miRTarBase - #MIRT168693


—
pre-miRNA Information
pre-miRNA hsa-mir-939   
Genomic Coordinates chr8: 144394149 - 144394230
Synonyms MIRN939, hsa-mir-939, MIR939
Description Homo sapiens miR-939 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-939-5p
Sequence 15| UGGGGAGCUGAGGCUCUGGGGGUG |38
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30593009 5 COSMIC
COSN30543331 16 COSMIC
COSN14667885 23 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1384036144 1 dbSNP
rs1395761717 5 dbSNP
rs1311227571 6 dbSNP
rs371302764 7 dbSNP
rs376683753 10 dbSNP
rs530381565 19 dbSNP
rs374825674 20 dbSNP
rs781946129 21 dbSNP
rs1327403764 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CDKN1A   
Synonyms CAP20, CDKN1, CIP1, MDA-6, P21, SDI1, WAF1, p21CIP1
Description cyclin dependent kinase inhibitor 1A
Transcript NM_000389   
Other Transcripts NM_078467   
Expression
Putative miRNA Targets on CDKN1A
3'UTR of CDKN1A
(miRNA target sites are highlighted)		 
>CDKN1A|NM_000389|3'UTR
   1 TCCGCCCACAGGAAGCCTGCAGTCCTGGAAGCGCGAGGGCCTCAAAGGCCCGCTCTACATCTTCTGCCTTAGTCTCAGTT
  81 TGTGTGTCTTAATTATTATTTGTGTTTTAATTTAAACACCTCCTCATGTACATACCCTGGCCGCCCCCTGCCCCCCAGCC
 161 TCTGGCATTAGAATTATTTAAACAAAAACTAGGCGGTTGAATGAGAGGTTCCTAAGAGTGCTGGGCATTTTTATTTTATG
 241 AAATACTATTTAAAGCCTCCTCATCCCGTGTTCTCCTTTTCCTCTCTCCCGGAGGTTGGGTGGGCCGGCTTCATGCCAGC
 321 TACTTCCTCCTCCCCACTTGTCCGCTGGGTGGTACCCTCTGGAGGGGTGTGGCTCCTTCCCATCGCTGTCACAGGCGGTT
 401 ATGAAATTCACCCCCTTTCCTGGACACTCAGACCTGAATTCTTTTTCATTTGAGAAGTAAACAGATGGCACTTTGAAGGG
 481 GCCTCACCGAGTGGGGGCATCATCAAAAACTTTGGAGTCCCCTCACCTCCTCTAAGGTTGGGCAGGGTGACCCTGAAGTG
 561 AGCACAGCCTAGGGCTGAGCTGGGGACCTGGTACCCTCCTGGCTCTTGATACCCCCCTCTGTCTTGTGAAGGCAGGGGGA
 641 AGGTGGGGTCCTGGAGCAGACCACCCCGCCTGCCCTCATGGCCCCTCTGACCTGCACTGGGGAGCCCGTCTCAGTGTTGA
 721 GCCTTTTCCCTCTTTGGCTCCCCTGTACCTTTTGAGGAGCCCCAGCTACCCTTCTTCTCCAGCTGGGCTCTGCAATTCCC
 801 CTCTGCTGCTGTCCCTCCCCCTTGTCCTTTCCCTTCAGTACCCTCTCAGCTCCAGGTGGCTCTGAGGTGCCTGTCCCACC
 881 CCCACCCCCAGCTCAATGGACTGGAAGGGGAAGGGACACACAAGAAGAAGGGCACCCTAGTTCTACCTCAGGCAGCTCAA
 961 GCAGCGACCGCCCCCTCCTCTAGCTGTGGGGGTGAGGGTCCCATGTGGTGGCACAGGCCCCCTTGAGTGGGGTTATCTCT
1041 GTGTTAGGGGTATATGATGGGGGAGTAGATCTTTCTAGGAGGGAGACACTGGCCCCTCAAATCGTCCAGCGACCTTCCTC
1121 ATCCACCCCATCCCTCCCCAGTTCATTGCACTTTGATTAGCAGCGGAACAAGGAGTCAGACATTTTAAGATGGTGGCAGT
1201 AGAGGCTATGGACAGGGCATGCCACGTGGGCTCATATGGGGCTGGGAGTAGTTGTCTTTCCTGGCACTAACGTTGAGCCC
1281 CTGGAGGCACTGAAGTGCTTAGTGTACTTGGAGTATTGGGGTCTGACCCCAAACACCTTCCAGCTCCTGTAACATACTGG
1361 CCTGGACTGTTTTCTCTCGGCTCCCCATGTGTCCTGGTTCCCGTTTCTCCACCTAGACTGTAAACCTCTCGAGGGCAGGG
1441 ACCACACCCTGTACTGTTCTGTGTCTTTCACAGCTCCTCCCACAATGCTGAATATACAGCAGGTGCTCAATAAATGATTC
1521 TTAGTGACTTTACTTGTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' guggGGGUCU--C-----GGAGUCGAGGGGu 5'
              ||::||  |     :|||:||||||| 
Target 5' ctggCCTGGACTGTTTTCTCTCGGCTCCCCa 3'
 1357 - 1387 158.00 -28.80
2 
miRNA  3' guGGGGGUCUCGGAGUCGAGGGGu 5'
            :|||:    |:|::||||||| 
Target 5' ttTCCCT----CTTTGGCTCCCCt 3'
 725 - 744 156.00 -23.20
3 
miRNA  3' guGGGGG---UCUCGGAGUCGAGGGGu 5'
            ||:::   :||||| ||||| ||| 
Target 5' taCCTTTTGAGGAGCCCCAGCTACCCt 3'
 746 - 772 142.00 -27.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN8871647 4 COSMIC
COSN30107428 13 COSMIC
COSN17136499 21 COSMIC
COSN24388178 36 COSMIC
COSN30512604 38 COSMIC
COSN26970192 40 COSMIC
COSN30166588 65 COSMIC
COSN24301745 80 COSMIC
COSN30488608 90 COSMIC
COSN30469357 137 COSMIC
COSN30533369 148 COSMIC
COSN32056942 195 COSMIC
COSN17181950 363 COSMIC
COSN21122568 516 COSMIC
COSN8514252 516 COSMIC
COSN20590362 520 COSMIC
COSN26644634 575 COSMIC
COSN32057748 625 COSMIC
COSN31576773 708 COSMIC
COSN15779126 787 COSMIC
COSN28791109 848 COSMIC
COSN8514253 848 COSMIC
COSN26566755 989 COSMIC
COSN31541982 1111 COSMIC
COSN31595516 1138 COSMIC
