| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-1470 |
| Genomic Coordinates | chr19: 15449548 - 15449608 |
| Synonyms | MIRN1470, hsa-mir-1470, MIR1470 |
| Description | Homo sapiens miR-1470 stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Mature miRNA Information | ||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-1470 | |||||||||||||||||||||||||||
| Sequence | 1| GCCCUCCGCCCGUGCACCCCG |21 | |||||||||||||||||||||||||||
| Evidence | Experimental | |||||||||||||||||||||||||||
| Experiments | Cloned | |||||||||||||||||||||||||||
| SNPs in miRNA |
|
|||||||||||||||||||||||||||
| Putative Targets | ||||||||||||||||||||||||||||
| miRNA Expression profile | |
|---|---|
| Human miRNA Tissue Atlas | |
| Circulating MicroRNA Expression Profiling | |
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | NSD1 | ||||||||||||||||||||
| Synonyms | ARA267, KMT3B, SOTOS, SOTOS1, STO | ||||||||||||||||||||
| Description | nuclear receptor binding SET domain protein 1 | ||||||||||||||||||||
| Transcript | NM_022455 | ||||||||||||||||||||
| Other Transcripts | NM_172349 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on NSD1 | |||||||||||||||||||||
| 3'UTR of NSD1 (miRNA target sites are highlighted) |
>NSD1|NM_022455|3'UTR 1 TACCAATCAATGTCACATGAACAAACAAGCTGCCCCCAGGGTACCATTTGGGGAGGGGAAATCTTTTCTTTCTTTCCCCC 81 TTAAAAAAAAACACATCTGCCCCGAACACTTTCCCACTGTTATTCTTTCCTCATATCCCAACACTCAGAACTCTTGTGAC 161 ATTAGCCAGTGGGGGCTTATGGTTGTGTGAACCATGTATGAAAATCCAGTGGGCCCCAACCAAGGAGACAGACAGACTTG 241 GGTCTCTTTCCCCCAACTTTTCCACATGGTCATCGTGAAATAAAAAGTCCACTCTGGAGTCAAGTATGGAATTCAATTCC 321 GCTGGTCAGGTTGGAAGGTATAGGGGCTCTCAAAGCGATTTCCCCAACCAGACAGAGCCCCATTGAGGGCACCTAGGAAC 401 CCTTGGGAGGAAATGGTGTTCTTTCAAATCAGTGGCGATTTCCTGAGCATTCACGTGTTCTAGGCCGGGTGCTAGTCACT 481 GATGAGAGATACAGGCCTCATCCCTGTGAGCCTGGATTCCAAGGCTTTCAGGAACCTTTGACCAGGAAGTAACAGGAAGT 561 TCTGAGGGGCCCTGGGGCTTTAGACTCATTTTGAAATGTCCTTTGTGGCACCAGAAGTGGTTGTGTTGAGGAAGTGTCTC 641 TTGGCTGCGGTGTGCATGGGTGCGTGTGCATGCGCGCACACTCACAGAGGTCTCCTCTATAGATGCAAGGGTGCTGCATT 721 GAGGCCAGCAAGGCTGTTGGCTGTGGGGTCGCCGCTGCTGCTTTTGTCTGGGCTGTGCAGAGTCTCAAGATCAGTCCTTG 801 GAGGAGCAGGTGGTCAGGGGCAGTCGGGCTCTGTGCGAATGTAGATTTCCAGCAGTGGAAGAAGGCATTTGGCAAGCTTC 881 TCTTTCTTTGCTTTTGTTTCTACCTATTTTTCTCTTTGTACATGAATCCACCCCATCCCTATTTCCCTAAAACACTCAGG 961 TGCTTTCAGATTTCAGAGCCTCGGGCAGTGGACATAGGGAATCTCTGGCAAGCTCTGAGCTAGACACACCAGCTTCAGGA 1041 AGAGTACCAGATCCTGATGGGAAATTTCTTTTCCCCATTCCTTTTCCCTCCTGAGTGGAGGGAGTCCTCTTCTTCGCCTC 1121 CCTGAGAATTGCTGTGCTCTGTATTGAGAGCACCTGCCTGCTGACTTAGCTCAAAGGCAAGCCAGAACCCTTCCCTGAAG 1201 ACTGGCAAGAGGTGGTGTTTAGAGCAACGTCCAGGCTAAGAGATGACTCCTATTAACTGCTGATTATCTGTTACTGCTGC 1281 CCTGAGCTGGGGCCCAAGGGCTGGGAAATCTGTTGGTGCTACCCTGCCCTACCATTCACCCAGCTCACAGACTGCCAACA 1361 GGAAGTGCTGTTTGGCTAGTTTCCTCCCACTTGTCTACCCCTCCTTTGTCCTTAGACCAACATGTTTACCTCTCTGCTTT 1441 GCCAACTTAGCCAGCAGGCCATCCCCGGCCCTAACGTCTCCTGGCCATTATCTCTTAGTTATGGCTTTCACGCTCTCAAT 1521 AGGATTCTGTATTTGGTCCCAATTTCCTCAAGTTCTTATTGAGGTTACTCCCATCAATTCCACGGAGGGAACAGTAGTTA 1601 TTATAGAAGCATTTGCGCTTTATCTAAAGATTAAAAATAGAATCTGCTTTTATTTCCCAAAGTCTGTCTCTGAGGTTGAG 1681 ACACTTGAACTCAGGCAGAGGGACGAGGCTGGGCAGGGCTGTCCTGAGTTTAGGGGCCTATCCCTGCATTTCACTGAGAC 