miRTarBase - #MIRT168142


—
pre-miRNA Information
pre-miRNA hsa-mir-548ac   
Genomic Coordinates chr1: 116560024 - 116560111
Description Homo sapiens miR-548ac stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-548ac
Sequence 53| CAAAAACCGGCAAUUACUUUUG |74
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 1 - 116560056 29233923 MiREDiBase
A-to-I 5 1 - 116560055 29233923 MiREDiBase
A-to-I 6 1 - 116560054 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1182074110 6 dbSNP
rs1392446444 6 dbSNP
rs1326234665 7 dbSNP
rs556579863 8 dbSNP
rs993390910 9 dbSNP
rs901450363 13 dbSNP
rs538553306 22 dbSNP
Putative Targets

Gene Information
Gene Symbol SOX4   
Synonyms EVI16
Description SRY-box 4
Transcript NM_003107   
Expression
Putative miRNA Targets on SOX4
3'UTR of SOX4
(miRNA target sites are highlighted)		 
>SOX4|NM_003107|3'UTR
   1 AGGGCGCGCAGGCAGGGAGAAGGGCCGGGGGGGGTAGGAGAGGAGAAAAAAAAAGTGAAAAAAAGAAACGAAAAGGACAG
  81 ACGAAGAGTTTAAAGAGAAAAGGGAAAAAAGAAAGAAAAAGTAAGCAGGGCTGGCTTCGCCCGCGTTCTCGTCGTCGGAT
 161 CAAGGAGCGCGGCGGCGTTTTGGACCCGCGCTCCCATCCCCCACCTTCCCGGGCCGGGGACCCACTCTGCCCAGCCGGAG
 241 GGACGCGGAGGAGGAAGAGGGTAGACAGGGGCGACCTGTGATTGTTGTTATTGATGTTGTTGTTGATGGCAAAAAAAAAA
 321 AAGCGACTTCGAGTTTGCTCCCCTTTGCTTGAAGAGACCCCCTCCCCCTTCCAACGAGCTTCCGGACTTGTCTGCACCCC
 401 CAGCAAGAAGGCGAGTTAGTTTTCTAGAGACTTGAAGGAGTCTCCCCCTTCCTGCATCACCACCTTGGTTTTGTTTTATT
 481 TTGCTTCTTGGTCAAGAAAGGAGGGGAGAACCCAGCGCACCCCTCCCCCCCTTTTTTTAAACGCGTGATGAAGACAGAAG
 561 GCTCCGGGGTGACGAATTTGGCCGATGGCAGATGTTTTGGGGGAACGCCGGGACTGAGAGACTCCACGCAGGCGAATTCC
 641 CGTTTGGGGCTTTTTTTTCCTCCCTCTTTTCCCCTTGCCCCCTCTGCAGCCGGAGGAGGAGATGTTGAGGGGAGGAGGCC
 721 AGCCAGTGTGACCGGCGCTAGGAAATGACCCGAGAACCCCGTTGGAAGCGCAGCAGCGGGAGCTAGGGGCGGGGGCGGAG
 801 GAGGACACGAACTGGAAGGGGGTTCACGGTCAAACTGAAATGGATTTGCACGTTGGGGAGCTGGCGGCGGCGGCTGCTGG
 881 GCCTCCGCCTTCTTTTCTACGTGAAATCAGTGAGGTGAGACTTCCCAGACCCCGGAGGCGTGGAGGAGAGGAGACTGTTT
 961 GATGTGGTACAGGGGCAGTCAGTGGAGGGCGAGTGGTTTCGGAAAAAAAAAAAGAAAAAAAGAAAAAAAAAGAAAAAAAA
1041 AAGATTTTTTTCTTCTCTTAATCGGAATCGTGATGGTGTTGGATTATTTCAATGGTGGGGTTAATATAGCATGTTATCCT
1121 GTCTATCTTTTAAAGATTTCTGTATAAGACTGTTGAGCAGTTTTTAAAATAGTGTAGGATAATATAAAAAGCAGATAGAT
1201 GGCGCTATGTTTGATTCCTACAACGAAATTATCACCAGCTTTTTTTCATTCTTAACTCTTTAAAGGATTCAAACGCAACT
1281 CAAATCTGTGCTGGACTTTAAAAAAACAATTCAGGACCAAATTTTTTCTCAGTGTGTGTGTTTATTCCTTATAGGTGTAA
1361 ATGAGAAGACGTGTTTTTTTCCTTCACCGATGCTCCATCCTCGTATTTCTTTTTCCTTGTAAATGTAATCAGATGCCATT
1441 TTATATGTGGACGTATTTATACTGGCCAAACATATTTTTTCTTTTGTCCCTTTTTTTCTTTCCTTTCTTTTTACTTCCTT
1521 TATTTCTTTATTCCTTCCTTTTCCTTTTTTTCTTTTTTTTTTCTTTTTTTTTTTTTTTTTTTGGTAGTTGTTGTTACCCA
1601 CGCCATTTTACGTCTCCTTCACTGAAGGGCTAGAGTTTTAACTTTTAATTTTTTATATTTAAATGTAGACTTTTGACACT
1681 TTTAAAAAACAAAAAAAGACAAGAGAGATGAAAACGTTTGATTATTTTCTCAGTGTATTTTTGTAAAAAATATATAAAGG
1761 GGGTGTTAATCGGTGTAAATCGCTGTTTGGATTTCCTGATTTTATAACAGGGCGGCTGGTTAATATCTCACACAGTTTAA
1841 AAAATCAGCCCCTAATTTCTCCATGTTTACACTTCAATCTGCAGGCTTCTTAAAGTGACAGTATCCCTTAACCTGCCACC
1921 AGTGTCCACCCTCCGGCCCCCGTCTTGTAAAAAGGGGAGGAGAATTAGCCAAACACTGTAAGCTTTTAAGAAAAACAAAG
2001 TTTTAAACGAAATACTGCTCTGTCCAGAGGCTTTAAAACTGGTGCAATTACAGCAAAAAGGGATTCTGTAGCTTTAACTT
2081 GTAAACCACATCTTTTTTGCACTTTTTTTATAAGCAAAAACGTGCCGTTTAAACCACTGGATCTATCTAAATGCCGATTT
2161 GAGTTCGCGACACTATGTACTGCGTTTTTCATTCTTGTATTTGACTATTTAATCCTTTCTACTTGTCGCTAAATATAATT
2241 GTTTTAGTCTTATGGCATGATGATAGCATATGTGTTCAGGTTTATAGCTGTTGTGTTTAAAAATTGAAAAAAGTGGAAAA
2321 CATCTTTGTACATTTAAGTCTGTATTATAATAAGCAAAAAGATTGTGTGTATGTATGTTTAATATAACATGACAGGCACT
2401 AGGACGTCTGCCTTTTTAAGGCAGTTCCGTTAAGGGTTTTTGTTTTTAAACTTTTTTTTGCCATCCATCCTGTGCAATAT
2481 GCCGTGTAGAATATTTGTCTTAAAATTCAAGGCCACAAAAACAATGTTTGGGGGAAAAAAAAGAAAAAATCATGCCAGCT
2561 AATCATGTCAAGTTCACTGCCTGTCAGATTGTTGATATATACCTTCTGTAAATAACTTTTTTTGAGAAGGAAATAAAATC
2641 AGCTGGAACTGAACCCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' guUUUCAUUAA--CGG---CCAAAAAc 5'
            ||:| |:||  |::   ||||||| 
Target 5' ttAAGGCAGTTCCGTTAAGGGTTTTTg 3'
 2416 - 2442 154.00 -10.30
2 
miRNA  3' guUUUCAUUAAC-GGCCAAAAAc 5'
            |:| | :|||  | |||||| 
Target 5' taAGACT-GTTGAGCAGTTTTTa 3'
 1145 - 1166 123.00 -5.50
3 
miRNA  3' guUUUCAUUAACGG------CCAAAAAc 5'
            |::  |||| ||      || |||| 
Target 5' gcAGGCGAATTCCCGTTTGGGGCTTTTt 3'
 628 - 655 118.00 -8.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN20102460 35 COSMIC
COSN30130578 41 COSMIC
COSN32051869 55 COSMIC
COSN31562045 65 COSMIC
COSN1329761 88 COSMIC
COSN30138601 110 COSMIC
COSN31515459 112 COSMIC
COSN26578619 122 COSMIC
COSN31549936 132 COSMIC
COSN30110570 146 COSMIC
COSN30165627 154 COSMIC
COSN9776930 173 COSMIC
COSN31480191 228 COSMIC
COSN30529869 316 COSMIC
COSN1329762 323 COSMIC
COSN27346377 323 COSMIC
COSN7866970 349 COSMIC
COSN26957634 444 COSMIC
COSN31555263 533 COSMIC
COSN9776931 571 COSMIC
COSN31589084 597 COSMIC
COSN30143967 628 COSMIC
COSN31538414 659 COSMIC
COSN15626430 667 COSMIC
COSN6315496 780 COSMIC
COSN19660705 809 COSMIC
COSN30116000 834 COSMIC
COSN31557315 869 COSMIC
COSN1329763 913 COSMIC
COSN31488402 947 COSMIC
COSN31488648 952 COSMIC
COSN27459301 1014 COSMIC
COSN17153537 1015 COSMIC
COSN16531558 1033 COSMIC
COSN17401069 1035 COSMIC
COSN31563627 1043 COSMIC
COSN30529921 1044 COSMIC
COSN31516477 1045 COSMIC
COSN31606864 1056 COSMIC
COSN31487056 1215 COSMIC
COSN31580128 1307 COSMIC
COSN15626431 1331 COSMIC
COSN26958475 1331 COSMIC
COSN26958476 1332 COSMIC
COSN30132757 1491 COSMIC
COSN20547843 1504 COSMIC
COSN20545020 1508 COSMIC
COSN31570653 1510 COSMIC
COSN30170329 1535 COSMIC
COSN31539620 1545 COSMIC
COSN8513792 1553 COSMIC
COSN30175895 1563 COSMIC
COSN20390156 1564 COSMIC
COSN8513793 1572 COSMIC
COSN30140151 1602 COSMIC
COSN30510670 1615 COSMIC
COSN26465215 1643 COSMIC
COSN30537787 1683 COSMIC
COSN30537790 1684 COSMIC
COSN25100621 1725 COSMIC
COSN30124593 1751 COSMIC
COSN30529475 1792 COSMIC
COSN31537778 1814 COSMIC
COSN26554556 1815 COSMIC
COSN30130802 1827 COSMIC
COSN15626432 1906 COSMIC
COSN31610520 1945 COSMIC
COSN15626433 1955 COSMIC
COSN31516778 1972 COSMIC
COSN30113527 2049 COSMIC
COSN26791827 2098 COSMIC
COSN31595308 2104 COSMIC
COSN30533797 2155 COSMIC
COSN28669879 2182 COSMIC
COSN30512136 2199 COSMIC
COSN30118164 2248 COSMIC
COSN15966676 2272 COSMIC
COSN30533494 2310 COSMIC
COSN31589997 2329 COSMIC
COSN30136042 2344 COSMIC
COSN30113605 2362 COSMIC
COSN30173879 2366 COSMIC