COSN9781735 1206 COSMIC
COSN21510222 1432 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs139304346 4 dbSNP
rs747014318 5 dbSNP
rs1184573689 9 dbSNP
rs1396765368 11 dbSNP
rs1445659229 11 dbSNP
rs777207887 12 dbSNP
rs1376040331 15 dbSNP
rs1226999329 17 dbSNP
rs1059234 21 dbSNP
rs770267002 22 dbSNP
rs775069456 23 dbSNP
rs945802868 24 dbSNP
rs1475096701 28 dbSNP
rs762632530 29 dbSNP
rs201408395 32 dbSNP
rs375173291 33 dbSNP
rs41272170 34 dbSNP
rs1482370511 35 dbSNP
rs150869821 36 dbSNP
rs3176357 39 dbSNP
rs754567385 40 dbSNP
rs1166992411 41 dbSNP
rs755968076 44 dbSNP
rs1423988118 48 dbSNP
rs111926164 52 dbSNP
rs575815855 53 dbSNP
rs998171288 56 dbSNP
rs1028124783 57 dbSNP
rs952159534 59 dbSNP
rs983400213 67 dbSNP
rs907923458 69 dbSNP
rs760541872 75 dbSNP
rs1428687704 80 dbSNP
rs976707693 105 dbSNP
rs1451995360 114 dbSNP
rs951389423 117 dbSNP
rs763632708 118 dbSNP
rs1394250512 125 dbSNP
rs1322653551 126 dbSNP
rs779826646 133 dbSNP
rs922225207 136 dbSNP
rs187742871 137 dbSNP
rs914304254 138 dbSNP
rs1443635232 139 dbSNP
rs564494785 143 dbSNP
rs112675295 144 dbSNP
rs1041396487 145 dbSNP
rs1317251949 152 dbSNP
rs1210788045 155 dbSNP
rs1489707452 157 dbSNP
rs866686724 158 dbSNP
rs1245438449 163 dbSNP
rs1343160898 179 dbSNP
rs546659289 182 dbSNP
rs756718995 195 dbSNP
rs191431994 196 dbSNP
rs529170426 208 dbSNP
rs755706954 209 dbSNP
rs1056094900 222 dbSNP
rs960959039 226 dbSNP
rs1301078579 240 dbSNP
rs1423551932 245 dbSNP
rs1370821103 248 dbSNP
rs543585485 249 dbSNP
rs114982296 258 dbSNP
rs778242620 260 dbSNP
rs781689614 268 dbSNP
rs1372999209 283 dbSNP
rs41272172 284 dbSNP
rs1043234187 287 dbSNP
rs1483485414 291 dbSNP
rs925724850 291 dbSNP
rs1277091698 292 dbSNP
rs796185918 297 dbSNP
rs184374036 305 dbSNP
rs1039501629 307 dbSNP
rs1275518074 308 dbSNP
rs1387758636 311 dbSNP
rs539152524 313 dbSNP
rs1233808733 315 dbSNP
rs1347344575 321 dbSNP
rs866398753 327 dbSNP
rs189270770 330 dbSNP
rs566360271 333 dbSNP
rs1370764937 336 dbSNP
rs1046926038 344 dbSNP
rs1374607192 345 dbSNP
rs1407714364 352 dbSNP
rs377595930 355 dbSNP
rs887116254 358 dbSNP
rs181350370 377 dbSNP
rs1017456404 381 dbSNP
rs1302198995 385 dbSNP
rs3176358 386 dbSNP
rs1002260135 397 dbSNP
rs373590939 397 dbSNP
rs1454501485 398 dbSNP
rs1338842504 412 dbSNP
rs1363084136 416 dbSNP
rs866383890 416 dbSNP
rs976121091 430 dbSNP
rs1179838684 434 dbSNP
rs1296509107 440 dbSNP
rs575126168 442 dbSNP
rs1035203096 443 dbSNP
rs535732427 444 dbSNP
rs1309634071 451 dbSNP
rs960823517 458 dbSNP
rs922162572 467 dbSNP
rs1261233743 476 dbSNP
rs953675606 478 dbSNP
rs532581570 482 dbSNP
rs1281079083 488 dbSNP
rs777824384 489 dbSNP
rs879879447 493 dbSNP
rs1245700146 494 dbSNP
rs749588003 497 dbSNP
rs879309299 498 dbSNP
rs1176417316 499 dbSNP
rs1458233139 501 dbSNP
rs1410545818 513 dbSNP
rs557591236 514 dbSNP
rs1469781325 526 dbSNP
rs1238310449 527 dbSNP
rs914777007 529 dbSNP
rs978433655 530 dbSNP
rs1439329339 532 dbSNP
rs925725564 533 dbSNP
rs942480428 537 dbSNP
rs1039405016 541 dbSNP
rs575878563 545 dbSNP
rs1186756151 547 dbSNP
rs572991639 548 dbSNP
rs1241195720 553 dbSNP
rs946204604 587 dbSNP
rs1431092774 592 dbSNP
rs541799707 606 dbSNP
rs1286032990 612 dbSNP
rs1221894791 613 dbSNP
rs922442057 615 dbSNP
rs933792625 616 dbSNP
rs546335483 618 dbSNP
rs1047001332 625 dbSNP
rs1055493853 632 dbSNP
rs894366694 638 dbSNP
rs367706888 640 dbSNP
rs995702977 642 dbSNP
rs1316639627 646 dbSNP
rs1400543397 648 dbSNP
rs1414782201 651 dbSNP
rs184742749 655 dbSNP
rs941387040 656 dbSNP
rs1048397424 664 dbSNP
rs370572240 665 dbSNP
rs189202045 668 dbSNP
rs757862523 669 dbSNP
rs1289515919 683 dbSNP
rs540666701 692 dbSNP
rs1213364316 693 dbSNP
rs1446277683 700 dbSNP
rs1292232768 702 dbSNP
rs1247641087 708 dbSNP
rs774512258 709 dbSNP
rs1364417768 711 dbSNP
rs1004007357 717 dbSNP
rs1268992201 723 dbSNP
