pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-452 |
Genomic Coordinates | chrX: 151959628 - 151959712 |
Synonyms | MIRN452, hsa-mir-452, MIR452 |
Description | Homo sapiens miR-452 stem-loop |
Comment | The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies . The 5' end of the miRNA may be offset with respect to previous annotations. |
RNA Secondary Structure | |
Associated Diseases |
Mature miRNA Information | |||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-452-3p | ||||||||||||||||||
Sequence | 58| CUCAUCUGCAAAGAAGUAAGUG |79 | ||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||
Experiments | Array-cloned | ||||||||||||||||||
Editing Events in miRNAs |
|
||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | MIDN | ||||||||||||||||||||
Synonyms | - | ||||||||||||||||||||
Description | midnolin | ||||||||||||||||||||
Transcript | NM_177401 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on MIDN | |||||||||||||||||||||
3'UTR of MIDN (miRNA target sites are highlighted) |
>MIDN|NM_177401|3'UTR 1 GATCTTCGGATCGGCCACCCTCGCCCCTCGCACCCCAGCCCAGGGCGGCGGGGACTCCGAGAGCCCCGGAGAGAACGTGG 81 CCCAGCCCTGGAGGGCAGGCGGCCACTCCCCCAGCCAGAAGTCTTTTTTTCTTTTCTTCTTTTTTATTATTTTTTTCTTT 161 TTTTAAAAAGTTCTGACCGTGGTTTCCTGGACTCTTCATGGGCTTTGCTTCCTACCTCCTTCACCCTTCACTCCTGCCCT 241 CCTCTTCCTCCTCCTCCTCCTCCTCCGTCTGTCTCCTTTCACCTCTGCGCCAGGTCGGTCCTCCCTGCCAACCTTCCCCA 321 GCTCCAATATGTAGCAGTCTCTCTGGATGGCGGAGAGTGAAGGAGACGGAGAAACGCGCCCCATCCCTTCCGCCGCCTCC 401 TTTCCCCCCCGACCCTATTCAGGTTTTAAGTCAAAAATGTCGATATGTCATTATGCACTTTACAGATGAGGGGAGGGGCC 481 GCAGTGCGCAGAACCCACCCCACCCCCCAGTGCAGACTTCGGGGTCTCCACCCCAGGCCAGCAGCGCCCACTGGGCTACA 561 GCAAGCCAACAGGTCACAGAAGCCAACGAGGGGACTGTTTCTCTTCCACTCCTATCCTCTTTTCTTGATCTTTTTTTTGC 641 ATTTTCCTTCATTTCTTTAACAAGGAGAGCAAAGCTGTTTTAGCAGAGGCTGGGGCTGAGGTCCCCATGGGGTTTGGGTG 721 CAGGGGCATGGCACCCTTTCCTGTCGGGAAGGGAGAGGGGAACTACCCCCCCAGCCTGCCCTCCGCCCCGCCCCAGCCGG 801 CGGACTGTGCTGTTTCCTCCGCCCCCACTCCCGTGTTTTCTGACCTCCTGCCTGAGTTTGGGGTATTTATAGACTATTAA 881 TTTTCTGACTGAGCCAATAGTGGTTGGGGAACTCTTGAAAAAGGGGAGAGAATGGCTGGGTGCTGGGGAGTTCCCCCCTC 961 CGAGCCCTCCTTCCCGGCCCAACCTGAGGGATGTGGATTTGGGACTGTCTGGGGGCCCCTCCTGCAGCGAGGATGGGAGG 1041 GGGTGCTGAGCTGTGAATCCCCTGGGCAGGGGGCGACAACTCCGTGTAGCATTAACCCCCGTGGCGGGGTCCGCTGCTGG 1121 TCTAATTTGGACCCCCTGCCTCTCAGTGCCCCTGCCCTAGGGGTGTCTGTCTCCAGAGGGGAGGGACAAATCCCCTACTG 1201 GGGCCATTTCAATGGGGTAGTTTTTGGATTTTTTTCCCCACTCACTTTTTATTTTTTAATGATAATGGAGATGTCTGGAC 1281 CCTTCCTCACCCCACCTGTCGGTCTTGTCCTGGCTCTGCCTGTCCCCCACCGTTGTTCTCGTAGGTGAACCCCAGGTCCT 1361 CAACTCCCCCCCTTTATGTGTTGAAAGTTAATGGTTTCAGATGTGAACATCACGTGTTATAACTGTAGCGCTGTAAATTT 1441 TTTTGTGGGAGGGTGGGCAGGGAGGGGTCCCAGAGGGTAGAGCTCAAGGATTTTGGGTTTTGTTTTGTTTTCATTTTTCC 1521 AAAAAAAAAAGAAAAAAAAATAGAAAAAAAAGGAGTAAAAGGGGCGGGTTTGTTTTTTGAAGAACTGTCTTGGATACCTA 1601 TTTAAATGTGTGTTCTGTTTTGTTTTTTAACGATTTTTAAATAACGTCTGTGCCTCCACTGGTTGAGGGTGGAACCTCCA 1681 GGCAGGAACCGGCTCGCCACCCTCTGCCCGGTAAGGGCTGCCCAAGAAAGCATTACCCGCCCTCGGGGGGTCGGGCTGTG 1761 GGGGTCCCGGCACCTGGCGTGAGTTTCATGTATGAAAACATAAAATTGAAAAAAAAAAAAAAACCTACACGAGCACCGTG 1841 ATTTCAAGTAATAAACAGAAAATGAAACACAAAAAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control
PAR-CLIP data was present in GSM545213. RNA binding protein: AGO2. Condition:Control
PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control
PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 90007.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
Experimental Support 3 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Disease | 90007.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
Experimental Support 4 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | C8166 , TZM-bl |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
