miRTarBase - #MIRT165198


—
pre-miRNA Information
pre-miRNA hsa-mir-548g   
Genomic Coordinates chr4: 147344629 - 147344717
Synonyms MIRN548G, hsa-mir-548g, MIR548G
Description Homo sapiens miR-548g stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-548g-5p
Sequence 15| UGCAAAAGUAAUUGCAGUUUUUG |37
Evidence Not_experimental
Experiments
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 4 - 147344700 29233923 MiREDiBase
A-to-I 7 4 - 147344697 29233923 MiREDiBase
A-to-I 16 4 - 147344688 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1428532945 1 dbSNP
rs749197968 2 dbSNP
rs1271780804 3 dbSNP
rs375562730 4 dbSNP
rs1340837915 12 dbSNP
rs1222552086 20 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol GRAMD3
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HeLa
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in Chi_124B_2A8_130_50. RNA binding protein: AGO. Condition:HeLa cell miR-124 + B ...

- Chi SW; Zang JB; Mele A; Darnell RB, 2009, Nature.

Article - Chi SW; Zang JB; Mele A; Darnell RB
- Nature, 2009
MicroRNAs (miRNAs) have critical roles in the regulation of gene expression; however, as miRNA activity requires base pairing with only 6-8 nucleotides of messenger RNA, predicting target mRNAs is a major challenge. Recently, high-throughput sequencing of RNAs isolated by crosslinking immunoprecipitation (HITS-CLIP) has identified functional protein-RNA interaction sites. Here we use HITS-CLIP to covalently crosslink native argonaute (Ago, also called Eif2c) protein-RNA complexes in mouse brain. This produced two simultaneous data sets-Ago-miRNA and Ago-mRNA binding sites-that were combined with bioinformatic analysis to identify interaction sites between miRNA and target mRNA. We validated genome-wide interaction maps for miR-124, and generated additional maps for the 20 most abundant miRNAs present in P13 mouse brain. Ago HITS-CLIP provides a general platform for exploring the specificity and range of miRNA action in vivo, and identifies precise sequences for targeting clinically relevant miRNA-mRNA interactions.
LinkOut: [PMID: 19536157]
CLIP-seq Support 1 for dataset Chi_124B_2A8_130_50
Method / RBP HITS-CLIP / AGO
Cell line / Condition HeLa / HeLa cell miR-124 + B
Location of target site ENST00000285689.3 | 3UTR | GGAAGAUUUUGCUGCUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 19536157 / Chi_HITSCLIP
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
249 hsa-miR-548g-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT057504 CEP55 centrosomal protein 55 2 4
MIRT060829 CEP350 centrosomal protein 350 2 4
MIRT062719 MLEC malectin 2 4
MIRT064766 CCND2 cyclin D2 2 8
MIRT075336 SF3B3 splicing factor 3b subunit 3 2 2
MIRT080205 PRKACB protein kinase cAMP-activated catalytic subunit beta 2 2
MIRT080236 SMAD4 SMAD family member 4 2 6
MIRT087395 AGFG1 ArfGAP with FG repeats 1 2 4
MIRT088228 GRAMD4 GRAM domain containing 4 2 2
MIRT089490 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 6
MIRT091222 USP13 ubiquitin specific peptidase 13 2 2
MIRT092959 CYP2U1 cytochrome P450 family 2 subfamily U member 1 2 4
MIRT094091 PAICS phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase 2 4