rs1014932119 733 dbSNP
rs1350764432 737 dbSNP
rs1305357860 741 dbSNP
rs1002289641 742 dbSNP
rs1365225649 743 dbSNP
rs1346497851 750 dbSNP
rs1225909893 754 dbSNP
rs1035067351 755 dbSNP
rs1169270853 760 dbSNP
rs997905489 770 dbSNP
rs1266718439 772 dbSNP
rs6457937 775 dbSNP
rs1269272527 778 dbSNP
rs529198430 781 dbSNP
rs990366166 796 dbSNP
rs544057426 812 dbSNP
rs1009737725 815 dbSNP
rs1021650885 821 dbSNP
rs968318210 822 dbSNP
rs1292832469 834 dbSNP
rs562367477 841 dbSNP
rs1214437185 843 dbSNP
rs139090547 846 dbSNP
rs967514962 851 dbSNP
rs980065929 853 dbSNP
rs1345101601 858 dbSNP
rs181534480 870 dbSNP
rs551145694 874 dbSNP
rs566590564 877 dbSNP
rs186592256 880 dbSNP
rs10046116 885 dbSNP
rs548971366 897 dbSNP
rs1401216744 907 dbSNP
rs567103693 914 dbSNP
rs772094412 918 dbSNP
rs991560468 919 dbSNP
rs1479367670 922 dbSNP
rs933848673 943 dbSNP
rs74801436 948 dbSNP
rs908342499 966 dbSNP
rs557652835 970 dbSNP
rs1203248566 971 dbSNP
rs1324860987 972 dbSNP
rs1265599057 987 dbSNP
rs1346545037 991 dbSNP
rs1323184962 998 dbSNP
rs1308173710 1008 dbSNP
rs1393307997 1013 dbSNP
rs1059247 1023 dbSNP
rs1486210553 1028 dbSNP
rs191000568 1031 dbSNP
rs1286834345 1032 dbSNP
rs1448911279 1043 dbSNP
rs1038653449 1049 dbSNP
rs1178582184 1050 dbSNP
rs375384268 1051 dbSNP
rs939842159 1055 dbSNP
rs1373329428 1061 dbSNP
rs1040878666 1067 dbSNP
rs540064877 1071 dbSNP
rs1258434302 1089 dbSNP
rs1308574600 1104 dbSNP
rs937985105 1105 dbSNP
rs776135188 1111 dbSNP
rs558063177 1112 dbSNP
rs889082589 1115 dbSNP
rs1261637880 1119 dbSNP
rs1011602474 1121 dbSNP
rs1315327520 1122 dbSNP
rs1306631788 1135 dbSNP
rs761473919 1142 dbSNP
rs1385000901 1148 dbSNP
rs1232064352 1152 dbSNP
rs1450298684 1161 dbSNP
rs573326094 1165 dbSNP
rs3176359 1166 dbSNP
rs903998141 1177 dbSNP
rs960052426 1184 dbSNP
rs1157825566 1190 dbSNP
rs555737213 1191 dbSNP
rs1386505260 1206 dbSNP
rs1181247844 1207 dbSNP
rs1461236031 1210 dbSNP
rs749899530 1213 dbSNP
rs1263105800 1224 dbSNP
rs1207246532 1226 dbSNP
rs573926464 1227 dbSNP
rs1223431084 1228 dbSNP
rs544119216 1234 dbSNP
rs1163000989 1236 dbSNP
rs930958513 1238 dbSNP
rs983778153 1243 dbSNP
rs1296287341 1251 dbSNP
rs1802569 1257 dbSNP
rs1383705783 1265 dbSNP
rs1382434582 1266 dbSNP
rs1297375941 1267 dbSNP
rs1424855287 1270 dbSNP
rs1426782231 1272 dbSNP
rs908447221 1273 dbSNP
rs1161106457 1277 dbSNP
rs1443541621 1279 dbSNP
rs1306606588 1281 dbSNP
rs1802570 1296 dbSNP
rs182235412 1299 dbSNP
rs185976780 1300 dbSNP
rs544851636 1304 dbSNP
rs1261412400 1309 dbSNP
rs1200644254 1311 dbSNP
rs1490893779 1314 dbSNP
rs1300371776 1319 dbSNP
rs1376345118 1321 dbSNP
rs1340234208 1328 dbSNP
rs1244523840 1350 dbSNP
rs963715824 1361 dbSNP
rs1324648171 1365 dbSNP
rs1277296198 1375 dbSNP
rs745953295 1380 dbSNP
rs1361208671 1382 dbSNP
rs932480638 1386 dbSNP
rs11550973 1388 dbSNP
rs527383432 1389 dbSNP
rs1396519804 1390 dbSNP
rs1169167214 1392 dbSNP
rs548775480 1394 dbSNP
rs1011571683 1397 dbSNP
rs1423597658 1398 dbSNP
rs73730143 1403 dbSNP
rs903433616 1404 dbSNP
rs982916069 1416 dbSNP
rs1267037831 1426 dbSNP
rs531369735 1431 dbSNP
rs778257166 1432 dbSNP
rs1194188901 1434 dbSNP
rs1183138065 1440 dbSNP
rs1337340457 1441 dbSNP
rs1257405417 1445 dbSNP
rs1223890425 1449 dbSNP
rs1036363838 1452 dbSNP
rs1385906506 1460 dbSNP
rs766360274 1460 dbSNP
rs1446722024 1461 dbSNP
rs1166317774 1462 dbSNP
rs564442732 1473 dbSNP
rs1419284609 1477 dbSNP
rs941154808 1479 dbSNP
rs1136646 1483 dbSNP
rs1471247583 1499 dbSNP
rs1427573585 1509 dbSNP
rs549777937 1512 dbSNP
rs1470615589 1515 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 1026.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' guGGGGGUCUCGGAGUCGAGGGGu 5'
            :|||:    |:|::||||||| 
Target 5' uuUCCCU----CUUUGGCUCCCCu 3'
 		4 - 23