Experimental Support 5 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | MCF7 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated
... - Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology. |
Article |
- Farazi TA; Ten Hoeve JJ; Brown M; et al. - Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
|
Experimental Support 6 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | Prostate Tissue |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRX1760583. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_A
... - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.). |
Article |
- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al. - Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
|
CLIP-seq Support 1 for dataset GSM714642 | |
---|---|
Method / RBP | HITS-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repA |
Location of target site | ENST00000591446.2 | 3UTR | UCGAUAUGUCAUUAUGCACUUUACAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM545212 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000591446.2 | 3UTR | GUCGAUAUGUCAUUAUGCACUUUACAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM545213 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000591446.2 | 3UTR | UCAUUAUGCACUUUACAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset GSM545214 | |
---|---|
Method / RBP | PAR-CLIP / AGO3 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000591446.2 | 3UTR | AUGUCGAUAUGUCAUUAUGCACUUUACAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 5 for dataset GSM545215 | |
---|---|
Method / RBP | PAR-CLIP / AGO4 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000591446.2 | 3UTR | UCAUUAUGCACUUUACA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 6 for dataset GSM545216 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-124 transfection |
Location of target site | ENST00000591446.2 | 3UTR | UUUUAAGUCAAAAAUGUCGAUAUGUCAUUAUGCACUUUACAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 7 for dataset GSM545217 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-7 transfection |
Location of target site | ENST00000591446.2 | 3UTR | AUGUCGAUAUGUCAUUAUGCACUUUACA |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 8 for dataset GSM714644 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repA |
Location of target site | ENST00000591446.2 | 3UTR | UCAAAAAUGUCGAUAUGUCAUUAUGCACUUUACAGAUG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 9 for dataset GSM714645 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repB |
Location of target site | ENST00000591446.2 | 3UTR | UCGAUAUGUCAUUAUGCACUUUACAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 10 for dataset GSM1065667 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_6 |
Location of target site | ENST00000591446.2 | 3UTR | UCAAAAAUGUCGAUAUGUCAUUAUGCACUUUACAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
CLIP-seq Support 11 for dataset GSM1065668 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_7 |
Location of target site | ENST00000591446.2 | 3UTR | UCGAUAUGUCAUUAUGCACUUUACAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
CLIP-seq Support 12 for dataset GSM1065669 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_8 |
Location of target site | ENST00000591446.2 | 3UTR | GUCGAUAUGUCAUUAUGCACUUUACAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
CLIP-seq Support 13 for dataset GSM1065670 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / 4-thiouridine, 3_ML_LG |
Location of target site | ENST00000591446.2 | 3UTR | UCGAUAUGUCAUUAUGCACUUUACAGAUGAGGGG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
CLIP-seq Support 14 for dataset SRR1045082 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | MCF7 / Untreated |