1761 CTCGGAATCTCCTCTGTGAATTCCACCTGCCTAGTTCTCCCCTTTCATCCTCTCTCTCTTCCCACATCATCAAAGAGGAA 1841 AAGCTCTTTGTTCAAAAGGAAGAGAAAACGTAAAGCATCTTATTTTCTTTTAAAAGAATTTTAAACCATGAAAAAGATAT 1921 TTTTAAAGAAATTCACCGAGAACATTAAAGTTCATTATATTAAGTATTTATCATGTGTGAGAATAATAAATATATAACTG 2001 CAGCTAGTAGGTCCCTTTCCCTAATCTTTTAGGTCATATGAGTAGGGTTTGCTTGGTGCCAGTCCTGTGCCCTTTTCTCT 2081 CCAGTCATCTGTAGTTGTGATCAGAAAAAGGTATCTGCACTGCACTGTCAGAGTCTCCTTTCACTATGTTGTGTGTTAAA 2161 TTACCGTAGCTCTTTGTTTCATGAAATAAACTGTGAATTTGGGGGGGGCGGGGGGAGGGCGTGCAGGCCATGTAAAAATT 2241 TTCCGTGGAGAAGTTTGATTCTAAAGTAGCTTCTCTAAAGTAGGCTTTGGTAGGTAATCAACTTGACAGCAGTCTAGATG 2321 TCTCACAGGACAGGAGGGAGTGAGGGAAAGGGGCCATGATTGGCTGCTTTGTGGTTTTATTTTGGTTCTTTCCATTCTCC 2401 GCCATTCATTGGAGGCTTCGTTCCAGACCTGCCTGGGAAAACAGCTTCTGAGCCATTTTGGGGAGCAGTTCTTCATCTGA 2481 ATGGATGGACATCTGGGCTTCCTTCAAGGGCCATTGAATGGGAACTAGAAAACCACTGGAAACTAGAAATTTGAGCTATT 2561 GGGCCCACCAGTAGCAGCATGTGATACTAGATGGTTAAAATCATGAAAGCAGTCACTATCCAATTAGAAGCAGAGTCACA 2641 ACAACTGTTGGGAAATGTGACTCTTGGAGGAAGGTGGGGAGGGAGTGGCCTTGCCAGCCCTGTGGGACGTCCCCTGAAGT 2721 TTGTAATAAGACCCCTTTTCCAAAGGGATGTGAATTGGAGTGAAAAGGAAATCTTTCATCTTAGAAAACTTCTGGTCCTT 2801 AACGCAGGGTGGTATTTGGGTATGTGCTTGGAAATTGAGATCTCAAGAGTGTTTGCCTTGGAGCCAGCTCCCCAGGAGGC 2881 CTTTTCCAGGGACAAGGCAAAAGTTGAAATTCTCCATGGGTAGCTAGAAAGCCAATACATCTAGCCCTGCTAAGTCAGAA 2961 AAAGATTATGAAAAATGTTGAAATTTACATTCAAAGCCTCATTTGCTTATCTTGCTGGAGCCAACCCAGTCTAATAGCAA 3041 AATAGCTGTCATTGATACAGAAACATCCTCATTTTTAAATGTCTGCTTTACCCTGTTACTGAGTTTGAGATGACTTAAAT 3121 CACTGTGTTGACCCTCTTCTGAACCAAATCTTTAGCATTGATGAAAATAGTTATTTTATTCTTTACATCCTTCACCCCAC 3201 ACTATGGTCAGGGCATGAAACACCCTGTTGATCCCTTCCCAGGCTCGGCACTGTCTGCTCACTGGAGCCGGACTCCCAGG 3281 TTGTAATTCTAATGTTGCCTCATGAGAACAGAATGGCAGAAAGTTTAGTCCTGACAGATTCCCCCATAGGGAGTAATGAG 3361 GACAGCATGAAACTTGGATAGGTTTTACCCTTAGTCCCTATAAGGTGGATTTTACTAAGGTTTTTTAAATGATACTGTCA 3441 TCCTCTTGGGGTTTATCAGCCAGGTTAGAGGAGCCCAGTGTCCTAACCTCTCTCAGATCATGGCAGAGAAGGAGCTGCCT 3521 CCAGCCCCTTTCTTGCTGAGTTTCATTTGAGCAGTTCCATGTGTAGACATTCCAAGTCACTGCTTGGTAGTTGCTGTGGG 3601 AGCCTGTCATTGGCTATGGCCAGTTAGTTCTCAGCTGAGCTTCCTAGGGCCAGTGCAACAGGGCCAGAGGCTGCTATAGT 3681 GTAAATTGAAATAAGAATAGATCATTGTTTTGTACACACACACAATAAAATGTAATGATGGTGCTAATTTCACGGTATAA 3761 ATAAGCACTGCCAAGGGTTGAGGGACTGGCAGCTCAAGAAACCCGGGTTCCTGTTTGGGAGGAGATTTTATGTAGAAAAG 3841 TTTGAGGCTTTGTTAAAAGTGGGGAGAAGGAAGATCCTCAGTGAAGCCTGCACCCAACCCTGGAGTGGCCCAGTGCAATC 3921 CAGAGGTGGAAGAGATCCTATATCCAGGTGAAGGTGGCCATTGAGTTTCTCAGGGCTGGGGCCACCTTGTCCATAGCCTC 4001 CGTCCACGCTGCCTGGAGCAGGTTGTTAGAGAGCTCTGGTTGTTGGGTCTTCCTCAGCTCCCTTCTGCCCCTCTCTACCT 4081 CTTCCACTCATGGAAGCCCCTCTACTGCTTATGAAGATTAAGGGTAGTATTTTCTAAGGAAGTGGAAAGAATTAAACTAG 4161 AAATCCACAACCTCGGAAGAAGTGTTTCGAGTTTAACATGCGCTGTTTCTGCTTATGTGGTTCCTTCTCTAGAGCTGCTT 4241 TCCCATGGCTTTCAAAACATCAGGTTATTGTGGGGCTTCAGGTGTAAGGTCCTGGAAGTTCAGCAAAGTTTCGTGGACAA 4321 GACATGGGCACAGAGAGTAGAAGCAGAAATAAATGGTTCTATGTTTTCAACTTCCAGGGTTGGGGCAGGCCAGAGCAAGG 4401 CGGTCTCATCGAGGTGGGTGCTACCTGTGTGTGTGTAGATGAGTGTGCTGAAGGTGGGGAGGGCAGCACACAGCAGCTCA 4481 TGGCAGAGCCGCCTCCTAGGTCTTGGCAAAGAGGCAAGCTGACGATAGACATCTACCTATATTGTTAAGAAAGGGGTCGG 4561 GGGGATCAGCCAAGGTCCATCATTGCTTTTTTGCCGCGCCCCCCCCCCCCCGCCCCCATAGATTGTCAGCTGTAAGTGAA 4641 ACTCCTAGTGAAAAAGAGGGGAGCCCTGTGTTAGGAGTCCCCATAAACATGTACTGTAATTCTTTGTATATAGAAAAAAA 4721 ATTTACTGTAAAGTAAAGTTTAACTTTACTCATAAAAAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control
