pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-16-2 |
Genomic Coordinates | chr3: 160404745 - 160404825 |
Description | Homo sapiens miR-16-2 stem-loop |
Comment | This entry represents a second putative hairpin precursor sequence for miR-16, located on chromosome 3 (see also MIR:MI0000070). The sequence was previously named mir-16-3 here and in references . |
RNA Secondary Structure | |
Associated Diseases |
Mature miRNA Information | |||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-16-2-3p | ||||||||||||||||||
Sequence | 53| CCAAUAUUACUGUGCUGCUUUA |74 | ||||||||||||||||||
Evidence | Experimental | ||||||||||||||||||
Experiments | Cloned | DRVs in miRNA |
|
||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | PAPD7 | ||||||||||||||||||||
Synonyms | LAK-1, LAK1, POLK, POLS, TRF4, TRF4-1, TRF41, TUTASE5 | ||||||||||||||||||||
Description | poly(A) RNA polymerase D7, non-canonical | ||||||||||||||||||||
Transcript | NM_001171805 | ||||||||||||||||||||
Other Transcripts | NM_001171806 , NM_006999 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on PAPD7 | |||||||||||||||||||||
3'UTR of PAPD7 (miRNA target sites are highlighted) |
>PAPD7|NM_001171805|3'UTR 1 TGGCTCCTGGCTGCGTCAGCCTCCCCCACCCCTCTGCAGACTGCCCCGCGGCCTCGGCCACCGGCAGGGGAACCGAGACC 81 AGCACCCCGCACGTCAGCCGGGCTCGCGGCACGCCCGCCGCTGATCACTCTGCATGTTTCTTCGTGTGGTGGTCGCGTCC 161 ATCTTCAAGAACAGCTCGTTGTGCTCATCTGTGAAGCCTTATTAAACGTGGACGTTGTTTTCTGCCTTCCCAGGATTCTT 241 CCTTCAGTGCTGAGGCAGGTCGGGCTCAGGAACTGCAGGGACGTGAACATGCGCTTGCGGTTTGAGGTAGCCGTGTCTGT 321 TCCTTCGCGGTTTGCTATTTTCATTTCCTGTTCGTCAAAGCAGCAGAGGAGATCAAACCCCGTTCGTGTGTCTTTCCTCC 401 ACGGATAAGCTTGGGAGGTCATTGTTTTACTGCCCTCACATTTTGTTTGAAATTTCAGAACTGTTTTTCTATGTAAATAT 481 TGAAAACTTATGATTTGTGCAATAACTCAGATATTTTTTATTTAATTTCCTATTTTCACATAAGTTATATTTAAGGGAGG 561 AGGGAATTTTTTTTAAACAAGCTTAGGTCCTTTCCCGAGCTGCATTTTCTAAGTTGGGTCATCGTGTCGGCTGGTTGTCT 641 GACGAGCATCGTTACAAACACCATGATGAGGGGTTTGGGGTTTTATTTTGATGTCTTTTCTTTTGGTCGGAAGTGAGTGA 721 AGGAGCCAGGTCGCCCTGAAGGTTTTCCAAAGGGCTTGGCTCCAGAGCCACCTGGCAGACTGCCCGTGGCCCTGCTGTCG 801 GGCCCCAGGCCGTTGTCCTGCTCTGACCACAGAGTTTTAATGTTTTGGTTTTCACTTCTTTTAAACTGGACAACAAATCC 881 AGCATTTCAAGTGCCAGAAGTATAACTTTCTAAGGAGAGAAGGGTTGTCACATTATAAAATCTTTAGGAAAATGTGAACT 961 GGAAAACGCTTCGGTCAGTTTTAGTGACATAGCCTGTGATGATGGGTCTGGTGACTATTATTGCGGACCGTGGTACCCAG 1041 TTTTAGGAATGTGGAGAAAGGAATTCTGTTGATTCCGTTGAGGAATCTGTAGCGTATGCATTCGTTCTGTTAAGAGCAAA 1121 TCTAGGAGAAGTGCTTCAGCTGCCCAGTGCGCCGTGGGGAGTGTTTTAACGGATCGTGTCGCAGGAGAGCACAGCCCAGC 1201 GTTGGGGCCGGGACCGCTGGCGCCCGACGTCGGAAGCATACAGGTATACTATGCAAGTGTATTCTGCCACAACAACCACT 1281 GTCTTTGTTACCTTTTTTTGAACAAGAATATATCCATCCTGCCTAACCCTGAGTTTTTGGAGCACCACAGTTGTCCTGGG 1361 AGTTGGTTGCATCTTGTAGGCCATCTGACTTCCTGTTTTTAAAACGGGGGTCTGGTCTTGCTAAACACTACAGGTAGGTT 