miRTarBase - #MIRT175250


—
pre-miRNA Information
pre-miRNA hsa-mir-4477a   
Genomic Coordinates chr9: 41233755 - 41233835
Description Homo sapiens miR-4477a stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4477a
Sequence 48| CUAUUAAGGACAUUUGUGAUUC |69
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1281813060 1 dbSNP
rs1352899679 1 dbSNP
rs1283566158 2 dbSNP
rs1236244724 4 dbSNP
rs75019967 4 dbSNP
rs1348124293 5 dbSNP
rs34026740 8 dbSNP
rs1288237115 9 dbSNP
rs71262206 10 dbSNP
rs1355759977 11 dbSNP
rs1300249508 16 dbSNP
rs1328879592 18 dbSNP
rs139133717 20 dbSNP
Putative Targets

Gene Information
Gene Symbol PSAT1   
Synonyms EPIP, NLS2, PSA, PSAT, PSATD
Description phosphoserine aminotransferase 1
Transcript NM_021154   
Other Transcripts NM_058179   
Expression
Putative miRNA Targets on PSAT1
3'UTR of PSAT1
(miRNA target sites are highlighted)		 
>PSAT1|NM_021154|3'UTR
   1 ACACATCCTAACCAGGATATACTCTGTTCTTGAACAACATACAAAGTTTAAAGTAACTTGGGGATGGCTACAAAAAGTTA
  81 ACACAGTATTTTTCTCAAATGAACATGTTTATTGCAGATTCTTCTTTTTTGAAAGAACAACAGCAAAACATCCACAACTC
 161 TGTAAAGCTGGTGGGACCTAATGTCACCTTAATTCTGACTTGAACTGGAAGCATTTTAAGAAATCTTGTTGCTTTTCTAA
 241 CAAATTCCCGCGTATTTTGCCTTTGCTGCTACTTTTTCTAGTTAGATTTCAAACTTGCCTGTGGACTTAATAATGCAAGT
 321 TGCGATTAATTATTTCTGGAGTCATGGGAACACACAGCACAGAGGGTAGGGGGGCCCTCTAGGTGCTGAATCTACACATC
 401 TGTGGGGTCTCCTGGGTTCAGCGGCTGTTGATTCAAGGTCAACATTGACCATTGGAGGAGTGGTTTAAGAGTGCCAGGCG
 481 AAGGGCAAACTGTAGATCGATCTTTATGCTGTTATTACAGGAGAAGTGACATACTTTATATATGTTTATATTAGCAAGGT
 561 CTGTTTTTAATACCATATACTTTATATTTCTATACATTTATATTTCTAATAATACAGTTATCACTGATATATGTAGACAC
 641 TTTTAGAATTTATTAAATCCTTGACCTTGTGCATTATAGCATTCCATTAGCAAGAGTTGTACCCCCTCCCCAGTCTTCGC
 721 CTTCCTCTTTTTAAGCTGTTTTATGAAAAAGACCTAGAAGTTCTTGATTCATTTTTACCATTCTTTCCATAGGTAGAAGA
 801 GAAAGTTGATTGGTTGGTTGTTTTTCAATTATGCCATTAAACTAAACATTTCTGTTAAATTACCCTATCCTTTGTTCTCT
 881 ACTGTTTTCTTTGTAATGTATGACTACGAGAGTGATACTTTGCTGAAAAGTCTTTCCCCTATTGTTTATCTATTGTCAGT
 961 ATTTTATGTTGAATATGTAAAGAACATTAAAGTCCTAAAACATCTAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cuUAGUGUUU------ACA--GGAAUUAUc 5'
            ||: ||||      |||   ||||||| 
Target 5' agATTTCAAACTTGCCTGTGGACTTAATAa 3'
 284 - 313 152.00 -7.30
2 
miRNA  3' cuUAGU-GUUU---ACAGGAAUUAUc 5'
            ||:| |||:   |||::|||||| 
Target 5' atATTAGCAAGGTCTGTTTTTAATAc 3'
 548 - 573 152.00 -7.80
3 
miRNA  3' cuuaguGUUUACA--GGAAUUAuc 5'
                | |||||  |||||||  
Target 5' tgggacCTAATGTCACCTTAATtc 3'
 172 - 195 142.00 -8.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
912650 220 ClinVar