COSN30530925 2436 COSMIC
COSN26958477 2527 COSMIC
COSN23012864 2535 COSMIC
COSN31551638 2536 COSMIC
COSN8513794 2549 COSMIC
COSN28669330 2598 COSMIC
COSN2499110 2647 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs758667509 3 dbSNP
rs777809842 5 dbSNP
rs747430686 6 dbSNP
rs1452161223 7 dbSNP
rs1180814300 8 dbSNP
rs1236140480 10 dbSNP
rs1441095212 11 dbSNP
rs1178890231 13 dbSNP
rs923920469 16 dbSNP
rs1384031165 18 dbSNP
rs958354281 23 dbSNP
rs1164194102 26 dbSNP
rs1164541918 26 dbSNP
rs764320667 27 dbSNP
rs774787329 27 dbSNP
rs1392063410 28 dbSNP
rs1409968157 29 dbSNP
rs781728088 30 dbSNP
rs768224472 31 dbSNP
rs1270229207 32 dbSNP
rs200088857 32 dbSNP
rs760527295 33 dbSNP
rs113141237 34 dbSNP
rs150449012 34 dbSNP
rs1247059117 35 dbSNP
rs1481268683 36 dbSNP
rs1177086723 38 dbSNP
rs765453290 39 dbSNP
rs1407076067 41 dbSNP
rs752846533 42 dbSNP
rs767852291 43 dbSNP
rs758368209 44 dbSNP
rs1406645806 46 dbSNP
rs199766530 46 dbSNP
rs754437511 46 dbSNP
rs764379585 47 dbSNP
rs1345246005 49 dbSNP
rs1199078075 50 dbSNP
rs1480236204 51 dbSNP
rs1397482308 55 dbSNP
rs11413405 57 dbSNP
rs534670825 57 dbSNP
rs546083928 57 dbSNP
rs1046571107 60 dbSNP
rs1025265961 62 dbSNP
rs1051079 63 dbSNP
rs1203175941 64 dbSNP
rs1437962292 66 dbSNP
rs546528035 67 dbSNP
rs534834455 69 dbSNP
rs553929047 70 dbSNP
rs1220782711 73 dbSNP
rs1306301588 81 dbSNP
rs888100184 85 dbSNP
rs571459101 88 dbSNP
rs1402470749 89 dbSNP
rs1334802149 93 dbSNP
rs1469438770 96 dbSNP
rs766429313 96 dbSNP
rs868578396 98 dbSNP
rs1178994195 99 dbSNP
rs1399366211 101 dbSNP
rs1005139325 102 dbSNP
rs1039600916 103 dbSNP
rs1178351760 104 dbSNP
rs1051048 105 dbSNP
rs977303692 105 dbSNP
rs899738469 106 dbSNP
rs1181253556 107 dbSNP
rs1460578738 108 dbSNP
rs755789293 108 dbSNP
rs1314978704 110 dbSNP
rs943856841 110 dbSNP
rs16901614 112 dbSNP
rs777230863 114 dbSNP
rs1048518278 116 dbSNP
rs931349428 116 dbSNP
rs1436742788 118 dbSNP
rs372757653 121 dbSNP
rs1452057319 123 dbSNP
rs1254785239 124 dbSNP
rs1467137643 125 dbSNP
rs79958549 126 dbSNP
rs1046668416 127 dbSNP
rs1160322065 130 dbSNP
rs906755544 130 dbSNP
rs1002886917 133 dbSNP
rs1051049 134 dbSNP
rs954842684 135 dbSNP
rs1161112892 137 dbSNP
rs1443544811 139 dbSNP
rs1000016194 140 dbSNP
rs557312513 141 dbSNP
rs1166405097 145 dbSNP
rs1418835384 146 dbSNP
rs1355727233 149 dbSNP
rs575573467 151 dbSNP
rs1245316817 155 dbSNP
rs1314943524 158 dbSNP
rs113534734 160 dbSNP
rs1361568749 161 dbSNP
rs537058170 162 dbSNP
rs958026636 163 dbSNP
rs555683849 166 dbSNP
rs554443753 174 dbSNP
rs1321552950 182 dbSNP
rs966998565 186 dbSNP
rs1166323489 187 dbSNP
rs1426323911 191 dbSNP
rs1418398751 195 dbSNP
rs1328589377 197 dbSNP
rs989457753 212 dbSNP
rs916846964 213 dbSNP
rs977087436 218 dbSNP
rs969614076 222 dbSNP
rs1266673918 225 dbSNP
rs982324079 226 dbSNP
rs1225391585 236 dbSNP
rs1338394871 236 dbSNP
rs1019713141 237 dbSNP
rs928118167 241 dbSNP
rs929773230 242 dbSNP
rs1233363423 244 dbSNP
rs1343953903 245 dbSNP
rs769412942 247 dbSNP
rs1283057912 259 dbSNP
rs1406038872 260 dbSNP
rs574096785 264 dbSNP
rs528494731 267 dbSNP
rs1460068826 268 dbSNP
rs1212996617 270 dbSNP
rs1478598695 271 dbSNP
rs1262119729 276 dbSNP
rs965303767 277 dbSNP
rs1190823429 280 dbSNP
rs1241738977 282 dbSNP
rs1251971355 289 dbSNP
rs1475690237 289 dbSNP
rs1200695635 293 dbSNP
rs1167121412 294 dbSNP
rs975740716 295 dbSNP
rs921073172 298 dbSNP
rs111640879 306 dbSNP
rs1333309679 308 dbSNP
rs113192344 311 dbSNP
rs1466816735 311 dbSNP
rs796555280 311 dbSNP
rs931169401 311 dbSNP
rs984203067 311 dbSNP
rs1175419487 313 dbSNP
rs1466411532 315 dbSNP
rs559729519 317 dbSNP
rs1179492584 322 dbSNP
rs940099564 323 dbSNP
rs1159672487 324 dbSNP
rs1387833314 325 dbSNP
rs1380853648 326 dbSNP
rs1318160641 331 dbSNP
rs1046368530 332 dbSNP
rs982944204 339 dbSNP
rs1339433622 341 dbSNP
rs909595390 342 dbSNP
rs759964109 343 dbSNP
rs1415038009 344 dbSNP
rs1294521557 348 dbSNP
rs867957273 349 dbSNP
rs1262804211 352 dbSNP
rs1353056147 354 dbSNP
rs1347658775 358 dbSNP
rs938242821 358 dbSNP
rs1238886787 359 dbSNP
rs1261219898 361 dbSNP
rs1055817164 362 dbSNP
rs893970386 363 dbSNP
rs1203145235 364 dbSNP
rs1283309459 365 dbSNP
rs941051447 370 dbSNP
rs1011052112 372 dbSNP
rs1039316668 375 dbSNP
rs1452924148 377 dbSNP
rs899791145 383 dbSNP
rs1190364172 385 dbSNP
rs1021315495 386 dbSNP
rs1442915374 388 dbSNP
rs902914424 393 dbSNP
rs577792688 397 dbSNP
rs752534861 397 dbSNP
rs765655839 398 dbSNP
rs903007596 403 dbSNP
rs998665711 407 dbSNP
rs1031521783 408 dbSNP
rs753133052 415 dbSNP
rs975349166 420 dbSNP
rs1356559323 424 dbSNP
rs1313759656 425 dbSNP
rs1028698780 426 dbSNP
rs1452333071 427 dbSNP
rs1010940299 428 dbSNP
rs952507311 439 dbSNP
rs1300028670 441 dbSNP
rs1422670181 441 dbSNP
rs983984884 442 dbSNP
rs550752789 443 dbSNP
rs940047325 443 dbSNP
rs545170892 444 dbSNP
rs563656230 446 dbSNP
rs77177818 449 dbSNP
rs113778405 450 dbSNP
rs1490337429 451 dbSNP
rs1288483163 455 dbSNP
rs1035242103 456 dbSNP
rs1307155864 458 dbSNP
rs1209959610 459 dbSNP
rs951631146 460 dbSNP
rs758882255 461 dbSNP
rs982949753 464 dbSNP
rs1279868807 466 dbSNP
rs1324247440 468 dbSNP
rs1364917156 468 dbSNP
rs909650551 468 dbSNP
rs902695198 470 dbSNP
rs998583723 474 dbSNP
rs941103547 487 dbSNP
rs1041227588 488 dbSNP
rs1167489831 488 dbSNP
rs1426172314 489 dbSNP
rs560939044 491 dbSNP
rs1480380081 494 dbSNP
rs1247856253 496 dbSNP
rs1221642196 499 dbSNP
rs1452896422 500 dbSNP
rs996940564 501 dbSNP
rs920928057 506 dbSNP
rs1485504823 507 dbSNP
rs933944962 509 dbSNP
rs1259706183 510 dbSNP
rs1221501768 512 dbSNP
rs1366789644 513 dbSNP
rs1051462037 517 dbSNP
rs1196444986 522 dbSNP
rs903075517 523 dbSNP
rs1275436384 524 dbSNP
rs1005474844 525 dbSNP
rs1438530515 525 dbSNP
rs1328297853 526 dbSNP
rs1164065142 527 dbSNP
rs144133444 529 dbSNP
rs184361355 530 dbSNP
rs571497565 531 dbSNP
rs1230623889 532 dbSNP
rs1455838637 532 dbSNP
rs1457910379 532 dbSNP
rs1010991158 533 dbSNP
rs959386487 534 dbSNP
rs1023673115 542 dbSNP
rs1279084448 547 dbSNP
rs1220828291 554 dbSNP
rs538850161 558 dbSNP
rs905200595 559 dbSNP
rs756775253 562 dbSNP
rs550752310 563 dbSNP
rs1452194496 564 dbSNP
rs1360048070 566 dbSNP
rs187509815 567 dbSNP
rs1399422198 569 dbSNP
rs1407943938 570 dbSNP
rs780578157 575 dbSNP
rs1042629301 579 dbSNP
rs146898567 584 dbSNP
rs962474548 591 dbSNP