Location of target site | ENST00000591446.2 | 3UTR | UCGAUAUGUCAUUAUGCACUUUACAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 24398324 / SRX388831 |
CLIP-seq Viewer | Link |
CLIP-seq Support 15 for dataset GSM1462572 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | C8166 / C8166 NL4-3 |
Location of target site | ENST00000591446.2 | 3UTR | UCAUUAUGCACUUUACAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23592263 / GSE59944 |
CLIP-seq Viewer | Link |
CLIP-seq Support 16 for dataset GSM1462574 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | TZM-bl / TZM-bl ami BaL |
Location of target site | ENST00000591446.2 | 3UTR | UCAAAAAUGUCGAUAUGUCAUUAUGCACUUUACAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23592263 / GSE59944 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT150000 | MIDN | midnolin | 2 | 10 | ||||||||
MIRT330600 | ZWINT | ZW10 interacting kinetochore protein | 2 | 2 | ||||||||
MIRT358701 | SUB1 | SUB1 homolog, transcriptional regulator | 2 | 4 | ||||||||
MIRT362854 | EIF4H | eukaryotic translation initiation factor 4H | 2 | 2 | ||||||||
MIRT447215 | ATXN7 | ataxin 7 | 2 | 2 | ||||||||
MIRT466655 | TAF1D | TATA-box binding protein associated factor, RNA polymerase I subunit D | 2 | 6 | ||||||||
MIRT483979 | PANK1 | pantothenate kinase 1 | 2 | 8 | ||||||||
MIRT485118 | SF3B3 | splicing factor 3b subunit 3 | 2 | 2 | ||||||||
MIRT488864 | AUTS8 | Autism, susceptibility to, 8 | 2 | 2 | ||||||||
MIRT492293 | SH2B3 | SH2B adaptor protein 3 | 2 | 2 | ||||||||
MIRT492976 | NCK2 | NCK adaptor protein 2 | 2 | 2 | ||||||||
MIRT497410 | LRRC40 | leucine rich repeat containing 40 | 2 | 2 | ||||||||
MIRT511143 | MRPL17 | mitochondrial ribosomal protein L17 | 2 | 6 | ||||||||
MIRT512650 | MAP3K2 | mitogen-activated protein kinase kinase kinase 2 | 2 | 2 | ||||||||
MIRT513017 | NSFL1C | NSFL1 cofactor | 2 | 6 | ||||||||
MIRT520445 | TSPAN2 | tetraspanin 2 | 2 | 6 | ||||||||
MIRT527995 | NDNF | neuron derived neurotrophic factor | 2 | 2 | ||||||||
MIRT528667 | PDE4DIP | phosphodiesterase 4D interacting protein | 2 | 2 | ||||||||
MIRT533512 | TRIM71 | tripartite motif containing 71 | 2 | 2 | ||||||||
MIRT537404 | FBXO47 | F-box protein 47 | 2 | 2 | ||||||||
MIRT538161 | DCP2 | decapping mRNA 2 | 2 | 2 | ||||||||
MIRT539124 | ARHGEF17 | Rho guanine nucleotide exchange factor 17 | 2 | 2 | ||||||||
MIRT540666 | MIS18A | MIS18 kinetochore protein A | 2 | 4 | ||||||||
MIRT542948 | GDF11 | growth differentiation factor 11 | 2 | 2 | ||||||||
MIRT547534 | MAML3 | mastermind like transcriptional coactivator 3 | 2 | 2 | ||||||||
MIRT559033 | C20orf24 | chromosome 20 open reading frame 24 | 2 | 4 | ||||||||
MIRT559554 | ARF6 | ADP ribosylation factor 6 | 2 | 2 | ||||||||
MIRT570177 | RCBTB1 | RCC1 and BTB domain containing protein 1 | 2 | 2 | ||||||||
MIRT573149 | ITGA9 | integrin subunit alpha 9 | 2 | 2 | ||||||||
MIRT575849 | Rab1 | RAB1A, member RAS oncogene family | 1 | 1 | ||||||||
MIRT611034 | RRP1B | ribosomal RNA processing 1B | 2 | 2 | ||||||||
MIRT616281 | HMGB1 | high mobility group box 1 | 2 | 2 | ||||||||
MIRT618372 | PRKG2 | protein kinase, cGMP-dependent, type II | 2 | 2 | ||||||||
MIRT619540 | PIWIL2 | piwi like RNA-mediated gene silencing 2 | 2 | 2 | ||||||||
MIRT622303 | SGIP1 | SH3 domain GRB2 like endophilin interacting protein 1 | 2 | 2 | ||||||||
MIRT622590 | PRRG4 | proline rich and Gla domain 4 | 2 | 2 | ||||||||
MIRT624441 | CAMK2N1 | calcium/calmodulin dependent protein kinase II inhibitor 1 | 2 | 2 | ||||||||
MIRT637089 | KLRD1 | killer cell lectin like receptor D1 | 2 | 2 | ||||||||
MIRT639084 | ADCYAP1 | adenylate cyclase activating polypeptide 1 | 2 | 2 | ||||||||