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177603. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_5 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' guggGGGUCU--C-----GGAGUCGAGGGGu 5'
              ||::||  |     :|||:||||||| 
Target 5' cuggCCUGGACUGUUUUCUCUCGGCUCCCCa 3'
 		8 - 38
Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
CLIP-seq Support 1 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000244741.5 | 3UTR | CCUUUUCCCUCUUUGGCUCCCCUGUACCUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.637 1.3e-3 -0.767 4.0e-5 20 Click to see details
GSE19536 Breast cancer 0.269 3.4e-3 0.249 6.2e-3 100 Click to see details
GSE42095 Differentiated embryonic stem cells 0.391 3.3e-2 0.357 4.7e-2 23 Click to see details
GSE28544 Breast cancer 0.365 4.0e-2 0.390 3.0e-2 24 Click to see details
GSE19783 ER- ER- breast cancer 0.198 4.0e-2 0.221 2.5e-2 79 Click to see details
GSE19350 CNS germ cell tumors -0.446 7.3e-2 -0.026 4.7e-1 12 Click to see details
GSE28260 Renal cortex and medulla -0.382 9.9e-2 -0.269 1.9e-1 13 Click to see details
GSE32688 Pancreatic cancer 0.211 1.2e-1 0.193 1.4e-1 32 Click to see details
GSE17498 Multiple myeloma -0.174 1.4e-1 -0.230 7.7e-2 40 Click to see details
GSE38226 Liver fibrosis -0.237 1.5e-1 -0.107 3.2e-1 21 Click to see details
GSE19783 ER+ ER+ breast cancer 0.209 1.9e-1 0.203 2.0e-1 20 Click to see details
GSE21032 Prostate cancer 0.094 2.0e-1 0.164 6.9e-2 83 Click to see details
GSE15076 Monocyte-derived dendritic cells -0.297 2.2e-1 -0.033 4.7e-1 9 Click to see details
GSE35602 Colorectal cancer stromal tissue -0.16 2.2e-1 -0.109 3.0e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells 0.163 2.2e-1 0.135 2.6e-1 24 Click to see details
GSE21687 Ependynoma primary tumors -0.075 2.8e-1 -0.041 3.7e-1 64 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.107 3.1e-1 -0.007 4.9e-1 25 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
PAAD -0.999 0.01 -1.000 0.5 3 Click to see details
LUSC 0.272 0.06 0.187 0.14 34 Click to see details
LUAD -0.577 0.07 -0.619 0.05 8 Click to see details
CHOL 0.573 0.16 0.700 0.09 5 Click to see details
THCA -0.126 0.19 -0.036 0.4 50 Click to see details
UCEC 0.211 0.22 0.185 0.25 16 Click to see details
KIRC 0.153 0.24 0.157 0.23 24 Click to see details
LIHC -0.107 0.25 -0.089 0.29 42 Click to see details
KICH 0.122 0.29 0.237 0.14 22 Click to see details
ESCA -0.154 0.35 -0.117 0.38 9 Click to see details
COAD -0.163 0.35 -0.238 0.29 8 Click to see details
PCPG 0.417 0.36 0.500 0.33 3 Click to see details
BLCA -0.088 0.39 -0.082 0.39 13 Click to see details
CESC -0.334 0.39 -0.500 0.33 3 Click to see details
BRCA 0.034 0.39 0.034 0.39 64 Click to see details
KIRP 0.028 0.45 -0.006 0.49 24 Click to see details
STAD -0.009 0.48 0.006 0.49 27 Click to see details
HNSC 0.007 0.48 -0.092 0.29 37 Click to see details
PRAD -0.006 0.49 0.098 0.38 12 Click to see details
PRAD -0.006 0.49 0.098 0.38 12 Click to see details
PRAD -0.006 0.49 0.098 0.38 12 Click to see details
137 hsa-miR-939-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT016026 IL6 interleukin 6 1 1
MIRT036634 SH3BP2 SH3 domain binding protein 2 1 1
MIRT036636 AMPD2 adenosine monophosphate deaminase 2 1 1
MIRT168693 CDKN1A cyclin dependent kinase inhibitor 1A 2 2
MIRT189766 CDADC1 cytidine and dCMP deaminase domain containing 1 2 2
MIRT443840 RGS6 regulator of G protein signaling 6 2 2
MIRT446198 GTPBP4 GTP binding protein 4 2 2
MIRT448037 SFRP1 secreted frizzled related protein 1 2 2
MIRT451304 LGALS3BP galectin 3 binding protein 2 2
MIRT452319 EIF5AL1 eukaryotic translation initiation factor 5A-like 1 2 2
MIRT453237 FTSJ3 FtsJ RNA methyltransferase homolog 3 2 2
MIRT453499 ARRB1 arrestin beta 1 2 2
MIRT453539 PRR12 proline rich 12 2 2
MIRT454899 SEPT8 septin 8 2 16
MIRT456442 TMEM81 transmembrane protein 81 2 2