rs944908444 600 dbSNP
rs555519149 601 dbSNP
rs745780496 607 dbSNP
rs1371689560 610 dbSNP
rs192477325 611 dbSNP
rs1212027588 615 dbSNP
rs1458295308 615 dbSNP
rs1445190920 616 dbSNP
rs1285296319 621 dbSNP
rs1040781230 623 dbSNP
rs1355857384 625 dbSNP
rs1313025681 626 dbSNP
rs920980422 627 dbSNP
rs769645048 628 dbSNP
rs1304926741 642 dbSNP
rs996623541 643 dbSNP
rs1360432289 650 dbSNP
rs1299412810 651 dbSNP
rs1422077040 651 dbSNP
rs1381576867 654 dbSNP
rs534834538 660 dbSNP
rs986453258 661 dbSNP
rs888118713 663 dbSNP
rs1005462017 664 dbSNP
rs1254145606 665 dbSNP
rs774099474 667 dbSNP
rs924551350 672 dbSNP
rs780018737 678 dbSNP
rs1192077160 679 dbSNP
rs1394859115 680 dbSNP
rs1432191424 683 dbSNP
rs934576960 685 dbSNP
rs1374484530 688 dbSNP
rs1459997865 690 dbSNP
rs1015558536 694 dbSNP
rs36017767 695 dbSNP
rs1340230061 700 dbSNP
rs1279259571 705 dbSNP
rs1054329161 707 dbSNP
rs914397839 708 dbSNP
rs1364296918 711 dbSNP
rs948498544 713 dbSNP
rs1443032905 716 dbSNP
rs1003814845 717 dbSNP
rs1045174326 717 dbSNP
rs905252885 719 dbSNP
rs1003968598 720 dbSNP
rs553071938 724 dbSNP
rs959699244 725 dbSNP
rs1056457532 726 dbSNP
rs768506235 727 dbSNP
rs887382525 734 dbSNP
rs990923684 735 dbSNP
rs1004467409 748 dbSNP
rs915208826 751 dbSNP
rs1297972528 758 dbSNP
rs1017092140 759 dbSNP
rs768256578 761 dbSNP
rs1259074274 772 dbSNP
rs900150139 772 dbSNP
rs773411748 775 dbSNP
rs577682127 777 dbSNP
rs996931862 778 dbSNP
rs1273902344 782 dbSNP
rs545207747 784 dbSNP
rs976629177 785 dbSNP
rs1028048525 786 dbSNP
rs760814494 788 dbSNP
rs766331342 789 dbSNP
rs557086958 791 dbSNP
rs956183175 794 dbSNP
rs1375853844 795 dbSNP
rs575582555 796 dbSNP
rs139085828 798 dbSNP
rs941029578 799 dbSNP
rs1188699776 809 dbSNP
rs1263402550 813 dbSNP
rs1457468000 816 dbSNP
rs1239084059 818 dbSNP
rs914451582 820 dbSNP
rs1321773854 822 dbSNP
rs1255788517 823 dbSNP
rs1234540588 826 dbSNP
rs1314493303 827 dbSNP
rs897033361 828 dbSNP
rs948551941 829 dbSNP
rs1035228365 830 dbSNP
rs1331699708 836 dbSNP
rs560757796 838 dbSNP
rs776604025 844 dbSNP
rs926730357 852 dbSNP
rs939435797 853 dbSNP
rs1399720208 858 dbSNP
rs1302078887 861 dbSNP
rs1417957941 863 dbSNP
rs1462914052 866 dbSNP
rs894987997 870 dbSNP
rs1012278723 872 dbSNP
rs1180686861 873 dbSNP
rs1349281025 873 dbSNP
rs1440927658 876 dbSNP
rs1022375062 878 dbSNP
rs1201426399 886 dbSNP
rs1056910249 890 dbSNP
rs575602892 891 dbSNP
rs543027975 892 dbSNP
rs1237317409 893 dbSNP
rs1360120115 893 dbSNP
rs1352250907 895 dbSNP
rs1030975712 899 dbSNP
rs564979921 900 dbSNP
rs1293939252 902 dbSNP
rs1338377953 905 dbSNP
rs898728223 908 dbSNP
rs1333238540 909 dbSNP
rs996998890 910 dbSNP
rs1357465978 913 dbSNP
rs1404266433 915 dbSNP
rs747178026 915 dbSNP
rs1419039079 925 dbSNP
rs532195982 931 dbSNP
rs753183806 932 dbSNP
rs1368161037 934 dbSNP
rs1007968881 935 dbSNP
rs558160482 942 dbSNP
rs1031801646 943 dbSNP
rs1261482324 944 dbSNP
rs932205901 945 dbSNP
rs1488915965 947 dbSNP
rs1259346761 950 dbSNP
rs550837670 951 dbSNP
rs763401964 952 dbSNP
rs1245077064 954 dbSNP
rs1341984248 955 dbSNP
rs1276101142 956 dbSNP
rs1487067167 956 dbSNP
rs985189020 956 dbSNP
rs758826683 958 dbSNP
rs1192526094 962 dbSNP
rs1403730937 968 dbSNP
rs569063799 971 dbSNP
rs1163983617 972 dbSNP
rs1459653416 976 dbSNP
rs1475890080 977 dbSNP
rs1421872024 978 dbSNP
rs1193447803 986 dbSNP
rs1478422428 988 dbSNP
rs1266049443 990 dbSNP
rs1185216181 991 dbSNP
rs941101618 993 dbSNP
rs1449310682 995 dbSNP
rs1412975516 1000 dbSNP
rs1210017014 1001 dbSNP
rs3209850 1002 dbSNP
rs1333344324 1003 dbSNP
rs3209851 1003 dbSNP
rs529860272 1003 dbSNP
rs573157025 1003 dbSNP
rs1434216842 1004 dbSNP
rs1419663176 1005 dbSNP
rs1324307198 1006 dbSNP
rs1398437677 1007 dbSNP
rs879078009 1007 dbSNP
rs1160929768 1011 dbSNP
rs955733223 1013 dbSNP
rs1170393098 1014 dbSNP
rs1171282012 1015 dbSNP
rs1245588810 1015 dbSNP
rs1426241795 1015 dbSNP
rs1466532949 1015 dbSNP
rs1478002478 1015 dbSNP
rs896822535 1017 dbSNP
rs1469513982 1018 dbSNP
rs1343244631 1019 dbSNP
rs1197770749 1020 dbSNP
rs1274871341 1022 dbSNP
rs1318247291 1022 dbSNP
rs1217357350 1023 dbSNP
rs1236665811 1023 dbSNP
rs1275491007 1023 dbSNP
rs1344258606 1023 dbSNP
rs1374951474 1023 dbSNP
rs989790532 1025 dbSNP
rs372058314 1026 dbSNP
rs1447815417 1027 dbSNP
rs1402851562 1028 dbSNP
rs1332648988 1029 dbSNP
rs1414376488 1029 dbSNP
rs1313684713 1030 dbSNP
rs939232510 1030 dbSNP
rs1377542649 1031 dbSNP
rs1377949960 1032 dbSNP
rs1021563792 1033 dbSNP
rs1056419187 1033 dbSNP
rs1207804235 1033 dbSNP
rs1279331282 1033 dbSNP
rs1457950185 1033 dbSNP
rs796750510 1033 dbSNP
rs969952419 1039 dbSNP
rs1012061187 1041 dbSNP
rs894969421 1041 dbSNP
rs1022325807 1042 dbSNP
rs1241098871 1044 dbSNP
rs1282769145 1044 dbSNP
rs1447830264 1045 dbSNP
rs979957778 1045 dbSNP
rs142990183 1047 dbSNP
rs999585326 1051 dbSNP
rs1358016510 1052 dbSNP
rs1374611823 1053 dbSNP
rs1409783451 1056 dbSNP
rs939468203 1056 dbSNP
rs1225982152 1057 dbSNP
rs1305260076 1058 dbSNP
rs1472305903 1064 dbSNP
rs1237856261 1067 dbSNP
rs1212877828 1068 dbSNP
rs1353467538 1077 dbSNP
rs1487287924 1083 dbSNP
rs1212108385 1084 dbSNP
rs1285364312 1086 dbSNP
rs1280563541 1093 dbSNP
rs1217505813 1099 dbSNP
rs1031384363 1100 dbSNP
rs966103446 1108 dbSNP
rs1227961818 1110 dbSNP
rs1380272097 1119 dbSNP
rs992263966 1120 dbSNP
rs1486488618 1122 dbSNP
rs976735553 1122 dbSNP
rs1207402585 1124 dbSNP
rs908582006 1126 dbSNP
rs940044791 1133 dbSNP
rs1029267860 1136 dbSNP
rs373804339 1140 dbSNP
rs1346460791 1145 dbSNP
rs898773940 1148 dbSNP
rs1236402005 1151 dbSNP
rs1404423165 1151 dbSNP
rs1480894067 1155 dbSNP
rs932902340 1156 dbSNP
rs1378453949 1160 dbSNP
rs1262464827 1162 dbSNP
rs1194468151 1166 dbSNP
rs1486848997 1166 dbSNP
rs1245065803 1173 dbSNP
rs1221043767 1174 dbSNP
rs1438812918 1178 dbSNP
rs909397769 1180 dbSNP
rs962414199 1182 dbSNP
rs972485679 1184 dbSNP
rs1397103023 1186 dbSNP
rs1279317312 1187 dbSNP
rs764663486 1192 dbSNP
rs918240351 1193 dbSNP
rs1291320065 1195 dbSNP
rs1435274731 1196 dbSNP
rs184800803 1205 dbSNP
rs867787013 1207 dbSNP
rs1333512112 1213 dbSNP
rs1463925812 1222 dbSNP
rs1422656524 1225 dbSNP
rs375201494 1240 dbSNP
rs764607984 1241 dbSNP
rs1444933804 1242 dbSNP
rs1050381326 1243 dbSNP
rs1056766634 1255 dbSNP
rs751163521 1257 dbSNP
rs1296935508 1258 dbSNP
rs1196990900 1259 dbSNP