MIRT097469 PAPD4 poly(A) RNA polymerase D4, non-canonical 2 2
MIRT102252 HBP1 HMG-box transcription factor 1 2 4
MIRT105440 ATP6V1B2 ATPase H+ transporting V1 subunit B2 2 10
MIRT107286 FAM73B mitoguardin 2 2 2
MIRT113584 ZDHHC18 zinc finger DHHC-type containing 18 2 2
MIRT113886 KPNA6 karyopherin subunit alpha 6 2 6
MIRT126457 ARL5B ADP ribosylation factor like GTPase 5B 2 2
MIRT135023 ADSS adenylosuccinate synthase 2 6
MIRT139889 BTF3L4 basic transcription factor 3 like 4 2 6
MIRT149702 LDLR low density lipoprotein receptor 2 2
MIRT163230 EDEM1 ER degradation enhancing alpha-mannosidase like protein 1 2 2
MIRT165198 GRAMD3 GRAM domain containing 2B 2 2
MIRT172169 FZD6 frizzled class receptor 6 2 8
MIRT177396 ZMYND11 zinc finger MYND-type containing 11 2 2
MIRT179427 TBRG1 transforming growth factor beta regulator 1 2 6
MIRT195617 FAM195A MAPK regulated corepressor interacting protein 2 2 6
MIRT208727 MED12L mediator complex subunit 12 like 2 6
MIRT211508 ELMOD2 ELMO domain containing 2 2 2
MIRT213434 MOB1B MOB kinase activator 1B 2 6
MIRT240121 NDRG1 N-myc downstream regulated 1 2 2
MIRT243102 LCLAT1 lysocardiolipin acyltransferase 1 2 4
MIRT247387 HCFC2 host cell factor C2 2 4
MIRT248057 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT249457 ZNF691 zinc finger protein 691 2 4
MIRT253421 EVI5L ecotropic viral integration site 5 like 2 2
MIRT254148 ETS2 ETS proto-oncogene 2, transcription factor 2 2
MIRT258906 LAPTM4B lysosomal protein transmembrane 4 beta 2 4
MIRT259391 SLC6A8 solute carrier family 6 member 8 2 4
MIRT266966 LRRC55 leucine rich repeat containing 55 2 4
MIRT279001 GMFB glia maturation factor beta 2 10
MIRT288802 KCNJ2 potassium voltage-gated channel subfamily J member 2 2 2
MIRT325678 ZNF367 zinc finger protein 367 2 2
MIRT330543 HNRNPF heterogeneous nuclear ribonucleoprotein F 2 4
MIRT334269 RCC2 regulator of chromosome condensation 2 2 2
MIRT350225 PRNP prion protein 2 2
MIRT400510 SKIL SKI like proto-oncogene 2 10
MIRT405635 WBP4 WW domain binding protein 4 2 4
MIRT408651 QKI QKI, KH domain containing RNA binding 2 2
MIRT444161 ZNF701 zinc finger protein 701 2 2
MIRT444509 ZNF525 zinc finger protein 525 2 2
MIRT445209 CRYBG3 crystallin beta-gamma domain containing 3 2 2
MIRT446844 FOXP1 forkhead box P1 2 2
MIRT449026 ADRB1 adrenoceptor beta 1 2 2
MIRT450746 POLI DNA polymerase iota 2 4
MIRT450793 OTUD7A OTU deubiquitinase 7A 2 2
MIRT454916 ANKEF1 ankyrin repeat and EF-hand domain containing 1 2 12
MIRT455266 DDX39B DExD-box helicase 39B 2 10
MIRT455715 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 2 2
MIRT456098 MB21D1 Mab-21 domain containing 1 2 6
MIRT463635 YY1 YY1 transcription factor 2 8
MIRT463891 WNT7B Wnt family member 7B 2 2
MIRT466262 TMBIM6 transmembrane BAX inhibitor motif containing 6 2 4
MIRT466820 STX6 syntaxin 6 2 6
MIRT466879 STX16 syntaxin 16 2 2
MIRT467524 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 2 6
MIRT468199 SGK1 serum/glucocorticoid regulated kinase 1 2 2
MIRT468633 SELT selenoprotein T 2 2
MIRT470367 PPP2R5E protein phosphatase 2 regulatory subunit B'epsilon 2 2
MIRT470998 PITPNA phosphatidylinositol transfer protein alpha 2 2
MIRT471559 PATL1 PAT1 homolog 1, processing body mRNA decay factor 2 6