PAR-CLIP data was present in GSM545213. RNA binding protein: AGO2. Condition:Control
PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control
PAR-CLIP data was present in GSM545215. RNA binding protein: AGO4. Condition:Control
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
| Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 64324.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
| Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | hESCs (WA-09) |
| Disease | 64324.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
| Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 64324.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
| Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
| Experimental Support 5 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HCT116 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in ERX177603. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_5
PAR-CLIP data was present in ERX177615. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_5
PAR-CLIP data was present in ERX177627. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_5
... - Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research. |
| Article |
- Krell J; Stebbing J; Carissimi C; Dabrowska et al. - Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
|
| Experimental Support 6 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | Prostate Tissue |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRX1760639. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_A
PAR-CLIP data was present in SRX1760641. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP-MDV_B
PAR-CLIP data was present in SRX1760632. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_C
PAR-CLIP data was present in SRX1760583. RNA binding protein: AGO2. Condition:AGO-CLIP-LNCaP_A
... - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.). |
| Article |
- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al. - Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
|
| CLIP-seq Support 1 for dataset GSM545212 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000439151.2 | 3UTR | UUGGAGGAAGGUGGGGAGG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM545213 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000439151.2 | 3UTR | UCUUGGAGGAAGGUGGGGAGG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM545214 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO3 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000439151.2 | 3UTR | UCUUGGAGGAAGGUGGGGAGG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset GSM545215 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO4 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000439151.2 | 3UTR | UCUUGGAGGAAGGUGGGGAGG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 5 for dataset GSM714645 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repB |