rs1376865642 1259 dbSNP
rs1008770969 1261 dbSNP
rs1031437315 1262 dbSNP
rs1235480862 1262 dbSNP
rs1310999641 1263 dbSNP
rs1306169186 1268 dbSNP
rs566625299 1275 dbSNP
rs1349531703 1277 dbSNP
rs756892985 1280 dbSNP
rs1277229975 1285 dbSNP
rs1043519275 1287 dbSNP
rs903700900 1287 dbSNP
rs1327417837 1288 dbSNP
rs1444137266 1299 dbSNP
rs1399210565 1300 dbSNP
rs1298563872 1301 dbSNP
rs1437879208 1307 dbSNP
rs891508472 1308 dbSNP
rs767007125 1309 dbSNP
rs1206056139 1313 dbSNP
rs1396982067 1321 dbSNP
rs751966245 1322 dbSNP
rs1239135761 1331 dbSNP
rs1197974070 1332 dbSNP
rs1482553356 1336 dbSNP
rs1021283410 1338 dbSNP
rs1457307359 1349 dbSNP
rs1255989391 1350 dbSNP
rs1211448808 1352 dbSNP
rs576870510 1354 dbSNP
rs1193963819 1371 dbSNP
rs901820252 1374 dbSNP
rs1237459592 1376 dbSNP
rs1375748525 1387 dbSNP
rs997555171 1390 dbSNP
rs1029421384 1394 dbSNP
rs1392979509 1398 dbSNP
rs953585302 1400 dbSNP
rs1477141162 1404 dbSNP
rs544304400 1406 dbSNP
rs1377312571 1407 dbSNP
rs1420554736 1410 dbSNP
rs1439291430 1416 dbSNP
rs1411702082 1420 dbSNP
rs1168512454 1422 dbSNP
rs535034712 1431 dbSNP
rs1442304509 1444 dbSNP
rs1422359065 1447 dbSNP
rs1328268470 1448 dbSNP
rs970004878 1452 dbSNP
rs868244065 1453 dbSNP
rs1486960146 1454 dbSNP
rs1436263896 1458 dbSNP
rs1016408423 1461 dbSNP
rs1273843260 1461 dbSNP
rs1339736066 1462 dbSNP
rs1261018524 1467 dbSNP
rs201386885 1472 dbSNP
rs980009954 1473 dbSNP
rs1317151191 1476 dbSNP
rs1035982475 1480 dbSNP
rs1214278575 1486 dbSNP
rs1274763858 1489 dbSNP
rs1357340042 1491 dbSNP
rs972891402 1491 dbSNP
rs959902313 1493 dbSNP
rs1324237914 1498 dbSNP
rs1385764709 1498 dbSNP
rs796991681 1498 dbSNP
rs1449635202 1499 dbSNP
rs1197954085 1500 dbSNP
rs960641877 1502 dbSNP
rs916253138 1503 dbSNP
rs991811657 1503 dbSNP
rs1190873075 1504 dbSNP
rs1353867627 1508 dbSNP
rs983667229 1508 dbSNP
rs1423017451 1514 dbSNP
rs1233732213 1518 dbSNP
rs1462376473 1518 dbSNP
rs1043656913 1519 dbSNP
rs552910440 1519 dbSNP
rs1327054726 1522 dbSNP
rs1352455381 1523 dbSNP
rs1385280638 1523 dbSNP
rs925113372 1524 dbSNP
rs1405133766 1527 dbSNP
rs1463407393 1528 dbSNP
rs1207536259 1531 dbSNP
rs1326593676 1534 dbSNP
rs1432462436 1535 dbSNP
rs1373119551 1538 dbSNP
rs1275711953 1544 dbSNP
rs1213931099 1545 dbSNP
rs1252061189 1545 dbSNP
rs1449498695 1545 dbSNP
rs1469598598 1545 dbSNP
rs1339304659 1550 dbSNP
rs1206687329 1552 dbSNP
rs1233421853 1552 dbSNP
rs1213884285 1553 dbSNP
rs1231233639 1553 dbSNP
rs1271982217 1553 dbSNP
rs1326752050 1553 dbSNP
rs1330738269 1553 dbSNP
rs878928189 1553 dbSNP
rs1274938083 1555 dbSNP
rs1443398080 1555 dbSNP
rs1354245346 1557 dbSNP
rs908638604 1557 dbSNP
rs1331144724 1558 dbSNP
rs1209010968 1560 dbSNP
rs1410995785 1561 dbSNP
rs1399329446 1562 dbSNP
rs1169137756 1563 dbSNP
rs1284713066 1563 dbSNP
rs11346868 1564 dbSNP
rs1198668071 1564 dbSNP
rs1275118202 1564 dbSNP
rs1304294666 1564 dbSNP
rs1438313518 1564 dbSNP
rs1476715771 1564 dbSNP
rs1488809770 1564 dbSNP
rs199698020 1564 dbSNP
rs201335371 1564 dbSNP
rs70993262 1564 dbSNP
rs75387434 1564 dbSNP
rs1236733264 1565 dbSNP
rs1375016988 1566 dbSNP
rs1448892433 1566 dbSNP
rs1214764750 1568 dbSNP
rs1279322510 1568 dbSNP
rs1356643845 1569 dbSNP
rs1332700514 1570 dbSNP
rs1262797662 1571 dbSNP
rs1173767331 1572 dbSNP
rs1231939090 1572 dbSNP
rs1436176108 1573 dbSNP
rs1475556823 1573 dbSNP
rs1378165618 1574 dbSNP
rs1190231462 1575 dbSNP
rs1234409678 1576 dbSNP
rs1367219122 1576 dbSNP
rs935187114 1576 dbSNP
rs1185269000 1578 dbSNP
rs1255246084 1583 dbSNP
rs1485326561 1583 dbSNP
rs1472765092 1584 dbSNP
rs1159442354 1585 dbSNP
rs1387634883 1586 dbSNP
rs1351775579 1587 dbSNP
rs149981162 1587 dbSNP
rs538745471 1590 dbSNP
rs1421087164 1591 dbSNP
rs1295939658 1594 dbSNP
rs1359550471 1597 dbSNP
rs755830616 1599 dbSNP
rs1052932896 1602 dbSNP
rs1314325967 1604 dbSNP
rs1338573397 1606 dbSNP
rs1312946577 1610 dbSNP
rs1416165035 1611 dbSNP
rs559859461 1613 dbSNP
rs1279883059 1617 dbSNP
rs1157843791 1622 dbSNP
rs901898181 1624 dbSNP
rs1409838806 1627 dbSNP
rs1161294760 1636 dbSNP
rs1258218293 1636 dbSNP
rs1474831234 1636 dbSNP
rs1352605629 1643 dbSNP
rs1487315042 1649 dbSNP
rs1241614741 1656 dbSNP
rs1237738586 1670 dbSNP
rs1285568445 1671 dbSNP
rs998026747 1676 dbSNP
rs557175079 1679 dbSNP
rs200398064 1680 dbSNP
rs1050408770 1682 dbSNP
rs1213040851 1683 dbSNP
rs551616148 1684 dbSNP
rs889127907 1685 dbSNP
rs1287816099 1687 dbSNP
rs556251795 1691 dbSNP
rs749095489 1691 dbSNP
rs770317623 1691 dbSNP
rs1323639493 1692 dbSNP
rs1460665706 1694 dbSNP
rs1418320933 1697 dbSNP
rs575781468 1699 dbSNP
rs1476815925 1701 dbSNP
rs897977974 1701 dbSNP
rs1418850816 1702 dbSNP
rs940088775 1711 dbSNP
rs1486967071 1714 dbSNP
rs974082718 1716 dbSNP
rs1213307615 1717 dbSNP
rs1183189857 1721 dbSNP
rs1366108164 1760 dbSNP
rs1217295986 1774 dbSNP
rs1036285192 1776 dbSNP
rs919919237 1778 dbSNP
rs1158492239 1783 dbSNP
rs189391383 1789 dbSNP
rs1363457575 1797 dbSNP
rs1300730236 1799 dbSNP
rs555267051 1805 dbSNP
rs1394891351 1809 dbSNP
rs932619593 1810 dbSNP
rs749882049 1814 dbSNP
rs868020907 1823 dbSNP
rs1327711250 1825 dbSNP
rs755665020 1826 dbSNP
rs180923473 1828 dbSNP
rs1379291205 1829 dbSNP
rs540233966 1829 dbSNP
rs1434966305 1842 dbSNP
rs1430317428 1843 dbSNP
rs1304014552 1845 dbSNP
rs960466258 1849 dbSNP
rs944232069 1855 dbSNP
rs564867245 1862 dbSNP
rs891577417 1878 dbSNP
rs1197207101 1880 dbSNP
rs200289141 1892 dbSNP
rs969063549 1893 dbSNP
rs1011329842 1906 dbSNP
rs1207259529 1912 dbSNP
rs779963265 1913 dbSNP
rs1308694111 1916 dbSNP
rs905537503 1920 dbSNP
rs1277610089 1931 dbSNP
rs1371339228 1932 dbSNP
rs1001569510 1943 dbSNP
rs925228895 1945 dbSNP
rs1298624908 1947 dbSNP
rs1463484240 1948 dbSNP
rs546828315 1949 dbSNP
rs1173139904 1951 dbSNP
rs1435547522 1954 dbSNP
rs774378839 1955 dbSNP
rs1035630370 1967 dbSNP
rs1179931562 1970 dbSNP
rs184779509 1975 dbSNP
rs1179418010 1979 dbSNP
rs544308760 1982 dbSNP
rs1482584553 1993 dbSNP
rs1277541078 1996 dbSNP
rs868347616 1999 dbSNP
rs1348152912 2000 dbSNP
rs1281942751 2001 dbSNP
rs1236452540 2004 dbSNP
rs1254274898 2005 dbSNP
rs1015168588 2008 dbSNP
rs1344370268 2016 dbSNP
rs1393035269 2021 dbSNP
rs772026753 2023 dbSNP
rs961474714 2031 dbSNP
rs3192372 2036 dbSNP
rs562700047 2048 dbSNP
rs1312345373 2052 dbSNP
rs1415401012 2057 dbSNP
rs1196499982 2058 dbSNP