MIRT456682 LDB1 LIM domain binding 1 2 2
MIRT457128 ASPH aspartate beta-hydroxylase 2 2
MIRT457177 ERC1 ELKS/RAB6-interacting/CAST family member 1 2 2
MIRT457597 IDS iduronate 2-sulfatase 2 2
MIRT458303 TNFAIP8L3 TNF alpha induced protein 8 like 3 2 2
MIRT458441 RPRM reprimo, TP53 dependent G2 arrest mediator homolog 2 2
MIRT460644 IGFBP4 insulin like growth factor binding protein 4 2 2
MIRT461453 SLC19A3 solute carrier family 19 member 3 2 2
MIRT462767 ZNF8 zinc finger protein 8 2 2
MIRT462989 ZNF740 zinc finger protein 740 2 2
MIRT463678 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 2
MIRT464110 VPS35 VPS35, retromer complex component 2 2
MIRT464412 UNC13A unc-13 homolog A 2 6
MIRT468613 SUMO1 small ubiquitin-like modifier 1 2 2
MIRT469602 RALGAPA2 Ral GTPase activating protein catalytic alpha subunit 2 2 2
MIRT469653 RAC1 Rac family small GTPase 1 2 2
MIRT473286 MFRP membrane frizzled-related protein 2 2
MIRT473602 MARK2 microtubule affinity regulating kinase 2 2 2
MIRT473659 MARCKSL1 MARCKS like 1 2 2
MIRT474691 KIF5A kinesin family member 5A 2 2
MIRT475660 HIC2 HIC ZBTB transcriptional repressor 2 2 2
MIRT477622 EFNA1 ephrin A1 2 2
MIRT478123 DIRAS1 DIRAS family GTPase 1 2 2
MIRT478439 DAZAP2 DAZ associated protein 2 2 4
MIRT478948 COX15 COX15, cytochrome c oxidase assembly homolog 2 2
MIRT479969 CARD10 caspase recruitment domain family member 10 2 2
MIRT480400 C19orf47 chromosome 19 open reading frame 47 2 2
MIRT482807 TRAF6 TNF receptor associated factor 6 2 2
MIRT482943 ZNF561 zinc finger protein 561 2 6
MIRT483651 QSOX2 quiescin sulfhydryl oxidase 2 2 4
MIRT485374 MSN moesin 2 4
MIRT485761 B4GALT5 beta-1,4-galactosyltransferase 5 2 2
MIRT485923 PGPEP1 pyroglutamyl-peptidase I 2 4
MIRT486240 FASTK Fas activated serine/threonine kinase 2 2
MIRT486844 SLC9A3R2 SLC9A3 regulator 2 2 2
MIRT486931 DTX2 deltex E3 ubiquitin ligase 2 2 2
MIRT487110 SCARF2 scavenger receptor class F member 2 2 2
MIRT487183 NFASC neurofascin 2 4
MIRT487208 HMX1 H6 family homeobox 1 2 2
MIRT487317 UBFD1 ubiquitin family domain containing 1 2 4
MIRT487809 PER3 period circadian clock 3 2 2
MIRT487828 CLSTN1 calsyntenin 1 2 4
MIRT488184 MAT1A methionine adenosyltransferase 1A 2 2
MIRT488637 HAND2 heart and neural crest derivatives expressed 2 2 2
MIRT488844 UBTF upstream binding transcription factor, RNA polymerase I 2 2
MIRT489101 ABCC5 ATP binding cassette subfamily C member 5 2 4
MIRT489220 ASCL2 achaete-scute family bHLH transcription factor 2 2 4
MIRT489354 SYNGR1 synaptogyrin 1 2 4
MIRT489729 GNAI2 G protein subunit alpha i2 2 4
MIRT489770 GRINA glutamate ionotropic receptor NMDA type subunit associated protein 1 2 2
MIRT490573 SLC47A1 solute carrier family 47 member 1 2 2
MIRT490776 PSMD3 proteasome 26S subunit, non-ATPase 3 2 2
MIRT491529 HDAC5 histone deacetylase 5 2 2
MIRT492276 SHISA6 shisa family member 6 2 4
MIRT492700 PHYHIP phytanoyl-CoA 2-hydroxylase interacting protein 2 2
MIRT493311 LIMD2 LIM domain containing 2 2 2
MIRT493541 ICOSLG inducible T-cell costimulator ligand 2 4
MIRT494326 CASKIN1 CASK interacting protein 1 2 2
MIRT494828 ADCY9 adenylate cyclase 9 2 2
MIRT496769 ADAMTS14 ADAM metallopeptidase with thrombospondin type 1 motif 14 2 2
MIRT496971 RPS6KA2 ribosomal protein S6 kinase A2 2 2
MIRT497036 DYRK1B dual specificity tyrosine phosphorylation regulated kinase 1B 2 2
MIRT498911 SRCAP Snf2 related CREBBP activator protein 2 2
MIRT500012 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT502228 HOXC6 homeobox C6 2 2
MIRT504105 FLOT1 flotillin 1 2 2
MIRT506428 NAGK N-acetylglucosamine kinase 2 6
MIRT507334 FAM168A family with sequence similarity 168 member A 2 2
MIRT507779 CDKN1B cyclin dependent kinase inhibitor 1B 2 2
MIRT510060 C12orf49 chromosome 12 open reading frame 49 2 4
