miRTarBase - #MIRT170870


—
pre-miRNA Information
pre-miRNA hsa-mir-2681   
Genomic Coordinates chr13: 101967642 - 101967746
Description Homo sapiens miR-2681 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-2681-5p
Sequence 22| GUUUUACCACCUCCAGGAGACU |43
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 6 13 - 101967720 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1263364397 4 dbSNP
rs1184634146 7 dbSNP
rs1464264801 10 dbSNP
rs1173765682 11 dbSNP
rs1263470724 12 dbSNP
rs906180025 15 dbSNP
rs935390707 20 dbSNP
rs1045157564 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TAX1BP1   
Synonyms CALCOCO3, T6BP, TXBP151
Description Tax1 binding protein 1
Transcript NM_001079864   
Other Transcripts NM_006024   
Expression
Putative miRNA Targets on TAX1BP1
3'UTR of TAX1BP1
(miRNA target sites are highlighted)		 
>TAX1BP1|NM_001079864|3'UTR
   1 TTACTTTTTATTATGAGTTAATATAGTTTAGCAGTAAAAAAAAAAAAAAAAACCACACCTAAAATAGACCACTGAGGAGA
  81 CCATAGAGCGGATGCTTTCATGCACCCTTTACTGCACTTTCTGACCAGGAGCTACTTTGAGTTTGGTGTTACTAGGATCA
 161 GGGTCAGTCTTTGGCTTATCAATAAATTTTAATCTCTGTTAATCTTACCTGCTTTAAAAAAAAGTTCTTGTGTGTTCGTA
 241 TCTTTATTTATTCCCTAGTTTGCAGAACTGTCTGAATAAAGGATACAAGGATTATTTCAATGTTACTGCACTGAAAAACG
 321 TGTATGTATTAGTGTGCTAGATTATTTAGCAGAATATTCACAAGTTTCTGTTGACCTTGTTGATTGAGCATGACTACTAA
 401 ATATTATGTAATAAAAAGCATTTGTCATAACAGTCTTATGAAGTAGTTCTTCGAATATAGAAAGTTCTATAATTTAGCCC
 481 ATGAAATGATAGGTTTTTAATTTTCAGAAATGGAGCTGCATGTAGAATGAGATCACATGCTTTTATATGTGAAATATTGG
 561 TTTTAGCAATTAACAGAAGGCATACTTTGCTAATTTTATGGCAAAATTTTAGAATAACCTGAATGATTATTTTTAAACTA
 641 TCTTGAAGTTGTATGTATATATCTAATGGGAAAATGGAACAAGAGATGTCAGTATAATTGTTTTCCTATTAAATGATCTC
 721 ATAACAGGGGTGTTTGTGGCATAAAAATCATAGAATATATATCAGTATCTTTTTTACATTTTCCTGATGAGAATATAAAT
 801 TTGAAATATTCTCAGTAAGTGATTAAAAGTACAATACATAAACCCAAATCAAAGTAATGTGTTTCTTCAGTTATGTCTGT
 881 GCTGTATAGAACTGTCACTAACATTAAAGAAAGAGGACACATTTTTCAAGATCTGTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ucagaggaccuccacCAUUUUg 5'
                         |||||| 
Target 5' taatatagtttagcaGTAAAAa 3'
 19 - 40 120.00 -5.50
2 
miRNA  3' ucAGAG----GACCUC-----CACC--AUUUUg 5'
            ||||    | ||:|     ||||  ||||| 
Target 5' gaTCTCATAACAGGGGTGTTTGTGGCATAAAAa 3'
 715 - 747 118.00 -10.70
3 
miRNA  3' ucagaggaccuccACCAUUUUg 5'
                       ||| |||| 
Target 5' tttgctaattttaTGGCAAAAt 3'
 586 - 607 113.00 -5.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN20047341 51 COSMIC
COSN20047342 52 COSMIC
COSN27422720 53 COSMIC
COSN5099711 53 COSMIC
COSN6516246 54 COSMIC
COSN30180353 59 COSMIC