rs1377368719 2063 dbSNP
rs776616562 2065 dbSNP
rs1253285154 2073 dbSNP
rs1263865380 2076 dbSNP
rs1453354653 2077 dbSNP
rs1364702964 2079 dbSNP
rs1050980175 2082 dbSNP
rs1474503286 2086 dbSNP
rs889119753 2091 dbSNP
rs1189277653 2092 dbSNP
rs974136530 2093 dbSNP
rs942033488 2098 dbSNP
rs1257689653 2100 dbSNP
rs529920193 2102 dbSNP
rs898053220 2103 dbSNP
rs144734333 2110 dbSNP
rs1240993586 2113 dbSNP
rs985834335 2114 dbSNP
rs759689295 2118 dbSNP
rs1233845081 2123 dbSNP
rs1035825909 2131 dbSNP
rs1375629792 2145 dbSNP
rs1316358636 2151 dbSNP
rs1381839130 2156 dbSNP
rs1386018973 2166 dbSNP
rs1290999639 2168 dbSNP
rs1465101277 2170 dbSNP
rs367694993 2172 dbSNP
rs1166228169 2174 dbSNP
rs895982070 2174 dbSNP
rs1168047373 2192 dbSNP
rs1369662811 2195 dbSNP
rs566769836 2195 dbSNP
rs527546877 2199 dbSNP
rs944270672 2200 dbSNP
rs1190461919 2202 dbSNP
rs1023362818 2206 dbSNP
rs1261911607 2206 dbSNP
rs1446053588 2206 dbSNP
rs1466931749 2207 dbSNP
rs969010916 2210 dbSNP
rs1214209127 2215 dbSNP
rs1053331039 2216 dbSNP
rs1268476654 2217 dbSNP
rs1226871084 2221 dbSNP
rs765617011 2235 dbSNP
rs879249672 2235 dbSNP
rs1439017987 2236 dbSNP
rs778685534 2236 dbSNP
rs1394158384 2239 dbSNP
rs1327042878 2241 dbSNP
rs1463455540 2242 dbSNP
rs913397592 2250 dbSNP
rs747212000 2254 dbSNP
rs1042831160 2260 dbSNP
rs1299428421 2262 dbSNP
rs905588228 2263 dbSNP
rs1452227689 2267 dbSNP
rs1491229148 2268 dbSNP
rs1001222943 2269 dbSNP
rs1491122788 2269 dbSNP
rs546635793 2270 dbSNP
rs1260092401 2275 dbSNP
rs571298531 2294 dbSNP
rs1276905495 2299 dbSNP
rs988470093 2306 dbSNP
rs923120469 2314 dbSNP
rs933189299 2323 dbSNP
rs189589692 2325 dbSNP
rs1057190113 2332 dbSNP
rs986197173 2336 dbSNP
rs1411044860 2341 dbSNP
rs910668769 2341 dbSNP
rs1470092400 2347 dbSNP
rs1432460895 2348 dbSNP
rs942106961 2352 dbSNP
rs895770773 2359 dbSNP
rs1193880754 2361 dbSNP
rs1189904825 2362 dbSNP
rs1230986934 2364 dbSNP
rs1264805709 2364 dbSNP
rs775784146 2365 dbSNP
rs1180956230 2384 dbSNP
rs1037683545 2389 dbSNP
rs550640811 2390 dbSNP
rs1208895108 2396 dbSNP
rs1347425361 2400 dbSNP
rs1281225984 2401 dbSNP
rs1221175671 2403 dbSNP
rs1005199306 2407 dbSNP
rs1463953369 2409 dbSNP
rs569227343 2423 dbSNP
rs760294006 2424 dbSNP
rs766072914 2429 dbSNP
rs1443533130 2434 dbSNP
rs771079525 2434 dbSNP
rs759035843 2437 dbSNP
rs544262784 2452 dbSNP
rs895964575 2452 dbSNP
rs994604125 2452 dbSNP
rs1157832315 2456 dbSNP
rs1044553032 2468 dbSNP
rs904926250 2469 dbSNP
rs1459246189 2470 dbSNP
rs1000573405 2473 dbSNP
rs1258354571 2475 dbSNP
rs762176006 2476 dbSNP
rs552581661 2480 dbSNP
rs1009484580 2482 dbSNP
rs1224749203 2484 dbSNP
rs985500275 2485 dbSNP
rs776959407 2500 dbSNP
rs1233237648 2502 dbSNP
rs745904663 2512 dbSNP
rs954555766 2514 dbSNP
rs1052050 2516 dbSNP
rs770060901 2517 dbSNP
rs1280132699 2528 dbSNP
rs1343131325 2530 dbSNP
rs764809326 2530 dbSNP
rs1218149956 2532 dbSNP
rs11556729 2535 dbSNP
rs910408110 2535 dbSNP
rs989478143 2536 dbSNP
rs1162649838 2540 dbSNP
rs1474862168 2541 dbSNP
rs1324083572 2542 dbSNP
rs973493435 2542 dbSNP
rs1474544630 2543 dbSNP
rs1219744026 2544 dbSNP
rs1216785533 2551 dbSNP
rs1265227940 2552 dbSNP
rs1487930938 2555 dbSNP
rs1216910014 2564 dbSNP
rs1271699979 2567 dbSNP
rs1213584357 2568 dbSNP
rs919258014 2571 dbSNP
rs1264945538 2572 dbSNP
rs1312791240 2578 dbSNP
rs1229602606 2579 dbSNP
rs1359262670 2580 dbSNP
rs929319327 2582 dbSNP
rs913449631 2590 dbSNP
rs1192387395 2595 dbSNP
rs947554617 2595 dbSNP
rs1418468691 2599 dbSNP
rs1390523891 2604 dbSNP
rs1057367369 2617 dbSNP
rs1460846565 2617 dbSNP
rs376065005 2617 dbSNP
rs776123291 2621 dbSNP
rs763565285 2636 dbSNP
rs1166833745 2651 dbSNP
rs917458855 2653 dbSNP
rs1418920083 2661 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293
Disease 6659.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "HITS-CLIP data was present in GSM714642. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 6659.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 6659.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions C8166
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3 ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_003107 | 3UTR | UUUUGUUUUUAAACUUUUUUUUGCCAUCCAUCCUGUGCAAUAUGCCGUGUAGAAUAUUUGUCUUAAAAUUCAAGGCCACAAAAACAAUGUUUGGGGGAAAAAAAAGAAAAAAUCAUGCCAGCUAAUCAUGUCAAGUUCACUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_003107 | 3UTR | UUUUGUUUUUAAACUUUUUUUUGCCAUCCAUCCUGUGCAAUAUGCCGUGUAGAAUAUUUGUCUUAAAAUUCAAGGCCACAAAAACAAUGUUUGGGGGAAAAAAAAGAAAAAAUCAUGCCAGCUAAUCAUGUCAAGUUCACUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4903834
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_b
Location of target site NM_003107 | 3UTR | UGUUUUUAAACUUUUUUUUGCCAUCCAUCCUGUGCAAUAUGCCGUGUAGAAUAUUUGUCUUAAAAUUCAAGGCCACAAAAACAAUGUUUGGGGGAAAAAAAAGAAAAAAUCAUGCCAGCUAAUCAUGUCAAGUUCACUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM4903834
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_b
Location of target site NM_003107 | 3UTR | UGUUUUUAAACUUUUUUUUGCCAUCCAUCCUGUGCAAUAUGCCGUGUAGAAUAUUUGUCUUAAAAUUCAAGGCCACAAAAACAAUGUUUGGGGGAAAAAAAAGAAAAAAUCAUGCCAGCUAAUCAUGUCAAGUUCACUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM4903835
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_c
Location of target site NM_003107 | 3UTR | UUUUUGUUUUUAAACUUUUUUUUGCCAUCCAUCCUGUGCAAUAUGCCGUGUAGAAUAUUUGUCUUAAAAUUCAAGGCCACAAAAACAAUGUUUGGGGGAAAAAAAAGAAAAAAUCAUGCCAGCUAAUCAUGUCAAGUUCACUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM4903835
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_c
Location of target site NM_003107 | 3UTR | UUUUUGUUUUUAAACUUUUUUUUGCCAUCCAUCCUGUGCAAUAUGCCGUGUAGAAUAUUUGUCUUAAAAUUCAAGGCCACAAAAACAAUGUUUGGGGGAAAAAAAAGAAAAAAUCAUGCCAGCUAAUCAUGUCAAGUUCACUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM4903836
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_a
Location of target site NM_003107 | 3UTR | UUUUGUUUUUAAACUUUUUUUUGCCAUCCAUCCUGUGCAAUAUGCCGUGUAGAAUAUUUGUCUUAAAAUUCAAGGCCACAAAAACAAUGUUUGGGGGAAAAAAAAGAAAAAAUCAUGCCAGCUAAUCAUGUCAAGUUCACUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM4903836
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_a
Location of target site NM_003107 | 3UTR | UUUUGUUUUUAAACUUUUUUUUGCCAUCCAUCCUGUGCAAUAUGCCGUGUAGAAUAUUUGUCUUAAAAUUCAAGGCCACAAAAACAAUGUUUGGGGGAAAAAAAAGAAAAAAUCAUGCCAGCUAAUCAUGUCAAGUUCACUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM4903837