1441 GGTCTTTGAAGTCCACTAGTGGAGAATGTCAAGACAAGATACTTATTACCATGACATCTGATGCATGTGCAGCAGTGGGG 1521 AGTTCTAGATTGATCTCTGAATGTGATCGACGCCCAGCAAGGACAAGCTTTAAAATGTCTGCGGTCTGCCCTTTTGAAGC 1601 AGGACTGGCTCACTCTGTCATTGGGAGCTGTCAGCTGCGACTGCAGGTTCTCTAGGAGGCATTCCAGAATAGAGTAGCAC 1681 ACTGTGTCTGCAGTTCTCGATGACCGAAAGTTATCAAAAATATTTAAAATATTTAAATTGTGAACCTATTGATAAAGAAT 1761 ATTTATAAAAACTGATCTGTAGGCCTGTACTAATCTCTACGCATTAGCAATATTGACTGTAAACCCACATTAAGGAAACC 1841 ACTACGGGTCTGGCAGTGCGTGTCCCGTGGGGTGTGCATTTTAAAACTCGATTCATAGACACAGGTACCATGTTCCATTT 1921 CCGTCATGGTGAAGCAAATGAATTGGCCTGGCTACCACTGTGGTCGCGTGCTACAGGTTTGACAAAAAGATATCATGTTT 2001 CGATTTTTTTGTGTGTGGACAACAATATGGAAGCTAAAATTGACATATTTTTATGTAAAGTTTTTCTATTCTTTGATTTT 2081 TAATAAACTTTGGAAACCAGTTTAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control
PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | hESCs (WA-09) |
Disease | 11044.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
Experimental Support 3 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | HEK293 |
Disease | 11044.0 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
CLIP-seq Support 1 for dataset GSM545212 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000230859.6 | 3UTR | AAAACUUAUGAUUUGUGCAAUAACUCAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM545214 | |
---|---|
Method / RBP | PAR-CLIP / AGO3 |
Cell line / Condition | HEK293 / Control |
Location of target site | ENST00000230859.6 | 3UTR | AAAACUUAUGAUUUGUGCAAUAACU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset GSM545216 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-124 transfection |
Location of target site | ENST00000230859.6 | 3UTR | AAAACUUAUGAUUUGUGCAAUAACU |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 4 for dataset SRR359787 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
Location of target site | ENST00000230859.6 | 3UTR | AAAACUUAUGAUUUGUGCAAUAACUCAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 22012620 / SRX103431 |
CLIP-seq Viewer | Link |
CLIP-seq Support 5 for dataset GSM1065668 | |
---|---|
Method / RBP | PAR-CLIP / AGO1 |
Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_7 |
Location of target site | ENST00000230859.6 | 3UTR | AAAACUUAUGAUUUGUGCAAUAAC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 23446348 / GSE43573 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
75 hsa-miR-16-2-3p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT004488 | RARB | retinoic acid receptor beta | 3 | 1 | ||||||||
MIRT038707 | NUCKS1 | nuclear casein kinase and cyclin dependent kinase substrate 1 | 1 | 1 | ||||||||
MIRT057208 | PPIF | peptidylprolyl isomerase F | 2 | 4 | ||||||||
MIRT058726 | RSBN1 | round spermatid basic protein 1 | 2 | 8 | ||||||||