COSN30154205 62 COSMIC
COSN1348008 119 COSMIC
COSN32063122 217 COSMIC
COSN4921711 263 COSMIC
COSN1348010 811 COSMIC
COSN9984311 846 COSMIC
COSN20104035 912 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs778387612 2 dbSNP
rs1245651823 3 dbSNP
rs747422200 5 dbSNP
rs771142835 9 dbSNP
rs1265451871 11 dbSNP
rs1462042534 12 dbSNP
rs777281718 14 dbSNP
rs190937938 15 dbSNP
rs369865240 21 dbSNP
rs557423199 22 dbSNP
rs1177237175 23 dbSNP
rs1331809248 24 dbSNP
rs746837613 24 dbSNP
rs1423820699 26 dbSNP
rs1168012657 30 dbSNP
rs763089100 32 dbSNP
rs182920258 33 dbSNP
rs1491401349 34 dbSNP
rs770664051 34 dbSNP
rs540413933 35 dbSNP
rs774381780 35 dbSNP
rs1037129664 36 dbSNP
rs1491320873 36 dbSNP
rs34270007 36 dbSNP
rs546365913 36 dbSNP
rs763851119 36 dbSNP
rs879102203 36 dbSNP
rs777780738 37 dbSNP
rs767285680 38 dbSNP
rs1356162673 39 dbSNP
rs1442793174 40 dbSNP
rs750971410 46 dbSNP
rs750200878 47 dbSNP
rs756753427 47 dbSNP
rs576111285 48 dbSNP
rs754000386 48 dbSNP
rs1006824834 49 dbSNP
rs754972691 50 dbSNP
rs766269628 50 dbSNP
rs753374195 51 dbSNP
rs1295822053 52 dbSNP
rs1491566766 52 dbSNP
rs754395332 52 dbSNP
rs536715693 53 dbSNP
rs748309489 53 dbSNP
rs779218686 53 dbSNP
rs1379789732 54 dbSNP
rs555488175 54 dbSNP
rs188352965 55 dbSNP
rs1054902562 57 dbSNP
rs894987288 66 dbSNP
rs1199845799 68 dbSNP
rs891845144 70 dbSNP
rs1010333085 71 dbSNP
rs1259687019 74 dbSNP
rs1350718352 76 dbSNP
rs1488682895 78 dbSNP
rs1286626664 79 dbSNP
rs1342611951 80 dbSNP
rs1212690255 82 dbSNP
rs116071040 83 dbSNP
rs965884696 85 dbSNP
rs1325509418 89 dbSNP
rs1275710328 90 dbSNP
rs1401267505 95 dbSNP
rs1340648041 97 dbSNP
rs1312790164 102 dbSNP
rs1413331332 104 dbSNP
rs541215100 106 dbSNP
rs1461635628 122 dbSNP
rs1173158659 127 dbSNP
rs1478183672 129 dbSNP
rs749357370 131 dbSNP
rs953045937 138 dbSNP
rs559692834 163 dbSNP
rs1187060914 166 dbSNP
rs1440638763 168 dbSNP
rs560235309 192 dbSNP
rs1200852848 193 dbSNP
rs771402922 195 dbSNP
rs1255734848 199 dbSNP
rs1183837670 210 dbSNP
rs952088145 216 dbSNP
rs968477273 216 dbSNP
rs984436260 238 dbSNP
rs1446400679 239 dbSNP
rs1454314592 241 dbSNP
rs1164497135 243 dbSNP
rs1335497444 243 dbSNP
rs977696486 247 dbSNP
rs1173093305 248 dbSNP
rs1466344623 255 dbSNP
rs924438881 264 dbSNP
rs1161554432 275 dbSNP
rs961743424 290 dbSNP
rs779301372 291 dbSNP
rs992707195 296 dbSNP
rs746226350 301 dbSNP
rs917690319 312 dbSNP
rs1200064550 319 dbSNP
rs183483565 320 dbSNP
rs776390213 321 dbSNP
rs927565266 321 dbSNP
rs1372993842 323 dbSNP
rs1357907152 325 dbSNP
rs936252837 326 dbSNP
rs748840827 342 dbSNP