| Location of target site | ENST00000439151.2 | 3UTR | CUUGGAGGAAGGUGGGGAGGG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 6 for dataset SRR359787 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
| Location of target site | ENST00000439151.2 | 3UTR | UCUUGGAGGAAGGUGGGGAGGGAGUGGC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 22012620 / SRX103431 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 7 for dataset GSM1065668 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_7 |
| Location of target site | ENST00000439151.2 | 3UTR | CUUGGAGGAAGGUGGGGAGG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 8 for dataset GSM1065669 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_8 |
| Location of target site | ENST00000439151.2 | 3UTR | UCUUGGAGGAAGGUGGGGAGG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 9 for dataset GSM1065670 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / 4-thiouridine, 3_ML_LG |
| Location of target site | ENST00000439151.2 | 3UTR | UCUUGGAGGAAGGUGGGGAGG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||
|---|---|---|---|---|---|---|---|
|
183 hsa-miR-1470 Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT166093 | NSD1 | nuclear receptor binding SET domain protein 1 |  |
|
2 | 8 | ||||||
| MIRT280167 | AREL1 | apoptosis resistant E3 ubiquitin protein ligase 1 | |
|
2 | 2 | ||||||
| MIRT306044 | SKIL | SKI like proto-oncogene | |
|
2 | 10 | ||||||
| MIRT348286 | ZBTB7A | zinc finger and BTB domain containing 7A | |
|
2 | 2 | ||||||
| MIRT441956 | MAGEB10 | MAGE family member B10 | |
|
2 | 6 | ||||||
| MIRT471141 | PHF19 | PHD finger protein 19 | |
|
2 | 4 | ||||||
| MIRT489563 | PLD6 | phospholipase D family member 6 | |
|
2 | 2 | ||||||
| MIRT497435 | SEC63 | SEC63 homolog, protein translocation regulator | |
|
2 | 4 | ||||||
| MIRT526684 | CEP72 | centrosomal protein 72 | |
|
2 | 2 | ||||||
| MIRT527821 | TMEM74B | transmembrane protein 74B | |
|
2 | 2 | ||||||
| MIRT529286 | PDE4C | phosphodiesterase 4C | |
|
2 | 2 | ||||||
| MIRT531944 | AACS | acetoacetyl-CoA synthetase | |
|
2 | 2 | ||||||
| MIRT531988 | SLCO1B3 | solute carrier organic anion transporter family member 1B3 | |
|
2 | 2 | ||||||
| MIRT534822 | RAB30 | RAB30, member RAS oncogene family | |
|
2 | 2 | ||||||
| MIRT540296 | TMA16 | translation machinery associated 16 homolog | |
|
2 | 2 | ||||||
| MIRT547507 | MAZ | MYC associated zinc finger protein | |
|
2 | 2 | ||||||
| MIRT570901 | METTL21A | methyltransferase like 21A | |
|
2 | 2 | ||||||
| MIRT570971 | TMBIM4 | transmembrane BAX inhibitor motif containing 4 | |
|
2 | 2 | ||||||
| MIRT571176 | ZNF85 | zinc finger protein 85 | |
|
2 | 2 | ||||||
| MIRT572755 | FAM204A | family with sequence similarity 204 member A | |
|
2 | 2 | ||||||
| MIRT575267 | Timp3 | tissue inhibitor of metalloproteinase 3 | |
|
2 | 2 | ||||||
| MIRT609153 | PNMAL2 | paraneoplastic Ma antigen family member 8B | |
|
2 | 2 | ||||||
| MIRT609478 | LSAMP | limbic system-associated membrane protein | |
|
2 | 2 | ||||||
| MIRT610266 | LRRC47 | leucine rich repeat containing 47 | |