MIRT074502 | NFATC2IP | nuclear factor of activated T-cells 2 interacting protein | 2 | 4 | ||||||||
MIRT081544 | ZNF431 | zinc finger protein 431 | 2 | 4 | ||||||||
MIRT096893 | ERBB2IP | erbb2 interacting protein | 2 | 2 | ||||||||
MIRT105124 | MYC | MYC proto-oncogene, bHLH transcription factor | 2 | 2 | ||||||||
MIRT107898 | PTAR1 | protein prenyltransferase alpha subunit repeat containing 1 | 2 | 4 | ||||||||
MIRT109432 | KLHL15 | kelch like family member 15 | 2 | 6 | ||||||||
MIRT166742 | PAPD7 | poly(A) RNA polymerase D7, non-canonical | 2 | 6 | ||||||||
MIRT171257 | YWHAG | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein gamma | 2 | 2 | ||||||||
MIRT192760 | B2M | beta-2-microglobulin | 2 | 2 | ||||||||
MIRT194905 | RBBP6 | RB binding protein 6, ubiquitin ligase | 2 | 8 | ||||||||
MIRT215599 | SUB1 | SUB1 homolog, transcriptional regulator | 2 | 2 | ||||||||
MIRT223632 | ATP6V1C1 | ATPase H+ transporting V1 subunit C1 | 2 | 4 | ||||||||
MIRT241605 | AMOTL1 | angiomotin like 1 | 2 | 4 | ||||||||
MIRT291174 | SH3GLB1 | SH3 domain containing GRB2 like, endophilin B1 | 2 | 2 | ||||||||
MIRT444286 | ABCG2 | ATP binding cassette subfamily G member 2 (Junior blood group) | 2 | 2 | ||||||||
MIRT463285 | ZFX | zinc finger protein, X-linked | 2 | 4 | ||||||||
MIRT471759 | NUS1 | NUS1 dehydrodolichyl diphosphate synthase subunit | 2 | 8 | ||||||||
MIRT479611 | CDC25A | cell division cycle 25A | 2 | 2 | ||||||||
MIRT481497 | ARL6IP1 | ADP ribosylation factor like GTPase 6 interacting protein 1 | 2 | 8 | ||||||||
MIRT483117 | SH3BP5 | SH3 domain binding protein 5 | 2 | 2 | ||||||||
MIRT502279 | GRPEL2 | GrpE like 2, mitochondrial | 2 | 8 | ||||||||
MIRT507838 | CCNT1 | cyclin T1 | 2 | 2 | ||||||||
MIRT508179 | MTRNR2L6 | MT-RNR2-like 6 | 2 | 4 | ||||||||
MIRT510576 | UBE2D3 | ubiquitin conjugating enzyme E2 D3 | 2 | 6 | ||||||||
MIRT517853 | RPS4X | ribosomal protein S4, X-linked | 2 | 4 | ||||||||
MIRT521690 | PRKAA1 | protein kinase AMP-activated catalytic subunit alpha 1 | 2 | 8 | ||||||||
MIRT525070 | FRK | fyn related Src family tyrosine kinase | 2 | 2 | ||||||||
MIRT527082 | UBE2E3 | ubiquitin conjugating enzyme E2 E3 | 2 | 2 | ||||||||
MIRT529552 | EI24 | EI24, autophagy associated transmembrane protein | 2 | 2 | ||||||||
MIRT530426 | SULT1B1 | sulfotransferase family 1B member 1 | 2 | 2 | ||||||||
MIRT533909 | TBC1D15 | TBC1 domain family member 15 | 2 | 2 | ||||||||
MIRT536627 | IPO7 | importin 7 | 2 | 2 | ||||||||
MIRT537647 | ERGIC2 | ERGIC and golgi 2 | 2 | 4 | ||||||||
MIRT538512 | CLCN3 | chloride voltage-gated channel 3 | 2 | 2 | ||||||||
MIRT539219 | ANP32E | acidic nuclear phosphoprotein 32 family member E | 2 | 6 | ||||||||