rs1239040111 351 dbSNP
rs887899112 354 dbSNP
rs1333801747 367 dbSNP
rs1447738089 380 dbSNP
rs1335849203 385 dbSNP
rs1321877625 402 dbSNP
rs1407135221 405 dbSNP
rs545404964 408 dbSNP
rs1163768224 409 dbSNP
rs1439012346 416 dbSNP
rs1378188671 418 dbSNP
rs1232140674 419 dbSNP
rs577020895 428 dbSNP
rs1291132799 430 dbSNP
rs942119797 437 dbSNP
rs1336446516 440 dbSNP
rs891814976 444 dbSNP
rs1214146190 453 dbSNP
rs1036415449 454 dbSNP
rs1250568421 457 dbSNP
rs563499683 462 dbSNP
rs997664169 468 dbSNP
rs1289973579 469 dbSNP
rs761603753 470 dbSNP
rs530918348 476 dbSNP
rs1030599392 478 dbSNP
rs1311868757 481 dbSNP
rs901955228 487 dbSNP
rs1370788881 488 dbSNP
rs1273288486 497 dbSNP
rs1438959816 498 dbSNP
rs769604875 509 dbSNP
rs1317740913 516 dbSNP
rs1418979778 517 dbSNP
rs1007660115 519 dbSNP
rs1419806355 520 dbSNP
rs79198426 522 dbSNP
rs1416022545 529 dbSNP
rs968906150 534 dbSNP
rs534068453 537 dbSNP
rs528702877 549 dbSNP
rs1368602251 558 dbSNP
rs959883866 560 dbSNP
rs961671577 562 dbSNP
rs1478811674 565 dbSNP
rs1354320530 581 dbSNP
rs1460738073 583 dbSNP
rs1192344866 585 dbSNP
rs991815667 591 dbSNP
rs546751588 594 dbSNP
rs992607405 598 dbSNP
rs772714745 602 dbSNP
rs1218063518 606 dbSNP
rs915852105 608 dbSNP
rs1311971001 615 dbSNP
rs571610334 618 dbSNP
rs981213787 624 dbSNP
rs1221098761 627 dbSNP
rs1413672904 636 dbSNP
rs909221712 645 dbSNP
rs1398203580 650 dbSNP
rs545409685 651 dbSNP
rs538936667 654 dbSNP
rs562116664 656 dbSNP
rs919310946 658 dbSNP
rs933507602 660 dbSNP
rs1415785487 661 dbSNP
rs1425400378 662 dbSNP
rs569587280 669 dbSNP
rs1169584658 673 dbSNP
rs1051917565 676 dbSNP
rs1305564121 678 dbSNP
rs1229320602 681 dbSNP
rs537031094 684 dbSNP
rs1264791728 687 dbSNP
rs889407025 689 dbSNP
rs1251885880 691 dbSNP
rs913508446 694 dbSNP
rs1236038479 712 dbSNP
rs946015058 719 dbSNP
rs1040431638 722 dbSNP
rs1257647021 723 dbSNP
rs901922696 726 dbSNP
rs1320006211 728 dbSNP
rs1007803556 731 dbSNP
rs1278929266 733 dbSNP
rs1043668906 734 dbSNP
rs932068551 754 dbSNP
rs1301060975 755 dbSNP
rs1255534861 760 dbSNP
rs1449932199 760 dbSNP
rs1359589129 768 dbSNP
rs1330265337 770 dbSNP
rs555538892 770 dbSNP
rs1486657014 772 dbSNP
rs573294587 776 dbSNP
rs573736084 801 dbSNP
rs1170798412 807 dbSNP
rs1006034139 810 dbSNP
rs1014781686 812 dbSNP
rs1483780056 814 dbSNP
rs531185943 814 dbSNP
rs1196918372 825 dbSNP
rs1459274695 833 dbSNP
rs998454156 839 dbSNP
rs1244123126 844 dbSNP
rs1320052286 845 dbSNP
rs1427182856 851 dbSNP
rs1310474561 855 dbSNP
rs1230028148 856 dbSNP
rs1383170391 858 dbSNP
rs1013203727 866 dbSNP