MIRT511183 MAPRE1 microtubule associated protein RP/EB family member 1 2 2
MIRT511933 FAM127B retrotransposon Gag like 8A 2 2
MIRT513516 YIPF4 Yip1 domain family member 4 2 6
MIRT527160 ADRA2B adrenoceptor alpha 2B 2 2
MIRT535348 PFN1 profilin 1 2 2
MIRT536732 IER5 immediate early response 5 2 4
MIRT539177 AP1G1 adaptor related protein complex 1 gamma 1 subunit 2 2
MIRT544641 PHF8 PHD finger protein 8 2 4
MIRT553365 TRIM44 tripartite motif containing 44 2 2
MIRT568465 ARMC12 armadillo repeat containing 12 2 2
MIRT568969 CACNA1C calcium voltage-gated channel subunit alpha1 C 2 2
MIRT569007 CXorf36 chromosome X open reading frame 36 2 2
MIRT569035 IL21R interleukin 21 receptor 2 2
MIRT569719 GPR173 G protein-coupled receptor 173 2 2
MIRT569865 KLK10 kallikrein related peptidase 10 2 2
MIRT569912 PCSK9 proprotein convertase subtilisin/kexin type 9 2 2
MIRT570010 COL1A2 collagen type I alpha 2 chain 2 2
MIRT570058 CPNE2 copine 2 2 2
MIRT570305 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT570723 CELSR2 cadherin EGF LAG seven-pass G-type receptor 2 2 2
MIRT570980 RGS19 regulator of G protein signaling 19 2 2
MIRT571194 C9orf62 chromosome 9 open reading frame 62 2 2
MIRT572263 AGO2 argonaute 2, RISC catalytic component 2 2
MIRT573213 NAT10 N-acetyltransferase 10 2 2
MIRT574021 RIMBP3C RIMS binding protein 3C 2 2
MIRT574392 TMEM109 transmembrane protein 109 2 2
MIRT574631 LPCAT3 lysophosphatidylcholine acyltransferase 3 2 2
MIRT574688 HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 2 2
MIRT606795 BICD2 BICD cargo adaptor 2 2 2
MIRT613843 SHB SH2 domain containing adaptor protein B 2 2
MIRT621599 USF2 upstream transcription factor 2, c-fos interacting 2 2
MIRT631042 LINC00346 long intergenic non-protein coding RNA 346 2 2
MIRT631301 CBS cystathionine-beta-synthase 2 2
MIRT647748 SAMD9L sterile alpha motif domain containing 9 like 2 2
MIRT649337 HEXA hexosaminidase subunit alpha 2 2
MIRT649992 MSI1 musashi RNA binding protein 1 2 2
MIRT661784 NLRC3 NLR family CARD domain containing 3 2 2
MIRT665990 SYNJ2BP synaptojanin 2 binding protein 2 2
MIRT667175 NR2F6 nuclear receptor subfamily 2 group F member 6 2 4
MIRT667384 MOB1B MOB kinase activator 1B 2 2
MIRT669205 CBX8 chromobox 8 2 2
MIRT680927 EVC EvC ciliary complex subunit 1 2 2
MIRT691868 GXYLT2 glucoside xylosyltransferase 2 2 2
MIRT693256 HBS1L HBS1 like translational GTPase 2 2
MIRT693488 MOB3A MOB kinase activator 3A 2 2
MIRT699479 SLC10A6 solute carrier family 10 member 6 2 2
MIRT717095 PXDC1 PX domain containing 1 2 2
MIRT717120 SOWAHA sosondowah ankyrin repeat domain family member A 2 2
MIRT717641 HLX H2.0 like homeobox 2 2
MIRT722583 THBS2 thrombospondin 2 2 2
MIRT736292 IGF1R insulin like growth factor 1 receptor 3 0
MIRT737162 NOS2 nitric oxide synthase 2 1 0
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-939 Ginsenoside Rh2 NULL 119307 Microarray NSCLC cell line A549 23152132 2013 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-939 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-939 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-mir-939 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-939-5p -d-xylose 24203222 NSC727221 sensitive
hsa-miR-939-5p (-)7,8-dihydrocalanolide a 383107 NSC682400 sensitive
hsa-miR-939-5p (10,13-dimethyl-3-oxo-1,2,6,7,8,9,11,12,14,15,16,17-dodecahydrocyclopenta[a]phenanthren-17-yl) 3-methylidene-2-oxo-6-oxabicyclo[3.1.0]hexane-1-carboxylate 495432 NSC654893 sensitive
hsa-miR-939-5p (2E)-2-[2-(4-bromophenyl)-2-oxoethylidene]-5-(2,4-dimethylphenyl)furan-3-one 5468713 NSC674919 sensitive
hsa-miR-939-5p (nz)-n-[1-[4-[(4-imidazol-1-ylquinolin-2-yl)amino]phenyl]ethylidene]hydroxylamine 24204871 NSC733301 sensitive
hsa-miR-939-5p .beta.-phenylethyl 2,4,5-trihydroxycinnamate 5933247 NSC666592 sensitive