MIRT472277 NFIB nuclear factor I B 2 4
MIRT472758 MTMR6 myotubularin related protein 6 2 8
MIRT474719 KIF13A kinesin family member 13A 2 6
MIRT475869 H3F3C H3 histone family member 3C 2 10
MIRT475903 H3F3B H3 histone family member 3B 2 8
MIRT477350 EOGT EGF domain specific O-linked N-acetylglucosamine transferase 2 4
MIRT477486 ELL2 elongation factor for RNA polymerase II 2 2 2
MIRT478096 DLG5 discs large MAGUK scaffold protein 5 2 6
MIRT479805 CCNA2 cyclin A2 2 6
MIRT480813 BLCAP bladder cancer associated protein 2 10
MIRT481947 ANKRD11 ankyrin repeat domain 11 2 2
MIRT483060 EXT2 exostosin glycosyltransferase 2 2 6
MIRT484143 LRRC45 leucine rich repeat containing 45 2 4
MIRT484904 ZFYVE26 zinc finger FYVE-type containing 26 2 4
MIRT485080 SOX4 SRY-box 4 2 10
MIRT485639 DICER1 dicer 1, ribonuclease III 2 4
MIRT485798 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT486271 SEC23A Sec23 homolog A, coat complex II component 2 2
MIRT486740 CNOT4 CCR4-NOT transcription complex subunit 4 2 6
MIRT487167 LFNG LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase 2 2
MIRT491642 PDRG1 p53 and DNA damage regulated 1 2 10
MIRT491934 WDR45B WD repeat domain 45B 2 8
MIRT492232 SLC48A1 solute carrier family 48 member 1 2 2
MIRT493089 MMGT1 membrane magnesium transporter 1 2 12
MIRT494479 BRWD3 bromodomain and WD repeat domain containing 3 2 2
MIRT494986 ROCK1 Rho associated coiled-coil containing protein kinase 1 2 2
MIRT495671 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 2
MIRT498467 PTBP2 polypyrimidine tract binding protein 2 2 10
MIRT499268 NBPF11 NBPF member 11 2 2
MIRT499855 SVOP SV2 related protein 2 12
MIRT500307 ZNF622 zinc finger protein 622 2 8
MIRT500640 TUBB2A tubulin beta 2A class IIa 2 8
MIRT501222 SEMA4C semaphorin 4C 2 6
MIRT501526 PPP1R15B protein phosphatase 1 regulatory subunit 15B 2 8
MIRT501569 PLEKHF2 pleckstrin homology and FYVE domain containing 2 2 4
MIRT502430 G3BP2 G3BP stress granule assembly factor 2 2 10
MIRT502967 CCNL1 cyclin L1 2 8
MIRT503470 ZNF154 zinc finger protein 154 2 6
MIRT504572 ERCC4 ERCC excision repair 4, endonuclease catalytic subunit 2 4
MIRT504956 ZNRF2 zinc and ring finger 2 2 6
MIRT505206 UBN2 ubinuclein 2 2 8
MIRT505238 UBE2D3 ubiquitin conjugating enzyme E2 D3 2 2
MIRT507570 DEK DEK proto-oncogene 2 2
MIRT509412 MCM7 minichromosome maintenance complex component 7 2 6
MIRT510715 SPG20 spartin 2 6
MIRT510859 RAN RAN, member RAS oncogene family 2 8
MIRT510914 PSMA2 proteasome subunit alpha 2 2 4
MIRT510944 PPTC7 PTC7 protein phosphatase homolog 2 8
MIRT511072 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 2 4
MIRT511213 LNPEP leucyl and cystinyl aminopeptidase 2 4
MIRT511959 ELOVL5 ELOVL fatty acid elongase 5 2 6
MIRT512123 CREBL2 cAMP responsive element binding protein like 2 2 8
MIRT513686 RNF111 ring finger protein 111 2 2
MIRT513896 GRB10 growth factor receptor bound protein 10 2 6
MIRT516305 F8A2 coagulation factor VIII associated 2 2 2
MIRT516331 F8A3 coagulation factor VIII associated 3 2 2
MIRT517521 ITM2C integral membrane protein 2C 2 6
MIRT517930 IMPA1 inositol monophosphatase 1 2 2
MIRT521368 RNF11 ring finger protein 11 2 6
MIRT525192 ZNF93 zinc finger protein 93 2 2