|
2 | 2 | ||||||
| MIRT610289 | PLCXD3 | phosphatidylinositol specific phospholipase C X domain containing 3 | |
|
2 | 2 | ||||||
| MIRT610351 | AGTRAP | angiotensin II receptor associated protein | |
|
2 | 2 | ||||||
| MIRT610397 | FOXE1 | forkhead box E1 | |
|
2 | 2 | ||||||
| MIRT611378 | KIF26A | kinesin family member 26A | |
|
2 | 2 | ||||||
| MIRT612512 | SH3PXD2A | SH3 and PX domains 2A | |
|
2 | 2 | ||||||
| MIRT612761 | MYOCD | myocardin | |
|
2 | 2 | ||||||
| MIRT613415 | CDH8 | cadherin 8 | |
|
2 | 2 | ||||||
| MIRT613704 | QPRT | quinolinate phosphoribosyltransferase | |
|
2 | 2 | ||||||
| MIRT613815 | ATP6AP1L | ATPase H+ transporting accessory protein 1 like | |
|
2 | 2 | ||||||
| MIRT614171 | MYO1F | myosin IF | |
|
2 | 2 | ||||||
| MIRT614215 | LENG9 | leukocyte receptor cluster member 9 | |
|
2 | 2 | ||||||
| MIRT614226 | TSKU | tsukushi, small leucine rich proteoglycan | |
|
2 | 2 | ||||||
| MIRT614498 | RHOB | ras homolog family member B | |
|
2 | 2 | ||||||
| MIRT614987 | GIPC1 | GIPC PDZ domain containing family member 1 | |
|
2 | 2 | ||||||
| MIRT615223 | ARSE | arylsulfatase E (chondrodysplasia punctata 1) | |
|
2 | 2 | ||||||
| MIRT615495 | SHB | SH2 domain containing adaptor protein B | |
|
2 | 2 | ||||||
| MIRT615507 | CNNM3 | cyclin and CBS domain divalent metal cation transport mediator 3 | |
|
2 | 2 | ||||||
| MIRT615537 | PHF1 | PHD finger protein 1 | |
|
2 | 2 | ||||||
| MIRT615551 | TNFSF15 | TNF superfamily member 15 | |
|
2 | 2 | ||||||
| MIRT615955 | SORD | sorbitol dehydrogenase | |
|
2 | 2 | ||||||
| MIRT616479 | MACC1 | MACC1, MET transcriptional regulator | |
|
2 | 2 | ||||||
| MIRT616668 | ST3GAL1 | ST3 beta-galactoside alpha-2,3-sialyltransferase 1 | |
|
2 | 2 | ||||||
| MIRT616743 | DCTN5 | dynactin subunit 5 | |
|
2 | 2 | ||||||
| MIRT616761 | SVOP | SV2 related protein | |
|
2 | 2 | ||||||
| MIRT616914 | LINC00598 | long intergenic non-protein coding RNA 598 | |
|
2 | 2 | ||||||
| MIRT617646 | RAB43 | RAB43, member RAS oncogene family | |
|
2 | 2 | ||||||
| MIRT617824 | EMX2 | empty spiracles homeobox 2 | |
|
2 | 2 | ||||||
| MIRT618518 | SELPLG | selectin P ligand | |
|
2 | 2 | ||||||
| MIRT618688 | DVL1 | dishevelled segment polarity protein 1 | |
|
2 | 2 | ||||||
| MIRT619465 | XRCC2 | X-ray repair cross complementing 2 | |
|
2 | 2 | ||||||
| MIRT619561 | GABRG2 | gamma-aminobutyric acid type A receptor gamma2 subunit | |
|
2 | 2 | ||||||
| MIRT620005 | C1orf64 | steroid receptor associated and regulated protein | |
|
2 | 2 | ||||||
| MIRT620211 | VN1R1 | vomeronasal 1 receptor 1 | |
|
2 | 2 | ||||||
| MIRT620447 | SEMA3E | semaphorin 3E | |
|
2 | 2 | ||||||
| MIRT621298 | SLC35B1 | solute carrier family 35 member B1 | |
|
2 | 2 | ||||||
| MIRT621813 | TMEM170B | transmembrane protein 170B | |
|
2 | 2 | ||||||
| MIRT622172 | SMYD1 | SET and MYND domain containing 1 | |
|
2 | 2 | ||||||
| MIRT622203 | SLC5A12 | solute carrier family 5 member 12 | |
|
2 | 2 | ||||||
| MIRT622296 | SH3BP5L | SH3 binding domain protein 5 like | |
|
2 | 2 | ||||||
| MIRT622719 | PLEKHA2 | pleckstrin homology domain containing A2 | |
