>HIVEP1|NM_002114|3'UTR
   1 TGGATTTTATTTTTTATTTGCTTTTTTTTTATATAACACTTAAAGGTTTCTTTGAAAACCCTCCTTTCCTTAAAGCACAT
  81 TTTTCTGACATAAACTCATGACTAATCTTTGTGCAATCATGAACTTTTGACCAATAATTGTTGTTTTGTGTCAGCTCCAG
 161 CCATTTTTGTACATGTTGTATAGACAATTGTGCCTTTTAGGAGCTTTATGTTTAGAAACTGTACAGATTGTTGAATATCT
 241 ATATACATAAAAATATATTATATATGTATATGAAAACCAGGTAGTTATTTGTGTTTAGTAAGGAAAACCTGTCAAATAAA
 321 TCAAATGATTAAATTATATGTTCCACTGTTGAATATAAATTTTATGGCTATGGGGCAGAGTTTCTGTGTATAAATTAGTA
 401 TGTAAACTCCATATTTATTGTATTCATATTAGTCTTTGAAAATGGGTCTGTCCTCCTTGTGTAAGACAGTAACTTTACAC
 481 TTCAGACAGATTTTCTGTGTTATGAAATGTTTCAGTAAAATATTGTTTACTGACTTTA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' ugUGGCUCCUCGGGUAGUACUa 5' |:| | | | ||||||| Target 5' taATCTTTGTG-CAATCATGAa 3'	103 - 123	143.00	-8.40
2	miRNA 3' ugUGGCUCCUCGG-GUAGUACUa 5' || || |: ::|:|||| Target 5' agACAGATTTTCTGTGTTATGAa 3'	484 - 506	112.00	-5.60
3	miRNA 3' uguggcuccucgggUAG--UACUa 5' ||| |||| Target 5' aacctgtcaaataaATCAAATGAt 3'	306 - 329	100.00	-5.70

Mutant ID	Mutant Position	Mutant Source
COSN30109043	4	COSMIC
COSN30451683	11	COSMIC
COSN24394258	30	COSMIC
COSN28863105	31	COSMIC
COSN16124061	144	COSMIC
COSN24301597	300	COSMIC
COSN1324052	303	COSMIC
COSN31542996	330	COSMIC
COSN31521487	380	COSMIC
COSN32053493	490	COSMIC
COSN31566628	496	COSMIC
COSN31507366	533	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs1279693866	3	dbSNP
rs1329798266	7	dbSNP
rs771259857	9	dbSNP
rs375066325	10	dbSNP
rs746362421	18	dbSNP
rs752138621	22	dbSNP
rs75719442	22	dbSNP
rs764318710	22	dbSNP
rs76772048	23	dbSNP
rs1382239758	25	dbSNP
rs1156989597	26	dbSNP
rs776174267	30	dbSNP
rs761358448	31	dbSNP
rs771496730	32	dbSNP
rs772858028	34	dbSNP
rs760315972	36	dbSNP
rs1482452655	38	dbSNP
rs757640086	38	dbSNP
rs1402638787	39	dbSNP
rs1237279589	40	dbSNP
rs766185501	44	dbSNP
rs888770947	50	dbSNP
rs1489106434	55	dbSNP
rs1209786308	60	dbSNP
rs1215325527	61	dbSNP
rs943026796	65	dbSNP
rs1053677982	77	dbSNP
rs1046008882	91	dbSNP
rs1368300526	92	dbSNP
rs1184589135	93	dbSNP
rs893716090	99	dbSNP
rs528602491	117	dbSNP
rs1362742210	135	dbSNP
rs551346296	138	dbSNP
rs186299554	153	dbSNP
rs1350561655	158	dbSNP
rs1167454111	174	dbSNP
rs189727381	179	dbSNP
rs1417588559	180	dbSNP
rs1194920926	181	dbSNP
rs748483022	182	dbSNP
rs1478586898	186	dbSNP
rs1053174183	188	dbSNP
rs770649122	193	dbSNP
rs1488496158	199	dbSNP
rs1266716784	205	dbSNP
rs1434325087	205	dbSNP
rs1321105558	208	dbSNP
rs1033754741	234	dbSNP
rs6913803	235	dbSNP
rs1347211800	248	dbSNP
rs1429002540	254	dbSNP
rs1338181816	256	dbSNP
rs35188801	258	dbSNP
rs1288707735	265	dbSNP
rs775925896	266	dbSNP
rs1017303753	267	dbSNP
rs900190686	269	dbSNP
rs181329307	289	dbSNP
rs1030263410	290	dbSNP
rs1456829629	297	dbSNP
rs1171797103	298	dbSNP
rs1304976983	298	dbSNP
rs973047184	314	dbSNP
rs922743260	318	dbSNP
rs1191958674	322	dbSNP
rs35274191	323	dbSNP
rs950670146	325	dbSNP
rs1188997735	328	dbSNP
rs983287407	328	dbSNP
rs1016072143	331	dbSNP
rs35258706	331	dbSNP
rs1284465332	336	dbSNP
rs1238670182	337	dbSNP
rs1200476232	352	dbSNP
rs1318374514	356	dbSNP
rs1250554837	358	dbSNP
rs1226960573	359	dbSNP
rs987187180	360	dbSNP
rs139115736	385	dbSNP
rs974177472	403	dbSNP
rs915967374	408	dbSNP
rs1332581283	411	dbSNP
rs1449652059	412	dbSNP
rs755454526	420	dbSNP
rs893508607	422	dbSNP
rs970096229	423	dbSNP
rs945285412	446	dbSNP
rs1251076063	456	dbSNP
rs1379061318	459	dbSNP
rs1173549760	466	dbSNP
rs1453226922	472	dbSNP
rs1380382492	473	dbSNP
rs1180369818	477	dbSNP
rs1456432975	489	dbSNP
rs981825445	496	dbSNP
rs1453802556	513	dbSNP
rs1042333949	519	dbSNP
rs928904062	520	dbSNP
rs1257927747	526	dbSNP
rs141545282	529	dbSNP
rs760936281	530	dbSNP
rs1399217636	532	dbSNP
rs1310092451	535	dbSNP
rs150877794	535	dbSNP
rs914780376	538	dbSNP

- Cell, 2010

RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- Nature, 2013

Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.