MIRT527216 CCNL2 cyclin L2 2 2
MIRT527835 NUPL1 nucleoporin 58 2 2
MIRT529433 MALT1 MALT1 paracaspase 2 2
MIRT530166 C11orf44 chromosome 11 open reading frame 44 2 4
MIRT530515 C4orf32 family with sequence similarity 241 member A 2 4
MIRT532372 LINC00598 long intergenic non-protein coding RNA 598 2 2
MIRT533855 TEAD1 TEA domain transcription factor 1 2 2
MIRT534750 RAVER2 ribonucleoprotein, PTB binding 2 2 4
MIRT534795 RAB8B RAB8B, member RAS oncogene family 2 2
MIRT538602 CDK19 cyclin dependent kinase 19 2 2
MIRT539247 ANKRD50 ankyrin repeat domain 50 2 2
MIRT539467 ADARB2 adenosine deaminase, RNA specific B2 (inactive) 2 2
MIRT543100 TNFRSF11A TNF receptor superfamily member 11a 2 2
MIRT543897 ESYT1 extended synaptotagmin 1 2 2
MIRT544980 MFF mitochondrial fission factor 2 4
MIRT545794 ZNF772 zinc finger protein 772 2 4
MIRT546009 WDR26 WD repeat domain 26 2 4
MIRT546378 STOX2 storkhead box 2 2 4
MIRT546681 RORA RAR related orphan receptor A 2 4
MIRT546947 SFTPA1 surfactant protein A1 2 2
MIRT547034 POGZ pogo transposable element derived with ZNF domain 2 2
MIRT547397 MKX mohawk homeobox 2 2
MIRT547470 MBNL3 muscleblind like splicing regulator 3 2 4
MIRT547501 MBNL1 muscleblind like splicing regulator 1 2 4
MIRT548077 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT548500 E2F8 E2F transcription factor 8 2 2
MIRT548883 CHEK2 checkpoint kinase 2 2 4
MIRT549063 CALM1 calmodulin 1 2 2
MIRT549166 BMP3 bone morphogenetic protein 3 2 2
MIRT549310 ARHGAP12 Rho GTPase activating protein 12 2 4
MIRT549345 ARC activity regulated cytoskeleton associated protein 2 2
MIRT549475 ACBD5 acyl-CoA binding domain containing 5 2 2
MIRT549678 ZNF598 zinc finger protein 598 2 2
MIRT550209 MAVS mitochondrial antiviral signaling protein 2 4
MIRT550356 INCENP inner centromere protein 2 4
MIRT550531 MYZAP myocardial zonula adherens protein 2 2
MIRT551156 ZNF678 zinc finger protein 678 2 2
MIRT552311 ZXDA zinc finger, X-linked, duplicated A 2 4
MIRT552880 WASL Wiskott-Aldrich syndrome like 2 4
MIRT553383 TRIM33 tripartite motif containing 33 2 2
MIRT554453 SAMD8 sterile alpha motif domain containing 8 2 2
MIRT554868 RCAN2 regulator of calcineurin 2 2 2
MIRT556022 MYBL1 MYB proto-oncogene like 1 2 2
MIRT556175 MCC mutated in colorectal cancers 2 2
MIRT556238 MARCKS myristoylated alanine rich protein kinase C substrate 2 2
MIRT556878 ITGA2 integrin subunit alpha 2 2 2
MIRT557575 GNPTAB N-acetylglucosamine-1-phosphate transferase alpha and beta subunits 2 2
MIRT557690 GATA6 GATA binding protein 6 2 2
MIRT557906 FBXO8 F-box protein 8 2 2
MIRT558132 ENPP4 ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative) 2 2
MIRT558481 DBN1 drebrin 1 2 2
MIRT558744 CHIC1 cysteine rich hydrophobic domain 1 2 2
MIRT558760 CFL2 cofilin 2 2 2
MIRT559122 C11orf57 chromosome 11 open reading frame 57 2 2
MIRT559406 GDNF glial cell derived neurotrophic factor 2 4
MIRT559476 ARL8A ADP ribosylation factor like GTPase 8A 2 2
MIRT559677 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT560049 ZNF680 zinc finger protein 680 2 2
MIRT560643 ZNF107 zinc finger protein 107 2 2
MIRT562581 CBX3 chromobox 3 2 2
MIRT564188 CLVS2 clavesin 2 2 2
MIRT564530 SNRPD3 small nuclear ribonucleoprotein D3 polypeptide 2 2