|
2 | 2 | ||||||
| MIRT622894 | PDCL | phosducin like | |
|
2 | 2 | ||||||
| MIRT623109 | NKD1 | naked cuticle homolog 1 | |
|
2 | 2 | ||||||
| MIRT623231 | MON1B | MON1 homolog B, secretory trafficking associated | |
|
2 | 2 | ||||||
| MIRT623549 | KCNJ6 | potassium voltage-gated channel subfamily J member 6 | |
|
2 | 2 | ||||||
| MIRT623558 | JPH3 | junctophilin 3 | |
|
2 | 2 | ||||||
| MIRT623670 | HRK | harakiri, BCL2 interacting protein | |
|
2 | 2 | ||||||
| MIRT623731 | GTDC1 | glycosyltransferase like domain containing 1 | |
|
2 | 4 | ||||||
| MIRT623743 | GRIN2B | glutamate ionotropic receptor NMDA type subunit 2B | |
|
2 | 2 | ||||||
| MIRT624182 | DERL2 | derlin 2 | |
|
2 | 2 | ||||||
| MIRT625759 | GPC5 | glypican 5 | |
|
2 | 2 | ||||||
| MIRT625976 | PIK3C2B | phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta | |
|
2 | 2 | ||||||
| MIRT626301 | KCNK12 | potassium two pore domain channel subfamily K member 12 | |
|
2 | 2 | ||||||
| MIRT626780 | PI4K2B | phosphatidylinositol 4-kinase type 2 beta | |
|
2 | 2 | ||||||
| MIRT627035 | TMEM109 | transmembrane protein 109 | |
|
2 | 4 | ||||||
| MIRT627110 | PDRG1 | p53 and DNA damage regulated 1 | |
|
2 | 2 | ||||||
| MIRT627406 | TMEM170A | transmembrane protein 170A | |
|
2 | 2 | ||||||
| MIRT628429 | ARRB1 | arrestin beta 1 | |
|
2 | 2 | ||||||
| MIRT629825 | REL | REL proto-oncogene, NF-kB subunit | |
|
2 | 2 | ||||||
| MIRT630871 | UBXN11 | UBX domain protein 11 | |
|
2 | 2 | ||||||
| MIRT630969 | KIAA2022 | neurite extension and migration factor | |
|
2 | 2 | ||||||
| MIRT635311 | FAM179A | TOG array regulator of axonemal microtubules 2 | |
|
2 | 2 | ||||||
| MIRT637117 | KLHL21 | kelch like family member 21 | |
|
2 | 2 | ||||||
| MIRT639179 | CEP70 | centrosomal protein 70 | |
|
2 | 2 | ||||||
| MIRT640004 | PHF21B | PHD finger protein 21B | |
|
2 | 2 | ||||||
| MIRT640641 | FBXL18 | F-box and leucine rich repeat protein 18 | |
|
2 | 2 | ||||||
| MIRT640825 | GPR107 | G protein-coupled receptor 107 | |
|
2 | 2 | ||||||
| MIRT641252 | CENPN | centromere protein N | |
|
2 | 2 | ||||||
| MIRT641435 | SCUBE3 | signal peptide, CUB domain and EGF like domain containing 3 | |
|
2 | 2 | ||||||
| MIRT641747 | MACROD2 | MACRO domain containing 2 | |
|
2 | 2 | ||||||
| MIRT641891 | SND1 | staphylococcal nuclease and tudor domain containing 1 | |
|
2 | 2 | ||||||
| MIRT642355 | C19orf40 | Fanconi anemia core complex associated protein 24 | |
1 | 1 | |||||||
| MIRT644008 | PPP1R3G | protein phosphatase 1 regulatory subunit 3G | |
|
2 | 2 | ||||||
| MIRT644302 | ZSCAN29 | zinc finger and SCAN domain containing 29 | |
|
2 | 2 | ||||||
| MIRT645707 | C1orf50 | chromosome 1 open reading frame 50 | |
|
2 | 2 | ||||||
| MIRT645753 | FAM213A | family with sequence similarity 213 member A | |
|
2 | 2 | ||||||
| MIRT646398 | SLC22A6 | solute carrier family 22 member 6 | |
|
2 | 2 | ||||||
| MIRT646575 | XPNPEP3 | X-prolyl aminopeptidase 3 | |
|
2 | 2 | ||||||
| MIRT647555 | CYP2B6 | cytochrome P450 family 2 subfamily B member 6 | |
|
2 | 2 | ||||||