367462 242 ClinVar
912651 252 ClinVar
367463 253 ClinVar
912652 253 ClinVar
912653 294 ClinVar
912654 379 ClinVar
367464 423 ClinVar
913754 497 ClinVar
913755 499 ClinVar
913756 555 ClinVar
367465 593 ClinVar
367466 665 ClinVar
367467 671 ClinVar
914154 720 ClinVar
367468 790 ClinVar
367469 837 ClinVar
367470 866 ClinVar
914155 940 ClinVar
COSN30469335 9 COSMIC
COSN30116467 11 COSMIC
COSN31533554 58 COSMIC
COSN2328516 64 COSMIC
COSN30494688 70 COSMIC
COSN9523582 88 COSMIC
COSN31600842 131 COSMIC
COSN31573909 144 COSMIC
COSN22259776 480 COSMIC
COSN31963052 555 COSMIC
COSN29120568 756 COSMIC
COSN15827104 781 COSMIC
COSN16477356 829 COSMIC
COSN24938179 894 COSMIC
COSN26324655 908 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1376181327 3 dbSNP
rs777691208 4 dbSNP
rs1305709679 5 dbSNP
rs1345650393 7 dbSNP
rs373654141 8 dbSNP
rs1260941235 11 dbSNP
rs771164639 14 dbSNP
rs779224452 15 dbSNP
rs377546355 20 dbSNP
rs1415326767 21 dbSNP
rs1383091743 22 dbSNP
rs768266832 26 dbSNP
rs776559550 28 dbSNP
rs1195204907 30 dbSNP
rs375713892 40 dbSNP
rs772682516 43 dbSNP
rs762410248 44 dbSNP
rs765897031 46 dbSNP
rs912112640 48 dbSNP
rs751156869 50 dbSNP
rs1356601342 52 dbSNP
rs55735002 54 dbSNP
rs1357763425 55 dbSNP
rs1291443041 65 dbSNP
rs944711574 89 dbSNP
rs1041760380 97 dbSNP
rs373306764 102 dbSNP
rs1380015320 121 dbSNP
rs532073374 122 dbSNP
rs1339518091 132 dbSNP
rs767572870 136 dbSNP
rs1406331941 138 dbSNP
rs1363509822 139 dbSNP
rs1336863412 141 dbSNP
rs924600684 144 dbSNP
rs773305506 150 dbSNP
rs936131415 156 dbSNP
rs1363797738 161 dbSNP
rs550727446 169 dbSNP
rs764963253 170 dbSNP
rs894334384 171 dbSNP
rs1012724932 179 dbSNP
rs1268679273 189 dbSNP
rs1196726330 191 dbSNP
rs1481941403 202 dbSNP
rs368179744 210 dbSNP
rs1297266168 211 dbSNP
rs1250125164 215 dbSNP
rs1045685672 221 dbSNP
rs1316766861 225 dbSNP
rs907078101 227 dbSNP
rs1004532311 233 dbSNP
rs1343218095 235 dbSNP
rs1057515673 242 dbSNP
rs962678923 250 dbSNP
rs187331280 251 dbSNP
rs76966550 252 dbSNP
rs17064358 253 dbSNP
rs1484933240 261 dbSNP
rs986225228 262 dbSNP
rs1377272781 267 dbSNP
rs912059641 271 dbSNP
rs566608311 272 dbSNP
rs966301702 276 dbSNP
rs1195754938 290 dbSNP
rs1462124280 291 dbSNP
rs1263262669 294 dbSNP
rs978065995 300 dbSNP
rs1273873087 308 dbSNP
rs1321040687 308 dbSNP
rs1239229691 317 dbSNP
rs1337321849 322 dbSNP
rs924660684 324 dbSNP
rs534118383 325 dbSNP
rs1338851919 332 dbSNP
rs753980162 333 dbSNP
rs1468297276 346 dbSNP
rs935978492 350 dbSNP
rs990261195 352 dbSNP
rs1471253466 355 dbSNP