rs1031396893 871 dbSNP
rs959763234 873 dbSNP
rs1331676926 875 dbSNP
rs758150354 876 dbSNP
rs1347676621 878 dbSNP
rs1236203326 888 dbSNP
rs751519547 894 dbSNP
rs1380019329 896 dbSNP
rs970260531 898 dbSNP
rs1034499999 900 dbSNP
rs1209534721 903 dbSNP
rs1239003054 903 dbSNP
rs1287982677 904 dbSNP
rs1359423750 905 dbSNP
rs369185424 906 dbSNP
rs957751117 906 dbSNP
rs1296055207 910 dbSNP
rs534812343 911 dbSNP
rs1284994601 914 dbSNP
rs984057152 921 dbSNP
rs73075348 930 dbSNP
rs1282312022 931 dbSNP
rs1364806019 933 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
     
Conditions HEK293S
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... HITS-CLIP data was present in GSM1084081. RNA binding protein: AGO2. Condition:CLIP_hippuristanol_rep2_SantaCruzAb ...

- Karginov FV; Hannon GJ, 2013, Genes & development.

Article - Karginov FV; Hannon GJ
- Genes & development, 2013
When adapting to environmental stress, cells attenuate and reprogram their translational output. In part, these altered translation profiles are established through changes in the interactions between RNA-binding proteins and mRNAs. The Argonaute 2 (Ago2)/microRNA (miRNA) machinery has been shown to participate in stress-induced translational up-regulation of a particular mRNA, CAT-1; however, a detailed, transcriptome-wide understanding of the involvement of Ago2 in the process has been lacking. Here, we profiled the overall changes in Ago2-mRNA interactions upon arsenite stress by cross-linking immunoprecipitation (CLIP) followed by high-throughput sequencing (CLIP-seq). Ago2 displayed a significant remodeling of its transcript occupancy, with the majority of 3' untranslated region (UTR) and coding sequence (CDS) sites exhibiting stronger interaction. Interestingly, target sites that were destined for release from Ago2 upon stress were depleted in miRNA complementarity signatures, suggesting an alternative mode of interaction. To compare the changes in Ago2-binding patterns across transcripts with changes in their translational states, we measured mRNA profiles on ribosome/polysome gradients by RNA sequencing (RNA-seq). Increased Ago2 occupancy correlated with stronger repression of translation for those mRNAs, as evidenced by a shift toward lighter gradient fractions upon stress, while release of Ago2 was associated with the limited number of transcripts that remained translated. Taken together, these data point to a role for Ago2 and the mammalian miRNAs in mediating the translational component of the stress response.