MIRT639334 | NINJ1 | ninjurin 1 | 2 | 2 | ||||||||
MIRT639798 | EIF3E | eukaryotic translation initiation factor 3 subunit E | 2 | 2 | ||||||||
MIRT640851 | RAB3B | RAB3B, member RAS oncogene family | 2 | 2 | ||||||||
MIRT641628 | KIAA1244 | ARFGEF family member 3 | 1 | 1 | ||||||||
MIRT642634 | EPPIN | epididymal peptidase inhibitor | 2 | 2 | ||||||||
MIRT643053 | EPPIN-WFDC6 | EPPIN-WFDC6 readthrough | 2 | 2 | ||||||||
MIRT643416 | ERVMER34-1 | endogenous retrovirus group MER34 member 1, envelope | 2 | 2 | ||||||||
MIRT645586 | SAR1A | secretion associated Ras related GTPase 1A | 2 | 2 | ||||||||
MIRT647393 | FAM181B | family with sequence similarity 181 member B | 2 | 2 | ||||||||
MIRT649411 | CDC14B | cell division cycle 14B | 2 | 2 | ||||||||
MIRT649477 | CLDN16 | claudin 16 | 2 | 2 | ||||||||
MIRT651307 | ZDHHC20 | zinc finger DHHC-type containing 20 | 2 | 2 | ||||||||
MIRT651387 | ZBTB16 | zinc finger and BTB domain containing 16 | 2 | 2 | ||||||||
MIRT653411 | SLC7A2 | solute carrier family 7 member 2 | 2 | 2 | ||||||||
MIRT654084 | RSPH4A | radial spoke head 4 homolog A | 2 | 2 | ||||||||
MIRT654613 | PTPRM | protein tyrosine phosphatase, receptor type M | 2 | 2 | ||||||||
MIRT655338 | PCP4L1 | Purkinje cell protein 4 like 1 | 2 | 2 | ||||||||
MIRT656173 | MRPL44 | mitochondrial ribosomal protein L44 | 2 | 2 | ||||||||
MIRT657272 | HS3ST3B1 | heparan sulfate-glucosamine 3-sulfotransferase 3B1 | 2 | 2 | ||||||||
MIRT657881 | GFPT1 | glutamine--fructose-6-phosphate transaminase 1 | 2 | 2 | ||||||||
MIRT659875 | CAPRIN1 | cell cycle associated protein 1 | 2 | 2 | ||||||||
MIRT662381 | ICA1L | islet cell autoantigen 1 like | 2 | 4 | ||||||||
MIRT666308 | SLC22A3 | solute carrier family 22 member 3 | 2 | 2 | ||||||||
MIRT667274 | NAV1 | neuron navigator 1 | 2 | 2 | ||||||||
MIRT667614 | LIMCH1 | LIM and calponin homology domains 1 | 2 | 2 | ||||||||
MIRT674242 | NUP62 | nucleoporin 62 | 2 | 4 | ||||||||
MIRT690386 | PARP15 | poly(ADP-ribose) polymerase family member 15 | 2 | 2 | ||||||||
MIRT693402 | NUDT16 | nudix hydrolase 16 | 2 | 2 | ||||||||
MIRT702503 | KDELR1 | KDEL endoplasmic reticulum protein retention receptor 1 | 2 | 2 | ||||||||
MIRT708632 | STMN4 | stathmin 4 | 2 | 2 | ||||||||
MIRT708839 | SCAND3 | zinc finger BED-type containing 9 | 1 | 1 | ||||||||
MIRT709016 | HSBP1 | heat shock factor binding protein 1 | 2 | 2 | ||||||||
MIRT709235 | RANGAP1 | Ran GTPase activating protein 1 | 2 | 2 | ||||||||
MIRT710885 | PARL | presenilin associated rhomboid like | 2 | 2 | ||||||||
MIRT712262 | PPP1CB | protein phosphatase 1 catalytic subunit beta | 2 | 2 | ||||||||
MIRT712573 | ATP2B4 | ATPase plasma membrane Ca2+ transporting 4 | 2 | 2 | ||||||||
MIRT715046 | PRPF38A | pre-mRNA processing factor 38A | 2 | 2 | ||||||||
MIRT718905 | GALR1 | galanin receptor 1 | 2 | 2 | ||||||||
MIRT719368 | FEM1A | fem-1 homolog A | 2 | 2 | ||||||||
MIRT719495 | SEC24B | SEC24 homolog B, COPII coat complex component | 2 | 2 | ||||||||
MIRT719601 | PRKX | protein kinase, X-linked | 2 | 2 | ||||||||
MIRT719891 | RRP36 | ribosomal RNA processing 36 | 2 | 2 | ||||||||
MIRT720063 | ZNF449 | zinc finger protein 449 | 2 | 2 | ||||||||
MIRT721679 | CMTM4 | CKLF like MARVEL transmembrane domain containing 4 | 2 | 2 | ||||||||
MIRT721724 | VTI1A | vesicle transport through interaction with t-SNAREs 1A | 2 | 2 | ||||||||
MIRT723370 | ZNF470 | zinc finger protein 470 | 2 | 2 | ||||||||
MIRT724941 | TXNL1 | thioredoxin like 1 | 2 | 2 | ||||||||
MIRT725302 | NLRC5 | NLR family CARD domain containing 5 | 2 | 2 |
miRNA-Drug Associations | |||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|