rs1362454793 359 dbSNP
rs755260572 361 dbSNP
rs1174679828 369 dbSNP
rs371726153 373 dbSNP
rs1431864718 375 dbSNP
rs915962826 377 dbSNP
rs1184969647 402 dbSNP
rs1179083794 403 dbSNP
rs1205392793 406 dbSNP
rs1352360659 408 dbSNP
rs1258796924 410 dbSNP
rs948535954 421 dbSNP
rs10867185 423 dbSNP
rs1465614317 424 dbSNP
rs1317084248 426 dbSNP
rs1450286422 428 dbSNP
rs1339968741 444 dbSNP
rs907027317 453 dbSNP
rs1402701290 463 dbSNP
rs1383042643 465 dbSNP
rs1344157884 468 dbSNP
rs1425680906 478 dbSNP
rs570860296 480 dbSNP
rs1290278116 481 dbSNP
rs1037337607 484 dbSNP
rs898178242 487 dbSNP
rs553854445 497 dbSNP
rs573775683 499 dbSNP
rs1028033654 500 dbSNP
rs1359907248 501 dbSNP
rs1281201926 504 dbSNP
rs1293612163 506 dbSNP
rs1347149403 510 dbSNP
rs1226568732 511 dbSNP
rs1355517463 516 dbSNP
rs889572522 518 dbSNP
rs1432959017 523 dbSNP
rs1007924919 532 dbSNP
rs1224121340 534 dbSNP
rs1405712716 537 dbSNP
rs1291455735 541 dbSNP
rs1019102180 544 dbSNP
rs376749590 555 dbSNP
rs1217982074 561 dbSNP
rs1032312948 568 dbSNP
rs1420836078 569 dbSNP
rs568308325 576 dbSNP
rs1168062593 577 dbSNP
rs1488301628 581 dbSNP
rs1476112152 582 dbSNP
rs1420765077 591 dbSNP
rs115361057 593 dbSNP
rs553947293 596 dbSNP
rs572620565 605 dbSNP
rs778172800 607 dbSNP
rs1219082974 609 dbSNP
rs915910394 618 dbSNP
rs948814663 636 dbSNP
rs981510527 657 dbSNP
rs41277903 665 dbSNP
rs1277586377 666 dbSNP
rs143748888 671 dbSNP
rs1347601579 680 dbSNP
rs1301750390 686 dbSNP
rs1036963176 704 dbSNP
rs1345251010 706 dbSNP
rs1355414871 711 dbSNP
rs1331476854 716 dbSNP
rs1423674638 719 dbSNP
rs898367741 720 dbSNP
rs1480586822 722 dbSNP
rs1049419781 723 dbSNP
rs1367217417 752 dbSNP
rs1189319180 771 dbSNP
rs1477576296 781 dbSNP
rs889437649 784 dbSNP
rs1007957619 787 dbSNP
rs1057515674 790 dbSNP
rs1278912566 798 dbSNP
rs576799548 803 dbSNP
rs1326004618 805 dbSNP
rs1299475549 812 dbSNP
rs544321070 826 dbSNP
rs562487070 829 dbSNP
rs957896304 835 dbSNP
rs41277905 837 dbSNP
rs1400180451 854 dbSNP
rs1022999589 859 dbSNP
rs529821810 866 dbSNP
rs981541758 868 dbSNP
rs928681662 872 dbSNP
rs1413502646 882 dbSNP
rs961239861 884 dbSNP
rs748940129 894 dbSNP
rs1490618598 901 dbSNP
rs973017363 908 dbSNP
rs1231699471 909 dbSNP
rs542019513 914 dbSNP
rs1471472276 917 dbSNP
rs1178271572 922 dbSNP
rs1408169193 931 dbSNP
rs545654977 933 dbSNP
rs1161300205 940 dbSNP
rs931260171 948 dbSNP
rs1285036496 953 dbSNP
rs1049615930 955 dbSNP
rs1386656453 958 dbSNP
rs1376897466 970 dbSNP
rs910907044 973 dbSNP
rs183713691 979 dbSNP
rs1454994463 980 dbSNP
rs943681493 986 dbSNP