MIRT564540 CCDC80 coiled-coil domain containing 80 2 2
MIRT565290 TMPPE transmembrane protein with metallophosphoesterase domain 2 2
MIRT565315 TMEM41A transmembrane protein 41A 2 2
MIRT565950 RRAGD Ras related GTP binding D 2 2
MIRT566633 NFYA nuclear transcription factor Y subunit alpha 2 4
MIRT566818 MAPK8 mitogen-activated protein kinase 8 2 2
MIRT567529 FGFR1OP FGFR1 oncogene partner 2 2
MIRT568631 ACVR2A activin A receptor type 2A 2 2
MIRT572141 DESI1 desumoylating isopeptidase 1 2 2
MIRT616029 TMTC1 transmembrane and tetratricopeptide repeat containing 1 2 4
MIRT620048 ODF4 outer dense fiber of sperm tails 4 2 2
MIRT620531 AVPR1A arginine vasopressin receptor 1A 2 2
MIRT621878 TAOK3 TAO kinase 3 2 2
MIRT623242 MLLT6 MLLT6, PHD finger containing 2 2
MIRT623994 FAM104A family with sequence similarity 104 member A 2 2
MIRT624301 COL12A1 collagen type XII alpha 1 chain 2 2
MIRT626283 PEX26 peroxisomal biogenesis factor 26 2 2
MIRT627771 RAB30 RAB30, member RAS oncogene family 2 2
MIRT641139 ZBTB33 zinc finger and BTB domain containing 33 2 2
MIRT644587 SPOP speckle type BTB/POZ protein 2 2
MIRT644820 DNAJC21 DnaJ heat shock protein family (Hsp40) member C21 2 2
MIRT645971 NHLRC2 NHL repeat containing 2 2 2
MIRT646171 PTPN14 protein tyrosine phosphatase, non-receptor type 14 2 2
MIRT646496 ZNF429 zinc finger protein 429 2 2
MIRT647834 RAB23 RAB23, member RAS oncogene family 2 2
MIRT648463 CCDC127 coiled-coil domain containing 127 2 2
MIRT657281 HRK harakiri, BCL2 interacting protein 2 2
MIRT658644 ENAH ENAH, actin regulator 2 2
MIRT658677 EMP2 epithelial membrane protein 2 2 2
MIRT665229 ZZZ3 zinc finger ZZ-type containing 3 2 2
MIRT669277 C19orf44 chromosome 19 open reading frame 44 2 2
MIRT676048 AUTS8 Autism, susceptibility to, 8 2 2
MIRT681484 DIP2A disco interacting protein 2 homolog A 2 2
MIRT681555 UBXN2A UBX domain protein 2A 2 2
MIRT683143 MTHFD1 methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 2 2
MIRT688535 DCAF7 DDB1 and CUL4 associated factor 7 2 2
MIRT689429 CYB561 cytochrome b561 2 2
MIRT689535 KIAA0513 KIAA0513 2 2
MIRT689895 SOD2 superoxide dismutase 2 2 2
MIRT695990 SNX19 sorting nexin 19 2 2
MIRT697781 UBXN7 UBX domain protein 7 2 2
MIRT702915 CRAMP1L cramped chromatin regulator homolog 1 2 2
MIRT703145 GPR137C G protein-coupled receptor 137C 2 2
MIRT703525 FKBP15 FK506 binding protein 15 2 2
MIRT704537 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 2 2
MIRT704998 CAMSAP1 calmodulin regulated spectrin associated protein 1 2 2
MIRT705722 AMMECR1L AMMECR1 like 2 2
MIRT707121 NWD1 NACHT and WD repeat domain containing 1 2 2
MIRT707452 PPFIBP1 PPFIA binding protein 1 2 2
MIRT707776 WNK3 WNK lysine deficient protein kinase 3 2 2
MIRT707889 SLC30A7 solute carrier family 30 member 7 2 2
MIRT720532 CHERP calcium homeostasis endoplasmic reticulum protein 2 2
MIRT723860 CD209 CD209 molecule 2 2
MIRT725350 MUC21 mucin 21, cell surface associated 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-548g Cisplatin 5460033 NSC119875 approved resistant cell line (OE19)
hsa-mir-548g Docetaxel+Cisplatin+5-Fluorouracil sensitive tissue (hypopharyngeal squamous cell carcinoma)

Error report submission