LinkOut: [PMID: 23824327]
CLIP-seq Support 1 for dataset GSM1084081
Method / RBP HITS-CLIP / AGO2
Cell line / Condition HEK293S / CLIP_hippuristanol_rep2_SantaCruzAb
Location of target site ENST00000396319.2 | 3UTR | AGCAGUAAAAAAAAAAAAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23824327 / GSE44404
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
115 hsa-miR-2681-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT058831 NRAS NRAS proto-oncogene, GTPase 2 4
MIRT076301 ULK2 unc-51 like autophagy activating kinase 2 2 2
MIRT095503 PURA purine rich element binding protein A 2 12
MIRT097763 ARSK arylsulfatase family member K 2 2
MIRT170870 TAX1BP1 Tax1 binding protein 1 2 2
MIRT179045 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 4
MIRT189057 CLEC2D C-type lectin domain family 2 member D 2 8
MIRT241949 BTG1 BTG anti-proliferation factor 1 2 4
MIRT261860 ZRANB1 zinc finger RANBP2-type containing 1 2 2
MIRT309357 OTUD4 OTU deubiquitinase 4 2 2
MIRT340568 SMIM12 small integral membrane protein 12 2 4
MIRT351983 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 8
MIRT351986 MOB4 MOB family member 4, phocein 2 8
MIRT353140 RAB10 RAB10, member RAS oncogene family 2 2
MIRT387104 VEZF1 vascular endothelial zinc finger 1 2 2
MIRT441833 SLC30A7 solute carrier family 30 member 7 2 2
MIRT443778 MTHFD1 methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 2 4
MIRT448135 CMTM6 CKLF like MARVEL transmembrane domain containing 6 2 2
MIRT450638 ZMYM2 zinc finger MYM-type containing 2 2 2
MIRT494763 AP1G1 adaptor related protein complex 1 gamma 1 subunit 2 2
MIRT498299 DCAF8 DDB1 and CUL4 associated factor 8 2 2
MIRT505104 YTHDC1 YTH domain containing 1 2 6
MIRT507179 G3BP2 G3BP stress granule assembly factor 2 2 6
MIRT516638 ZNF318 zinc finger protein 318 2 4
MIRT520011 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 4
MIRT526877 GJD3 gap junction protein delta 3 2 2
MIRT529374 SKP1 S-phase kinase associated protein 1 2 2
MIRT530090 SHISA2 shisa family member 2 2 2
MIRT536514 KCTD10 potassium channel tetramerization domain containing 10 2 2
MIRT536559 JMJD1C jumonji domain containing 1C 2 2
MIRT536624 IPO7 importin 7 2 2
MIRT544378 ZNF266 zinc finger protein 266 2 2
MIRT547590 LIN28B lin-28 homolog B 2 2
MIRT548736 CREBBP CREB binding protein 2 2
MIRT551485 TMEM192 transmembrane protein 192 2 4
MIRT552322 ZNF791 zinc finger protein 791 2 4
MIRT553193 UBE2A ubiquitin conjugating enzyme E2 A 2 2
MIRT553719 TBX18 T-box 18 2 2
MIRT554573 RRAS2 RAS related 2 2 2
MIRT557038 HOXB3 homeobox B3 2 2
MIRT559566 ARF1 ADP ribosylation factor 1 2 2
MIRT560134 INO80D INO80 complex subunit D 2 2
MIRT560406 JUN Jun proto-oncogene, AP-1 transcription factor subunit 2 2
MIRT561712 PTMA prothymosin, alpha 2 2
MIRT562688 ABI2 abl interactor 2 2 2
MIRT563214 FXN frataxin 2 2
MIRT566288 PROX1 prospero homeobox 1 2 4
MIRT567369 GTPBP3 GTP binding protein 3, mitochondrial 2 2
MIRT571380 JKAMP JNK1/MAPK8-associated membrane protein 2 2
MIRT574743 GOLGA4 golgin A4 2 2
MIRT576816 Tgfbr3 transforming growth factor, beta receptor III 2 2
MIRT609984 ZHX1 zinc fingers and homeoboxes 1 2 4
MIRT610518 HIAT1 major facilitator superfamily domain containing 14A 2 2
MIRT612203 NKTR natural killer cell triggering receptor 2 4
MIRT612224 DHX33 DEAH-box helicase 33 2 6
