>KPNA2|NM_002266|3'UTR
   1 ATCATGTAGCTGAGACATAAATTTGTTGTGTACTACGTTTGGTATTTTGTCTTATTGTTTCTCTACTAAGAACTCTTTCT
  81 TAAATGTGGTTTGTTACTGTAGCACTTTTTACACTGAAACTATACTTGAACAGTTCCAACTGTACATACATACTGTATGA
 161 AGCTTGTCCTCTGACTAGGTTTCTAATTTCTATGTGGAATTTCCTATCTTGCAGCATCCTGTAAATAAACATTCAAGTCC
 241 ACCCTTTTCTTGACTTCACCATGAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' uuucuUUAACA-----GGA--ACAUACUa 5' || ||| | | ||||||| Target 5' gttccAACTGTACATACATACTGTATGAa 3'	133 - 161	143.00	-5.80

Mutant ID	Mutant Position	Mutant Source
COSN31526962	14	COSMIC
COSN28883648	35	COSMIC
COSN26981806	38	COSMIC
COSN30103536	46	COSMIC
COSN30152099	62	COSMIC
COSN30466523	62	COSMIC
COSN30450845	76	COSMIC
COSN30137318	154	COSMIC
COSN1726642	162	COSMIC
COSN30165274	176	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs782120137	1	dbSNP
rs370784503	2	dbSNP
rs1395945357	3	dbSNP
rs781892184	4	dbSNP
rs1059433	16	dbSNP
rs782492864	21	dbSNP
rs1327123620	22	dbSNP
rs782453419	29	dbSNP
rs782097803	34	dbSNP
rs781838071	36	dbSNP
rs1059424	37	dbSNP
rs374156722	38	dbSNP
rs368012017	40	dbSNP
rs1179297095	43	dbSNP
rs1802811	55	dbSNP
rs570294765	56	dbSNP
rs1467046931	66	dbSNP
rs1272505346	67	dbSNP
rs1205443660	68	dbSNP
rs1352644687	85	dbSNP
rs1262707719	104	dbSNP
rs1237206297	113	dbSNP
rs1335221469	114	dbSNP
rs557497772	116	dbSNP
rs183137047	126	dbSNP
rs1369335129	128	dbSNP
rs1325846653	131	dbSNP
rs1401641907	132	dbSNP
rs1387681746	136	dbSNP
rs1156419866	137	dbSNP
rs1452668442	140	dbSNP
rs1194919789	143	dbSNP
rs1395332291	143	dbSNP
rs1452037560	149	dbSNP
rs1252281812	154	dbSNP
rs1193894607	156	dbSNP
rs1448485762	162	dbSNP
rs547066305	166	dbSNP
rs1281943437	170	dbSNP
rs1204352639	174	dbSNP
rs568499907	175	dbSNP
rs1353203667	180	dbSNP
rs1281306258	186	dbSNP
rs1236518877	189	dbSNP
rs1345894059	193	dbSNP
rs1303312097	204	dbSNP
rs1432164527	207	dbSNP
rs14515	213	dbSNP
rs1328543556	217	dbSNP
rs376076055	237	dbSNP
rs782398118	238	dbSNP
rs1375605478	258	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- Genes & development, 2011

MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.