| MIRT648079 | ZMIZ2 | zinc finger MIZ-type containing 2 | |
|
2 | 2 | ||||||
| MIRT648645 | ZNF562 | zinc finger protein 562 | |
|
2 | 2 | ||||||
| MIRT649128 | SRD5A1 | steroid 5 alpha-reductase 1 | |
|
2 | 2 | ||||||
| MIRT649557 | FAM20B | FAM20B, glycosaminoglycan xylosylkinase | |
|
2 | 2 | ||||||
| MIRT649645 | SAMHD1 | SAM and HD domain containing deoxynucleoside triphosphate triphosphohydrolase 1 | |
|
2 | 2 | ||||||
| MIRT649782 | MRPS27 | mitochondrial ribosomal protein S27 | |
|
2 | 4 | ||||||
| MIRT649944 | SIT1 | signaling threshold regulating transmembrane adaptor 1 | |
|
2 | 2 | ||||||
| MIRT650251 | CD68 | CD68 molecule | |
|
2 | 2 | ||||||
| MIRT650716 | KRT32 | keratin 32 | |
|
2 | 2 | ||||||
| MIRT651048 | ZNF644 | zinc finger protein 644 | |
|
2 | 2 | ||||||
| MIRT651121 | ZNF48 | zinc finger protein 48 | |
|
2 | 2 | ||||||
| MIRT651223 | ZNF225 | zinc finger protein 225 | |
|
2 | 2 | ||||||
| MIRT651278 | ZDHHC5 | zinc finger DHHC-type containing 5 | |
|
2 | 2 | ||||||
| MIRT651400 | ZBTB16 | zinc finger and BTB domain containing 16 | |
|
2 | 2 | ||||||
| MIRT652199 | TRIM39 | tripartite motif containing 39 | |
|
2 | 2 | ||||||
| MIRT652711 | THBS2 | thrombospondin 2 | |
|
2 | 4 | ||||||
| MIRT652764 | TENM4 | teneurin transmembrane protein 4 | |
|
2 | 2 | ||||||
| MIRT653355 | SMG7 | SMG7, nonsense mediated mRNA decay factor | |
|
2 | 2 | ||||||
| MIRT653865 | SHANK2 | SH3 and multiple ankyrin repeat domains 2 | |
|
2 | 2 | ||||||
| MIRT653962 | SEPN1 | selenoprotein N | |
|
2 | 2 | ||||||
| MIRT654464 | RAP2B | RAP2B, member of RAS oncogene family | |
|
2 | 2 | ||||||
| MIRT654484 | RANBP2 | RAN binding protein 2 | |
|
2 | 2 | ||||||
| MIRT654697 | PSMB5 | proteasome subunit beta 5 | |
|
2 | 2 | ||||||
| MIRT654919 | POMGNT1 | protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-) | |
|
2 | 2 | ||||||
| MIRT655444 | PALM2-AKAP2 | PALM2-AKAP2 readthrough | |
|
2 | 2 | ||||||
| MIRT655457 | PALM2 | paralemmin 2 | |
|
2 | 2 | ||||||
| MIRT655607 | ORMDL3 | ORMDL sphingolipid biosynthesis regulator 3 | |
|
2 | 2 | ||||||
| MIRT656025 | MYO5A | myosin VA | |
|
2 | 4 | ||||||
| MIRT656303 | METTL1 | methyltransferase like 1 | |
|
2 | 2 | ||||||
| MIRT656373 | MDFI | MyoD family inhibitor | |
|
2 | 4 | ||||||
| MIRT656400 | MCU | mitochondrial calcium uniporter | |
|
2 | 2 | ||||||
| MIRT656416 | MCTP1 | multiple C2 and transmembrane domain containing 1 | |
|
2 | 2 | ||||||
| MIRT656764 | LCOR | ligand dependent nuclear receptor corepressor | |
|
2 | 2 | ||||||
| MIRT656907 | KIAA1958 | KIAA1958 | |
|
2 | 2 | ||||||
| MIRT658937 | DPY19L1 | dpy-19 like C-mannosyltransferase 1 | |
|
2 | 2 | ||||||
| MIRT659222 | CXXC5 | CXXC finger protein 5 | |
|
2 | 2 | ||||||
| MIRT659485 | CLDN1 | claudin 1 | |
|
2 | 2 | ||||||
| MIRT660113 | BTBD3 | BTB domain containing 3 | |
|
2 | 2 | ||||||
| MIRT660306 | BHLHE40 | basic helix-loop-helix family member e40 | |
|
2 | 2 | ||||||
| MIRT660335 | BCL11B | B-cell CLL/lymphoma 11B | |
|
2 | 2 | ||||||
| MIRT660789 | AKAP2 | A-kinase anchoring protein 2 | |
|
2 | 2 | ||||||
| MIRT661579 | EPHX2 | epoxide hydrolase 2 | |