hsa-miR-939-5p [(3bR,9aS,11aS)-2-(2-hydroxy-5-oxo-2H-furan-3-yl)-3b,6,6,9a-tetramethyl-2,3,3a,4,5,5a,7,8,9,9b,10,11-dodecahydronaphtho[2,1-e][1]benzofuran-11a-yl]methyl acetate 378635 NSC661428 sensitive
hsa-miR-939-5p [(3S,10R,13S,16E)-16-[[3-methoxy-4-(2-piperidin-1-ylethoxy)phenyl]methylidene]-10,13-dimethyl-17-oxo-2,3,4,7,8,9,11,12,14,15-decahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 24203176 NSC727082 sensitive
hsa-miR-939-5p [[5-[(4-bromophenyl)diazenyl]-2-hydroxyphenyl]-[2-[3-(2-chloroanilino)-3-oxopropanoyl]hydrazinyl]methyl]phosphonous acid 377940 NSC659608 sensitive
hsa-miR-939-5p [2-amino-9-[3,4-dihydroxy-5-(hydroxymethyl)oxolan-2-yl]-1H-purin-6-ylidene]sulfanium;(2-hydroxy-5-nitrophenyl)mercury 135403618 NSC321239 sensitive
hsa-miR-939-5p [bis(aminomethyl)diethylsilane]dichloroplatinum (ii) NSC645351 sensitive
hsa-miR-939-5p [dibutyl-(2,6-difluorobenzoyl)oxy-stannyl] 2,6-difluorobenzoate 16683188 NSC643841 sensitive
hsa-miR-939-5p 1-[2-(2,4-dinitrophenyl)sulfonyl-1-methylene-allyl]sulfonyl-2,4-dinitro-benzene 361138 NSC623970 sensitive
hsa-miR-939-5p 1h-benzo[a]carbazole-1,4(11h)-dione, 11-methyl- 261066 NSC92937 sensitive
hsa-miR-939-5p 1h-imidazole-4-carboxamide, 5-(3-methyl-1-tetrazenyl)- 135493930 NSC684047 sensitive
hsa-miR-939-5p 2-(4-methylphenyl)-5-(2-naphthyl)-1,3,4-oxadiazole 260000 NSC90810 sensitive
hsa-miR-939-5p 2-(5-chloro-2-methylanilino)-6-(trifluoromethyl)pyridine-3-carboxamide 24204601 NSC732287 resistant
hsa-miR-939-5p 2-[(3,4-dicloro)anilino]-3-phenyl-5,7-diamino quinoxaline 24203444 NSC728037 sensitive
hsa-miR-939-5p 2-[[(2-aminobenzoyl)oxy-dibutyl-stannyl]amino]benzoic acid 16684416 NSC628572 sensitive
hsa-miR-939-5p 2-[3-chloro-3-(4-chloro-phenyl)-allylidene]-malononitrile 5473313 NSC725048 sensitive
hsa-miR-939-5p 2-acetyl-1,2-dihydroellipticine 376328 NSC657149 resistant
hsa-miR-939-5p 2-methyl-1-(2,3,4,5,6-pentafluorobenzoyl)-1h-benzimidazole 383504 NSC671889 sensitive
hsa-miR-939-5p 2-nitro-1-phenylpropan-1-ol 226118 NSC16258 sensitive
hsa-miR-939-5p 2,5-cyclohexadiene-1,4-dione, 2,3-dimethoxy-5-(2-naphthalenylthio)- 314728 NSC234214 sensitive
hsa-miR-939-5p 3-iodoacetamido-benzoic acid ethyl ester 398530 NSC708445 sensitive
hsa-miR-939-5p 3,4,5-trimethoxy-n-(4h-pyrrolo[2,1-c][1,4]benzoxazin-1-ylmethyl)aniline 403776 NSC719249 sensitive
hsa-miR-939-5p 3,4,8-trimethyl-7-((2-methyl-4-methylene-5-oxotetrahydro-2-furanyl)methoxy)-2h-chromen-2-one 381508 NSC668264 sensitive
hsa-miR-939-5p 4-(6-thioguanine)-7-nitro-2,1,3-benzoxadiazole 3246652 NSC348401 sensitive
hsa-miR-939-5p 4-[(2Z)-2-[1-amino-3-(methylamino)-1,3-bis(sulfanylidene)propan-2-ylidene]hydrazinyl]-1H-imidazole-5-carboxamide 5466293 NSC684046 sensitive
hsa-miR-939-5p 4-[(6-sulfanylidene-3,7-dihydropurin-8-yl)diazenyl]benzenesulfonamide 3246283 NSC75140 sensitive
hsa-miR-939-5p 4-[(z)-indolo[1,2-b]indazol-11-ylidenemethyl]-n,n-dimethylaniline 5472473 NSC719163 sensitive
hsa-miR-939-5p 5,7-bis(dibromomethyl)-3-nitropyrazolo[1,5-a]pyrimidin-2-amine 384486 NSC674312 sensitive
hsa-miR-939-5p 7-benzyl-3-[(e)-3-oxo-3-phenylprop-1-enyl]-16-thia-2,4,5,7-tetrazatetracyclo[7.7.0.02,6.010,15]hexadeca-1(9),3,5,10(15)-tetraen-8-one 45028585 NSC743396 sensitive
hsa-miR-939-5p 7-chloro-10,11-dimethoxy-2,8-diazatricyclo[7.3.1.05,13]trideca-1(12),5,7,9(13),10-pentaene-3,4-dione 397794 NSC706232 sensitive
hsa-miR-939-5p 8-(6-fluorohexyl)-3-methyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380336 NSC665863 resistant
hsa-miR-939-5p 8(5h)-quinolinone, 7-chloro-5-[[4-(diethylamino)-2-methylphenyl]imino]- 363174 NSC627778 sensitive
hsa-miR-939-5p Aplidazole c . tfa 362402 NSC626167 sensitive
hsa-miR-939-5p Artelasticin 5471311 NSC710342 sensitive
hsa-miR-939-5p Benzene, 1,1'-[(1,3-butadiene-1,4-diyl)sulfonyl]bis 5468033 NSC662781 sensitive