MIRT539348 | AGO2 | argonaute 2, RISC catalytic component | 2 | 4 | ||||||||
MIRT539954 | CCT4 | chaperonin containing TCP1 subunit 4 | 2 | 2 | ||||||||
MIRT541208 | HOXA10 | homeobox A10 | 2 | 2 | ||||||||
MIRT543216 | TMEM117 | transmembrane protein 117 | 2 | 2 | ||||||||
MIRT543399 | DROSHA | drosha ribonuclease III | 2 | 2 | ||||||||
MIRT546648 | RPS6KA5 | ribosomal protein S6 kinase A5 | 2 | 2 | ||||||||
MIRT546852 | RAB1A | RAB1A, member RAS oncogene family | 2 | 2 | ||||||||
MIRT549917 | MRPS30 | mitochondrial ribosomal protein S30 | 2 | 2 | ||||||||
MIRT552998 | USP46 | ubiquitin specific peptidase 46 | 2 | 2 | ||||||||
MIRT555254 | PREPL | prolyl endopeptidase-like | 2 | 2 | ||||||||
MIRT555956 | NRIP1 | nuclear receptor interacting protein 1 | 2 | 2 | ||||||||
MIRT557095 | HOXA9 | homeobox A9 | 2 | 2 | ||||||||
MIRT561396 | TUBB2A | tubulin beta 2A class IIa | 2 | 2 | ||||||||
MIRT561654 | RNF219 | ring finger protein 219 | 2 | 2 | ||||||||
MIRT563101 | PABPC4L | poly(A) binding protein cytoplasmic 4 like | 2 | 2 | ||||||||
MIRT565979 | RNF44 | ring finger protein 44 | 2 | 2 | ||||||||
MIRT572396 | CCDC14 | coiled-coil domain containing 14 | 2 | 2 | ||||||||
MIRT574400 | TM9SF3 | transmembrane 9 superfamily member 3 | 2 | 2 | ||||||||
MIRT607623 | VSNL1 | visinin like 1 | 2 | 2 | ||||||||
MIRT610645 | CTGF | connective tissue growth factor | 2 | 2 | ||||||||
MIRT623379 | LPP | LIM domain containing preferred translocation partner in lipoma | 2 | 2 | ||||||||
MIRT624687 | AR | androgen receptor | 2 | 2 | ||||||||
MIRT632089 | ALDH1A2 | aldehyde dehydrogenase 1 family member A2 | 2 | 2 | ||||||||
MIRT644216 | CBS | cystathionine-beta-synthase | 2 | 2 | ||||||||
MIRT647841 | BID | BH3 interacting domain death agonist | 2 | 2 | ||||||||
MIRT651649 | WASF2 | WAS protein family member 2 | 2 | 2 | ||||||||
MIRT689064 | AGMAT | agmatinase | 2 | 2 | ||||||||
MIRT698150 | TNPO1 | transportin 1 | 2 | 2 | ||||||||
MIRT700516 | PTPN14 | protein tyrosine phosphatase, non-receptor type 14 | 2 | 2 | ||||||||
MIRT704081 | DYRK2 | dual specificity tyrosine phosphorylation regulated kinase 2 | 2 | 2 | ||||||||
MIRT705970 | ACBD5 | acyl-CoA binding domain containing 5 | 2 | 2 | ||||||||
MIRT715694 | COMMD3-BMI1 | COMMD3-BMI1 readthrough | 2 | 2 | ||||||||
MIRT717184 | BMI1 | BMI1 proto-oncogene, polycomb ring finger | 2 | 2 | ||||||||
MIRT724607 | AP3B1 | adaptor related protein complex 3 beta 1 subunit | 2 | 2 | ||||||||
MIRT724854 | IGFBP5 | insulin like growth factor binding protein 5 | 2 | 2 | ||||||||
MIRT725401 | LRIG2 | leucine rich repeats and immunoglobulin like domains 2 | 2 | 2 |
miRNA-Drug Associations | ||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|