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_b
Location of target site NM_003107 | 3UTR | UUUUGUUUUUAAACUUUUUUUUGCCAUCCAUCCUGUGCAAUAUGCCGUGUAGAAUAUUUGUCUUAAAAUUCAAGGCCACAAAAACAAUGUUUGGGGGAAAAAAAAGAAAAAAUCAUGCCAGCUAAUCAUGUCAAGUUCACUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset GSM4903837
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_b
Location of target site NM_003107 | 3UTR | UUUUGUUUUUAAACUUUUUUUUGCCAUCCAUCCUGUGCAAUAUGCCGUGUAGAAUAUUUGUCUUAAAAUUCAAGGCCACAAAAACAAUGUUUGGGGGAAAAAAAAGAAAAAAUCAUGCCAGCUAAUCAUGUCAAGUUCACUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 11 for dataset GSM4903838
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_c
Location of target site NM_003107 | 3UTR | UGUUUUUAAACUUUUUUUUGCCAUCCAUCCUGUGCAAUAUGCCGUGUAGAAUAUUUGUCUUAAAAUUCAAGGCCACAAAAACAAUGUUUGGGGGAAAAAAAAGAAAAAAUCAUGCCAGCUAAUCAUGUCAAGUUCACUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 12 for dataset GSM4903838
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_c
Location of target site NM_003107 | 3UTR | UGUUUUUAAACUUUUUUUUGCCAUCCAUCCUGUGCAAUAUGCCGUGUAGAAUAUUUGUCUUAAAAUUCAAGGCCACAAAAACAAUGUUUGGGGGAAAAAAAAGAAAAAAUCAUGCCAGCUAAUCAUGUCAAGUUCACUGC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 13 for dataset GSM714642
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000244745.1 | 3UTR | UUAAACUUUUUUUUGCCAUCCAUCCUGUGCAAUAUGCCGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 14 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000244745.1 | 3UTR | UUUAAACUUUUUUUUGCCAUCCAUCCUGUGCAAUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 15 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000244745.1 | 3UTR | UUUAAACUUUUUUUUGCCAUCCAUCCUGUGCAAUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 16 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000244745.1 | 3UTR | UUUUUAAACUUUUUUUUGCCAUCCAUCCUGUGCAAUAUGCCGUGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 17 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000244745.1 | 3UTR | UUUUAAACUUUUUUUUGCCAUCCAUCCUGUGCAAUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 18 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000244745.1 | 3UTR | UUUUUAAACUUUUUUUUGCCAUCCAUCCUGUGCAAUAUGCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
CLIP-seq Support 19 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000244745.1 | 3UTR | UUUUUAAACUUUUUUUUGCCAUCCAUCCUGUGCAAUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 20 for dataset GSM1462572
Method / RBP PAR-CLIP / AGO2
Cell line / Condition C8166 / C8166 NL4-3
Location of target site ENST00000244745.1 | 3UTR | UAAACUUUUUUUUGCCAUCCAUCCUGUGCAAUAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
275 hsa-miR-548ac Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT055863 BUB3 BUB3, mitotic checkpoint protein 2 2
MIRT074959 LEPROT leptin receptor overlapping transcript 2 2
MIRT076823 SUZ12 SUZ12 polycomb repressive complex 2 subunit 2 4
MIRT078708 LLGL2 LLGL2, scribble cell polarity complex component 2 2
MIRT099610 ID4 inhibitor of DNA binding 4, HLH protein 2 4
MIRT103362 CBX3 chromobox 3 2 2
MIRT111801 MPZL1 myelin protein zero like 1 2 2
MIRT114050 AKAP11 A-kinase anchoring protein 11 2 12
MIRT133719 SKI SKI proto-oncogene 2 2
MIRT136817 NHLRC3 NHL repeat containing 3 2 6
MIRT149926 LDLR low density lipoprotein receptor 2 2
MIRT166915 TNPO1 transportin 1 2 2
MIRT168142 SOX4 SRY-box 4 2 10
MIRT190787 STRN3 striatin 3 2 4
MIRT207471 RMND5A required for meiotic nuclear division 5 homolog A 2 2
MIRT250951 CDK5R1 cyclin dependent kinase 5 regulatory subunit 1 2 4
MIRT271993 ARF1 ADP ribosylation factor 1 2 4
MIRT282618 IGF1R insulin like growth factor 1 receptor 2 8
MIRT294153 ZNF845 zinc finger protein 845 2 2
MIRT309060 C4ORF3 chromosome 4 open reading frame 3 2 2
MIRT318548 SYNCRIP synaptotagmin binding cytoplasmic RNA interacting protein 2 2
MIRT319752 LUC7L2 LUC7 like 2, pre-mRNA splicing factor 2 2
MIRT331324 TM9SF3 transmembrane 9 superfamily member 3 2 2
MIRT337204 TOMM20 translocase of outer mitochondrial membrane 20 2 6
MIRT346145 ALYREF Aly/REF export factor 2 2
MIRT347727 LSM14A LSM14A, mRNA processing body assembly factor 2 2
MIRT350503 MRGBP MRG domain binding protein 2 6
MIRT356409 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 2
MIRT357986 GRPEL2 GrpE like 2, mitochondrial 2 2
MIRT374399 M6PR mannose-6-phosphate receptor, cation dependent 2 6
MIRT442727 TMEM158 transmembrane protein 158 (gene/pseudogene) 2 2
MIRT443411 HMX3 H6 family homeobox 3 2 2
MIRT444408 FRMD5 FERM domain containing 5 2 2
MIRT444469 PTPRG protein tyrosine phosphatase, receptor type G 2 2
MIRT444650 HSBP1 heat shock factor binding protein 1 2 2
MIRT444861 EXD2 exonuclease 3'-5' domain containing 2 2 2
MIRT445685 TNFSF15 TNF superfamily member 15 2 2
MIRT446001 CD1D CD1d molecule 2 2
MIRT446074 RABIF RAB interacting factor 2 2
MIRT446308 ACSL3 acyl-CoA synthetase long chain family member 3 2 2
MIRT446432 ABHD2 abhydrolase domain containing 2 2 2
MIRT447269 C3orf30 chromosome 3 open reading frame 30 2 2
MIRT447759 TMCC3 transmembrane and coiled-coil domain family 3 2 2
MIRT448161 P2RY10 purinergic receptor P2Y10 2 2
MIRT449049 ADAMTS5 ADAM metallopeptidase with thrombospondin type 1 motif 5 2 2
MIRT449275 PALM2 paralemmin 2 2 2
MIRT450122 IMP3 IMP3, U3 small nucleolar ribonucleoprotein 2 2
MIRT450155 GABRB3 gamma-aminobutyric acid type A receptor beta3 subunit 2 2
MIRT451289 ZNF101 zinc finger protein 101 2 2
MIRT459253 ADRBK1 G protein-coupled receptor kinase 2 2 2
MIRT462554 NUDT19 nudix hydrolase 19 2 2
MIRT464470 UGCG UDP-glucose ceramide glucosyltransferase 2 2
MIRT465120 TSC22D2 TSC22 domain family member 2 2 4
MIRT467996 SKIL SKI like proto-oncogene 2 2
MIRT468718 SDC4 syndecan 4 2 2
MIRT469269 RHOB ras homolog family member B 2 2
MIRT470675 POLR2D RNA polymerase II subunit D 2 4
MIRT470723 POGK pogo transposable element derived with KRAB domain 2 2
MIRT471438 PDIA6 protein disulfide isomerase family A member 6 2 2
MIRT471502 PDE4D phosphodiesterase 4D 2 4
MIRT471988 NR2F2 nuclear receptor subfamily 2 group F member 2 2 4
MIRT472386 NEK7 NIMA related kinase 7 2 2