|
2 | 2 | ||||||
| MIRT661874 | PDLIM5 | PDZ and LIM domain 5 | |
|
2 | 2 | ||||||
| MIRT662257 | C15orf52 | chromosome 15 open reading frame 52 | |
|
2 | 2 | ||||||
| MIRT662699 | SPIRE2 | spire type actin nucleation factor 2 | |
|
2 | 2 | ||||||
| MIRT663316 | TECPR2 | tectonin beta-propeller repeat containing 2 | |
|
2 | 2 | ||||||
| MIRT665967 | SZRD1 | SUZ RNA binding domain containing 1 | |
|
2 | 2 | ||||||
| MIRT666058 | STK40 | serine/threonine kinase 40 | |
|
2 | 2 | ||||||
| MIRT667284 | NAV1 | neuron navigator 1 | |
|
2 | 2 | ||||||
| MIRT667649 | LGALSL | galectin like | |
|
2 | 2 | ||||||
| MIRT668493 | ETV3 | ETS variant 3 | |
|
2 | 2 | ||||||
| MIRT669357 | BHLHE22 | basic helix-loop-helix family member e22 | |
|
2 | 2 | ||||||
| MIRT691271 | GET4 | golgi to ER traffic protein 4 | |
|
2 | 2 | ||||||
| MIRT695829 | ABCG8 | ATP binding cassette subfamily G member 8 | |
|
2 | 2 | ||||||
| MIRT698670 | TEF | TEF, PAR bZIP transcription factor | |
|
2 | 2 | ||||||
| MIRT699230 | SLCO3A1 | solute carrier organic anion transporter family member 3A1 | |
|
2 | 2 | ||||||
| MIRT699894 | RUNX1 | runt related transcription factor 1 | |
|
2 | 2 | ||||||
| MIRT710791 | IFNLR1 | interferon lambda receptor 1 | |
|
2 | 2 | ||||||
| MIRT710951 | AMZ1 | archaelysin family metallopeptidase 1 | |
|
2 | 2 | ||||||
| MIRT711229 | RETSAT | retinol saturase | |
|
2 | 2 | ||||||
| MIRT711638 | PEBP1 | phosphatidylethanolamine binding protein 1 | |
|
2 | 2 | ||||||
| MIRT711969 | APOA5 | apolipoprotein A5 | |
|
2 | 2 | ||||||
| MIRT712079 | WDR37 | WD repeat domain 37 | |
|
2 | 2 | ||||||
| MIRT713716 | PAOX | polyamine oxidase | |
|
2 | 2 | ||||||
| MIRT713876 | FAM212B | family with sequence similarity 212 member B | |
|
2 | 2 | ||||||
| MIRT714481 | TBL2 | transducin beta like 2 | |
|
2 | 2 | ||||||
| MIRT714804 | WDPCP | WD repeat containing planar cell polarity effector | |
|
2 | 2 | ||||||
| MIRT715932 | CHD4 | chromodomain helicase DNA binding protein 4 | |
|
2 | 2 | ||||||
| MIRT716184 | MTRNR2L1 | MT-RNR2-like 1 | |
|
2 | 2 | ||||||
| MIRT716331 | POU5F1 | POU class 5 homeobox 1 | |
|
2 | 2 | ||||||
| MIRT716943 | CACNB1 | calcium voltage-gated channel auxiliary subunit beta 1 | |
|
2 | 2 | ||||||
| MIRT717338 | URM1 | ubiquitin related modifier 1 | |
|
2 | 2 | ||||||
| MIRT718115 | CRTC1 | CREB regulated transcription coactivator 1 | |
|
2 | 2 | ||||||
| MIRT719457 | APBA1 | amyloid beta precursor protein binding family A member 1 | |
|
2 | 2 | ||||||
| MIRT719990 | MAPK1 | mitogen-activated protein kinase 1 | |
|
2 | 2 | ||||||
| MIRT721362 | ENTHD1 | ENTH domain containing 1 | |
|
2 | 2 | ||||||
| MIRT721490 | LTB4R2 | leukotriene B4 receptor 2 | |
|
2 | 2 | ||||||
| MIRT723011 | FADS1 | fatty acid desaturase 1 | |
|
2 | 2 | ||||||
| MIRT723609 | FKRP | fukutin related protein | |
|
2 | 2 | ||||||
| MIRT724827 | HOXB8 | homeobox B8 | |
|
2 | 2 | ||||||
| MIRT731173 | JUN | Jun proto-oncogene, AP-1 transcription factor subunit | |
|
|
3 | 1 | |||||
| miRNA-Drug Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|