734890 SMAD3 SMAD family member 3 3 0
MIRT737328 LINC02476 long intergenic non-protein coding RNA 2476 3 0
MIRT737544 MALAT1 metastasis associated lung adenocarcinoma transcript 1 (non-protein coding) 4 0
MIRT755545 PAK1 p21 (RAC1) activated kinase 1 3 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-497 Bufalin NULL 9547215 Quantitative real-time PCR colorectal cancer HCT116 cells 24375248 2014 up-regulated
miR-497 Diethylstilbestrol approved 448537 Microarray mammosphere-derived epithelial cells (MDEC) 19549897 2009 up-regulated
miR-497 Ethanol NULL 702 Quantitative real-time PCR CIE10 22141737 2012 up-regulated
miR-497 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 up-regulated
miR-497 Reversine NULL 210332 Microarray C2C12 myoblast cells 24513286 2014 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-497 Tamoxifen 2733525 NSC180973 approved sensitive Low Breast Cancer cell line (MCF-7, T47D)
hsa-mir-497 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-497 Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-mir-497 Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-mir-497 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-mir-497 Androstenedione+Letrozole sensitive cell line (MCF-7)
hsa-mir-497 Tamoxifen 2733525 NSC180973 approved sensitive cell line (MCF7)
hsa-mir-497 Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-miR-497-3p Mitoxantrone 4212 NSC279836 approved sensitive High Breast Cancer cell line (BT-20, BT-474, BT-549, CAMA-1, HCC1143, HCC1395, HCC1569, HCC1806, HCC-1937, HCC1954, HCC202, HCC38, HCC70, Hs578T, MCF-7, MDA-MB-175VII, MDA-MB-231, MDA-MB-361, MDA-MB-415, MDA-MB-436, MDA-MB-468, SKBR3, T47D, UACC812, EVSA-T, MPE-600 , SK-BR-
hsa-miR-497-3p Docetaxel 148124 NSC628503 approved resistant High Breast Cancer cell line (MDA-MB-231, MCF-7)
hsa-miR-497-3p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549, PC-9)
hsa-miR-497-3p Cisplatin 5460033 NSC119875 approved resistant Low Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-497-3p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-497-3p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-497-3p Cisplatin 5460033 NSC119875 approved resistant tissue
hsa-miR-497-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-497-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-497-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)

Error report submission