hsa-miR-939-5p Benzo[1,2-c:4,5-c']dipyrrole-1,3,5,7(2h,6h)-tetraimine 359178 NSC619860 sensitive
hsa-miR-939-5p Carbon monoxide;iridium;1-phenyldiazenylnaphthalen-2-olate 6711627 NSC632877 sensitive
hsa-miR-939-5p Cps49 9905583 NSC726796 sensitive
hsa-miR-939-5p Dacarbazine 5351166 NSC45388 approved sensitive
hsa-miR-939-5p Eh00008 354026 NSC603974 sensitive
hsa-miR-939-5p Gnmlngdfmleynr-uhfffaoysa-n 402862 NSC717147 resistant
hsa-miR-939-5p Herveline o 5459269 NSC676002 sensitive
hsa-miR-939-5p Incarnal 131851 NSC648322 sensitive
hsa-miR-939-5p Leinamycin 5459203 NSC645777 sensitive
hsa-miR-939-5p M-232 403374 NSC718170 sensitive
hsa-miR-939-5p Melampodinin 5359028 NSC294600 sensitive
hsa-miR-939-5p Methyl (1S,4S)-6,11-dioxo-4-[3,4,5-triacetyloxy-6-(acetyloxymethyl)oxan-2-yl]oxy-1,4-dihydropyridazino[1,2-b]phthalazine-1-carboxylate 385569 NSC676858 sensitive
hsa-miR-939-5p Mp 317 16683647 NSC30916 sensitive
hsa-miR-939-5p N-(((2-methoxy-5-(trifluoromethyl)anilino)carbonyl)oxy)butanimidoyl chloride 9556202 NSC672059 sensitive
hsa-miR-939-5p N-(2-aminophenyl)-4-[3-(3-methyl-2,5-dioxoimidazolidin-1-yl)prop-1-en-2-yl]benzamide 11682081 NSC736099 sensitive
hsa-miR-939-5p Niveusin a 5477575 NSC331121 sensitive
hsa-miR-939-5p NSC621339 NSC621339 sensitive
hsa-miR-939-5p Pc 287 239486 NSC44580 sensitive
hsa-miR-939-5p Phenethyl 3-(3,4-dihydroxyphenyl)propanoate 380847 NSC666586 sensitive
hsa-miR-939-5p Prumycin 5458561 NSC278619 resistant
hsa-miR-939-5p Stk673848 403091 NSC717563 resistant
hsa-miR-939-5p Tamoxifen 2733525 NSC180973 approved sensitive High Breast Cancer cell line (MCF-7, LY2)
hsa-miR-939-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HCT-116)
hsa-miR-939-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-939-5p Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-939-5p Bortezomib 387447 NSC681239 approved resistant High Multiple Myeloma cell line
hsa-miR-939-5p Imatinib 5291 NSC743414 approved sensitive High Gastrointestinal Stromal Tumor tissue
hsa-miR-939-5p Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-939-5p Capecitabine + Oxaliplatin resistant High Colon Adenocarcinoma tissue
hsa-miR-939-5p Fluorouracil 3385 NSC19893 approved sensitive Low Gastric Cancer cell line (AGS, BGC-823, HGC-27, MGC-803, MNK-45, SGC-7901)
hsa-miR-939-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HCT-116, HT-29)
hsa-miR-939-5p Tamoxifen 2733525 NSC180973 approved resistant High Breast Cancer cell line (MCF-7)
hsa-miR-939-5p Paclitaxel 36314 NSC125973 approved sensitive High Endometrial Serous Carcinoma cell line (USPC1)
hsa-miR-939-5p Cisplatin 5460033 NSC119875 approved resistant High Hypopharyngeal Cancer cell line (FaDu)
hsa-miR-939-5p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-939-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-939-5p Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-939-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-939-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-939-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (MGC-803)
hsa-miR-939-5p 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-miR-939-5p Ethanol+Tamoxifen resistant cell line (LY2)
hsa-miR-939-5p Cisplatin 5460033 NSC119875 approved resistant cell line (RPMI2650)
hsa-miR-939-5p Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-939-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-939-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-939-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (OVCAR3)
hsa-miR-939-5p Cisplatin 5460033 NSC119875 approved resistant cell line (H23)
hsa-miR-939-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-939-5p Cisplatin 5460033 NSC119875 approved resistant cell line (OVSAHO)

Error report submission