MIRT475028 KANSL1 KAT8 regulatory NSL complex subunit 1 2 8
MIRT479411 CDKN1B cyclin dependent kinase inhibitor 1B 2 10
MIRT480514 C11orf57 chromosome 11 open reading frame 57 2 2
MIRT481700 AR androgen receptor 2 2
MIRT482543 ACTB actin beta 2 4
MIRT482627 ABCE1 ATP binding cassette subfamily E member 1 2 2
MIRT484725 INHBA inhibin beta A subunit 2 12
MIRT487778 ANKEF1 ankyrin repeat and EF-hand domain containing 1 2 16
MIRT491883 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 2
MIRT494653 ARNTL aryl hydrocarbon receptor nuclear translocator like 2 2
MIRT497366 SF1 splicing factor 1 2 2
MIRT499156 HSPA1B heat shock protein family A (Hsp70) member 1B 2 8
MIRT502830 CELSR3 cadherin EGF LAG seven-pass G-type receptor 3 2 6
MIRT502944 CDC37L1 cell division cycle 37 like 1 2 8
MIRT503942 FBXL13 F-box and leucine rich repeat protein 13 2 4
MIRT504235 MYO6 myosin VI 2 2
MIRT504453 MC2R melanocortin 2 receptor 2 2
MIRT506022 PURA purine rich element binding protein A 2 2
MIRT508028 BCAT1 branched chain amino acid transaminase 1 2 4
MIRT508299 YES1 YES proto-oncogene 1, Src family tyrosine kinase 2 4
MIRT511515 HMGN2 high mobility group nucleosomal binding domain 2 2 2
MIRT512307 AMER1 APC membrane recruitment protein 1 2 6
MIRT514565 XRCC3 X-ray repair cross complementing 3 2 4
MIRT515657 MYBPC1 myosin binding protein C, slow type 2 2
MIRT518429 SSU72 SSU72 homolog, RNA polymerase II CTD phosphatase 2 2
MIRT520378 UBE2D1 ubiquitin conjugating enzyme E2 D1 2 4
MIRT521604 PSMA2 proteasome subunit alpha 2 2 4
MIRT521725 PPP3R1 protein phosphatase 3 regulatory subunit B, alpha 2 4
MIRT522579 MBNL3 muscleblind like splicing regulator 3 2 4
MIRT522731 LRRC55 leucine rich repeat containing 55 2 8
MIRT524547 CDC5L cell division cycle 5 like 2 4
MIRT525371 SYNM synemin 2 2
MIRT526489 PPIA peptidylprolyl isomerase A 2 4
MIRT527197 CLASP1 cytoplasmic linker associated protein 1 2 2
MIRT527285 FBLN2 fibulin 2 2 2
MIRT527383 MGARP mitochondria localized glutamic acid rich protein 2 2
MIRT527409 SMU1 DNA replication regulator and spliceosomal factor 2 6
MIRT527454 COL4A3 collagen type IV alpha 3 chain 2 2
MIRT528348 TBC1D22B TBC1 domain family member 22B 2 2
MIRT529104 ZNF100 zinc finger protein 100 2 2
MIRT529317 ATRNL1 attractin like 1 2 2
MIRT529328 PDE5A phosphodiesterase 5A 2 2
MIRT529750 SEL1L SEL1L ERAD E3 ligase adaptor subunit 2 2
MIRT530277 MKRN3 makorin ring finger protein 3 2 2
MIRT531415 TMEM18 transmembrane protein 18 2 2
MIRT532544 WDR13 WD repeat domain 13 2 2
MIRT533245 VKORC1L1 vitamin K epoxide reductase complex subunit 1 like 1 2 2
MIRT534659 RNF20 ring finger protein 20 2 2
MIRT534818 RAB33B RAB33B, member RAS oncogene family 2 2
MIRT537492 FAM169A family with sequence similarity 169 member A 2 2
MIRT538778 CABLES1 Cdk5 and Abl enzyme substrate 1 2 2
MIRT539122 ARL10 ADP ribosylation factor like GTPase 10 2 2
MIRT540964 SLC25A43 solute carrier family 25 member 43 2 2
MIRT541403 CDC27 cell division cycle 27 2 2
MIRT543353 ZNF829 zinc finger protein 829 2 2
MIRT543623 MFAP3 microfibril associated protein 3 2 2
MIRT543649 YY2 YY2 transcription factor 2 2
MIRT544945 SNCB synuclein beta 2 2
MIRT545327 SPC25 SPC25, NDC80 kinetochore complex component 2 2
MIRT546094 VEZF1 vascular endothelial zinc finger 1 2 2
MIRT548605 DCUN1D3 defective in cullin neddylation 1 domain containing 3 2 2
MIRT548638 DAZAP1 DAZ associated protein 1 2 4
MIRT550318 ZNF681 zinc finger protein 681 2 2
MIRT550412 SLC29A1 solute carrier family 29 member 1 (Augustine blood group) 2 4
MIRT551034 SPPL3 signal peptide peptidase like 3 2 2
MIRT551602 HDGFRP2 HDGF like 2 2 2
MIRT552064 ALG1 ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase 2 4
MIRT552803 YAF2 YY1 associated factor 2 2 2
MIRT553274 TVP23C trans-golgi network vesicle protein 23 homolog C 2 2
MIRT553303 TSPAN3 tetraspanin 3 2 2
MIRT553570 NPM3 nucleophosmin/nucleoplasmin 3 2 2
MIRT554844 RECK reversion inducing cysteine rich protein with kazal motifs 2 2
MIRT556069 MTF2 metal response element binding transcription factor 2 2 4
MIRT556898 ITGA2 integrin subunit alpha 2 2 2
MIRT558680 CNIH cornichon family AMPA receptor auxiliary protein 1 1 1
MIRT559032 C20orf24 chromosome 20 open reading frame 24 2 2
MIRT559108 C18orf25 chromosome 18 open reading frame 25 2 2
MIRT559864 GSKIP GSK3B interacting protein 2 2
MIRT560868 GAL3ST3 galactose-3-O-sulfotransferase 3 2 2
MIRT562268 GRB2 growth factor receptor bound protein 2 2 2
MIRT562419 EIF2S2 eukaryotic translation initiation factor 2 subunit beta 2 2
MIRT562652 ARID1A AT-rich interaction domain 1A 2 4
MIRT563771 ZNF678 zinc finger protein 678 2 2
MIRT564279 DEPDC1B DEP domain containing 1B 2 2
MIRT565253 TRA2B transformer 2 beta homolog 2 4
MIRT565307 TMEM64 transmembrane protein 64 2 2
MIRT566034 RFX1 regulatory factor X1 2 2
MIRT566714 MTMR3 myotubularin related protein 3 2 2
MIRT568087 CELF2 CUGBP Elav-like family member 2 2 2
MIRT568417 ATF7IP activating transcription factor 7 interacting protein 2 2
MIRT568766 MYBL1 MYB proto-oncogene like 1 2 2
MIRT569516 THYN1 thymocyte nuclear protein 1 2 2
MIRT571823 PHF19 PHD finger protein 19 2 2
MIRT571995 HOXA9 homeobox A9 2 2
MIRT572174 CELF1 CUGBP Elav-like family member 1 2 2
MIRT572637 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT573756 KHSRP KH-type splicing regulatory protein 2 2
MIRT574089 CCDC132 VPS50, EARP/GARPII complex subunit 2 6
MIRT574311 CMTM6 CKLF like MARVEL transmembrane domain containing 6 2 2
MIRT574512 PSAT1 phosphoserine aminotransferase 1 2 2
MIRT574559 NRBF2 nuclear receptor binding factor 2 2 2
MIRT576686 H6pd hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase) 2 2
MIRT608491 NKTR natural killer cell triggering receptor 2 6
MIRT608640 ATP9A ATPase phospholipid transporting 9A (putative) 2 6
MIRT609231 TMEM189 transmembrane protein 189 2 2
MIRT609561 TCEAL4 transcription elongation factor A like 4 2 2
MIRT610193 FAM49A family with sequence similarity 49 member A 2 2
MIRT610681 SYT2 synaptotagmin 2 2 4
MIRT610725 NAV2 neuron navigator 2 2 2
MIRT610813 SGOL2 shugoshin 2 2 2
MIRT610993 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 2
MIRT611030 KCNK10 potassium two pore domain channel subfamily K member 10 2 2
MIRT611339 SLC2A4 solute carrier family 2 member 4 2 2