MIRT612889 HOOK3 hook microtubule tethering protein 3 2 2
MIRT613639 DUSP18 dual specificity phosphatase 18 2 4
MIRT614161 PHF8 PHD finger protein 8 2 2
MIRT614630 WDR13 WD repeat domain 13 2 4
MIRT615001 FXR1 FMR1 autosomal homolog 1 2 4
MIRT615665 TSC22D2 TSC22 domain family member 2 2 2
MIRT615976 KAT6A lysine acetyltransferase 6A 2 2
MIRT616328 ADARB2 adenosine deaminase, RNA specific B2 (inactive) 2 2
MIRT616495 AIPL1 aryl hydrocarbon receptor interacting protein like 1 2 2
MIRT616585 ZNF460 zinc finger protein 460 2 2
MIRT616870 ARPC1B actin related protein 2/3 complex subunit 1B 2 4
MIRT617631 RXRA retinoid X receptor alpha 2 2
MIRT620339 TLN1 talin 1 2 2
MIRT621658 UBE4B ubiquitination factor E4B 2 2
MIRT621824 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT622134 SOX4 SRY-box 4 2 2
MIRT622154 SNTG1 syntrophin gamma 1 2 2
MIRT622298 SGK3 serum/glucocorticoid regulated kinase family member 3 2 2
MIRT622531 RAB9B RAB9B, member RAS oncogene family 2 2
MIRT622596 PRRC2B proline rich coiled-coil 2B 2 2
MIRT623328 MAK16 MAK16 homolog 2 2
MIRT624499 C8orf44-SGK3 C8orf44-SGK3 readthrough 2 2
MIRT624720 AP1S2 adaptor related protein complex 1 sigma 2 subunit 2 2
MIRT625990 IBA57 IBA57 homolog, iron-sulfur cluster assembly 2 2
MIRT626143 MPRIP myosin phosphatase Rho interacting protein 2 2
MIRT626499 ARHGAP9 Rho GTPase activating protein 9 2 2
MIRT627023 CREBL2 cAMP responsive element binding protein like 2 2 2
MIRT635710 HFM1 HFM1, ATP dependent DNA helicase homolog 2 2
MIRT635725 CCDC58 coiled-coil domain containing 58 2 2
MIRT637121 MKX mohawk homeobox 2 2
MIRT639969 POU5F1B POU class 5 homeobox 1B 2 2
MIRT640962 GPRASP1 G protein-coupled receptor associated sorting protein 1 2 4
MIRT641067 HHIPL1 HHIP like 1 2 2
MIRT644800 NKX3-2 NK3 homeobox 2 2 2
MIRT644958 STEAP4 STEAP4 metalloreductase 2 2
MIRT649152 LRTM1 leucine rich repeats and transmembrane domains 1 2 2
MIRT651887 UFD1L ubiquitin recognition factor in ER associated degradation 1 2 2
MIRT652165 TRIM66 tripartite motif containing 66 2 2
MIRT652565 TLR6 toll like receptor 6 2 2
MIRT653127 SRPX2 sushi repeat containing protein, X-linked 2 2 2
MIRT655622 ONECUT1 one cut homeobox 1 2 2
MIRT656245 MEX3A mex-3 RNA binding family member A 2 2
MIRT656837 KLF7 Kruppel like factor 7 2 2
MIRT656990 KCNN3 potassium calcium-activated channel subfamily N member 3 2 2
MIRT660337 BCL10 B-cell CLL/lymphoma 10 2 2
MIRT660393 B3GALT5 beta-1,3-galactosyltransferase 5 2 2
MIRT660940 ACER3 alkaline ceramidase 3 2 2
MIRT661509 C8orf82 chromosome 8 open reading frame 82 2 2
MIRT665000 KLF2 Kruppel like factor 2 2 2
MIRT665106 TNFSF8 TNF superfamily member 8 2 2
MIRT665547 UCHL5 ubiquitin C-terminal hydrolase L5 2 2
MIRT687376 NT5DC3 5'-nucleotidase domain containing 3 2 2
MIRT711828 SIGLEC9 sialic acid binding Ig like lectin 9 2 2
MIRT713313 VLDLR very low density lipoprotein receptor 2 2
MIRT715654 PPM1K protein phosphatase, Mg2+/Mn2+ dependent 1K 2 2
MIRT715735 CD226 CD226 molecule 2 2
MIRT717255 SLC44A1 solute carrier family 44 member 1 2 2
MIRT717950 MIA3 MIA family member 3, ER export factor 2 2
MIRT719709 CD101 CD101 molecule 2 2
MIRT723893 NUDT21 nudix hydrolase 21 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-2681-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)

Error report submission