MIRT611511 HIPK3 homeodomain interacting protein kinase 3 2 2
MIRT611638 EDIL3 EGF like repeats and discoidin domains 3 2 2
MIRT611856 RPL3L ribosomal protein L3 like 2 2
MIRT611905 TRPC3 transient receptor potential cation channel subfamily C member 3 2 2
MIRT612047 PCNXL2 pecanex homolog 2 2 6
MIRT612340 TRIB2 tribbles pseudokinase 2 2 2
MIRT612870 INO80C INO80 complex subunit C 2 2
MIRT613555 AMPD3 adenosine monophosphate deaminase 3 2 2
MIRT614490 MMS22L MMS22 like, DNA repair protein 2 2
MIRT615098 BRD4 bromodomain containing 4 2 2
MIRT616228 PTPN11 protein tyrosine phosphatase, non-receptor type 11 2 2
MIRT617220 GDPGP1 GDP-D-glucose phosphorylase 1 2 2
MIRT617884 ESR1 estrogen receptor 1 2 2
MIRT618344 CD59 CD59 molecule (CD59 blood group) 2 2
MIRT620264 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 2 2
MIRT620660 CCDC108 cilia and flagella associated protein 65 2 2
MIRT620761 CCR5 C-C motif chemokine receptor 5 (gene/pseudogene) 2 2
MIRT621416 TXNL1 thioredoxin like 1 2 2
MIRT621676 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 2
MIRT622231 SLC25A51 solute carrier family 25 member 51 2 2
MIRT622377 SALL1 spalt like transcription factor 1 2 2
MIRT622404 RRAGC Ras related GTP binding C 2 2
MIRT622494 RC3H1 ring finger and CCCH-type domains 1 2 2
MIRT623064 NRXN1 neurexin 1 2 2
MIRT623295 MAX MYC associated factor X 2 2
MIRT623691 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT623930 FMNL3 formin like 3 2 2
MIRT623984 FAM208A family with sequence similarity 208 member A 2 2
MIRT624513 C7orf55-LUC7L2 C7orf55-LUC7L2 readthrough 2 2
MIRT624668 ARID4A AT-rich interaction domain 4A 2 2
MIRT624756 ANGPTL2 angiopoietin like 2 2 2
MIRT624949 MARCH2 membrane associated ring-CH-type finger 2 2 2
MIRT625968 RNF2 ring finger protein 2 2 2
MIRT626415 KIAA2018 upstream transcription factor family member 3 2 2
MIRT626882 AP3B1 adaptor related protein complex 3 beta 1 subunit 2 2
MIRT627157 ZNF652 zinc finger protein 652 2 2
MIRT627613 SFT2D2 SFT2 domain containing 2 2 2
MIRT627744 RAP2B RAP2B, member of RAS oncogene family 2 4
MIRT627808 PTEN phosphatase and tensin homolog 2 2
MIRT627820 PRR3 proline rich 3 2 2
MIRT630935 UNC93A unc-93 homolog A 2 2
MIRT635930 GLTSCR2 NOP53 ribosome biogenesis factor 2 2
MIRT638301 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT638437 PNRC1 proline rich nuclear receptor coactivator 1 2 2
MIRT640281 TCF24 transcription factor 24 2 2
MIRT641979 PCMTD2 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 2 2 2
MIRT644179 GIN1 gypsy retrotransposon integrase 1 2 2
MIRT644439 VDR vitamin D receptor 2 2
MIRT644974 STEAP4 STEAP4 metalloreductase 2 2
MIRT647653 B3GALNT1 beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group) 2 2
MIRT648702 TNFRSF13C TNF receptor superfamily member 13C 2 2
MIRT650120 ZCCHC9 zinc finger CCHC-type containing 9 2 2
MIRT650505 UFM1 ubiquitin fold modifier 1 2 2
MIRT650701 CLNK cytokine dependent hematopoietic cell linker 2 2
MIRT651083 ZNF518B zinc finger protein 518B 2 4
MIRT653644 SLC30A1 solute carrier family 30 member 1 2 2
MIRT653788 SIX4 SIX homeobox 4 2 2
MIRT656773 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT656949 KIAA1456 KIAA1456 2 2
MIRT656981 KDM5A lysine demethylase 5A 2 2
MIRT657225 TOR1AIP2 torsin 1A interacting protein 2 2 4
MIRT657706 GPC5 glypican 5 2 2
MIRT660107 BTBD3 BTB domain containing 3 2 2
MIRT662817 C9orf64 chromosome 9 open reading frame 64 2 2
MIRT665889 TGIF2 TGFB induced factor homeobox 2 2 2
MIRT668140 GINS2 GINS complex subunit 2 2 2
MIRT668566 ERCC1 ERCC excision repair 1, endonuclease non-catalytic subunit 2 2
MIRT669718 AAGAB alpha and gamma adaptin binding protein 2 2
MIRT685693 TRIM45 tripartite motif containing 45 2 2
MIRT686579 TMPPE transmembrane protein with metallophosphoesterase domain 2 2
MIRT687491 NHLRC2 NHL repeat containing 2 2 2
MIRT687805 KCNJ15 potassium voltage-gated channel subfamily J member 15 2 2
MIRT687968 HHIP hedgehog interacting protein 2 2
MIRT689487 SCIMP SLP adaptor and CSK interacting membrane protein 2 2
MIRT689595 NUDT7 nudix hydrolase 7 2 2
MIRT690501 RSRC1 arginine and serine rich coiled-coil 1 2 2
MIRT692290 XRN2 5'-3' exoribonuclease 2 2 2
MIRT693060 KIAA1324 KIAA1324 2 2
MIRT697443 ZFHX3 zinc finger homeobox 3 2 2
MIRT698475 TJP1 tight junction protein 1 2 2
MIRT699033 SOAT1 sterol O-acyltransferase 1 2 2
MIRT699785 SEMA4D semaphorin 4D 2 2
MIRT701463 NEO1 neogenin 1 2 2
MIRT701869 MRO maestro 2 2
MIRT702158 MAP3K1 mitogen-activated protein kinase kinase kinase 1 2 2
MIRT703750 FAM126B family with sequence similarity 126 member B 2 2
MIRT704277 DGS2 DiGeorge syndrome/velocardiofacial syndrome complex 2 2 2
MIRT707956 PGM3 phosphoglucomutase 3 2 2
MIRT712747 LAMTOR1 late endosomal/lysosomal adaptor, MAPK and MTOR activator 1 2 2
MIRT712848 RHOA ras homolog family member A 2 2
MIRT712954 CCBE1 collagen and calcium binding EGF domains 1 2 2
MIRT713119 U2SURP U2 snRNP associated SURP domain containing 2 2
MIRT713148 PKIA cAMP-dependent protein kinase inhibitor alpha 2 2
MIRT715394 TADA3 transcriptional adaptor 3 2 2
MIRT715475 NEGR1 neuronal growth regulator 1 2 2
MIRT715535 G2E3 G2/M-phase specific E3 ubiquitin protein ligase 2 2
MIRT721159 MYOCD myocardin 2 2
MIRT722719 ZNF460 zinc finger protein 460 2 2
MIRT723130 GTF2F2 general transcription factor IIF subunit 2 2 2
MIRT723259 TMLHE trimethyllysine hydroxylase, epsilon 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-54 Nicotine approved 89594 Microarray Caenorhabditis elegans 23765240 2013 up-regualted
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-548ac Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-miR-548ac Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-548ac Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-548ac Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-548ac Paclitaxel 36314 NSC125973 approved sensitive cell line (HS578T)
hsa-miR-548ac Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-548ac Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-548ac Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-548ac Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-548ac Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)

Error report submission