rs768478418 991 dbSNP
rs527575923 1005 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cuUAGUGUUU------ACA--GGAAUUAuc 5'
            ||: ||||      |||   ||||||  
Target 5' --AUUUCAAACUUGCCUGUGGACUUAAU-- 3'
 		1 - 26
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 29968.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_021154 | 3UTR | CUGGAAGCAUUUUAAGAAAUCUUGUUGCUUUUCUAACAAAUUCCCGCGUAUUUUGCCUUUGCUGCUACUUUUUCUAGUUAGAUUUCAAACUUGCCUGUGGACUUAAUAAUGCAAGUUGCGAUUAAUUAUUUCUGGAGUCAUGGGAACACACAGCACAGAGGGUAGGGGGGCCCUCUAGGUGCUGAAUCUACACAUCUGUGGGGUCUCCUGGGUUCAGCGGCUGUUGAUUCAAGGUCAACAUUGACCAUUGGAGGAGUGGUUUAAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903834
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_b
Location of target site NM_021154 | 3UTR | ACUGGAAGCAUUUUAAGAAAUCUUGUUGCUUUUCUAACAAAUUCCCGCGUAUUUUGCCUUUGCUGCUACUUUUUCUAGUUAGAUUUCAAACUUGCCUGUGGACUUAAUAAUGCAAGUUGCGAUUAAUUAUUUCUGGAGUCAUGGGAACACACAGCACAGAGGGUAGGGGGGCCCUCUAGGUGCUGAAUCUACACAUCUGUGGGGUCUCCUGGGUUCAGCGGCUGUUGAUUCAAGGUCAACAUUGACCAUUGGAGGAGUGGUUUAAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4903835
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_c
Location of target site NM_021154 | 3UTR | AAGCAUUUUAAGAAAUCUUGUUGCUUUUCUAACAAAUUCCCGCGUAUUUUGCCUUUGCUGCUACUUUUUCUAGUUAGAUUUCAAACUUGCCUGUGGACUUAAUAAUGCAAGUUGCGAUUAAUUAUUUCUGGAGUCAUGGGAACACACAGCACAGAGGGUAGGGGGGCCCUCUAGGUGCUGAAUCUACACAUCUGUGGGGUCUCCUGGGUUCAGCGGCUGUUGAUUCAAGGUCAACAUUGACCAUUGGAGGAGUGGUUUAAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM4903836
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_a
Location of target site NM_021154 | 3UTR | ACUUGAACUGGAAGCAUUUUAAGAAAUCUUGUUGCUUUUCUAACAAAUUCCCGCGUAUUUUGCCUUUGCUGCUACUUUUUCUAGUUAGAUUUCAAACUUGCCUGUGGACUUAAUAAUGCAAGUUGCGAUUAAUUAUUUCUGGAGUCAUGGGAACACACAGCACAGAGGGUAGGGGGGCCCUCUAGGUGCUGAAUCUACACAUCUGUGGGGUCUCCUGGGUUCAGCGGCUGUUGAUUCAAGGUCAACAUUGACCAUUGGAGGAGUGGUUUAAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM4903837
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_b
Location of target site NM_021154 | 3UTR | GAAAUCUUGUUGCUUUUCUAACAAAUUCCCGCGUAUUUUGCCUUUGCUGCUACUUUUUCUAGUUAGAUUUCAAACUUGCCUGUGGACUUAAUAAUGCAAGUUGCGAUUAAUUAUUUCUGGAGUCAUGGGAACACACAGCACAGAGGGUAGGGGGGCCCUCUAGGUGCUGAAUCUACACAUCUGUGGGGUCUCCUGGGUUCAGCGGCUGUUGAUUCAAGGUCAACAUUGACCAUUGGAGGAGUGGUUUAAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM4903838
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_c
Location of target site NM_021154 | 3UTR | GAACUGGAAGCAUUUUAAGAAAUCUUGUUGCUUUUCUAACAAAUUCCCGCGUAUUUUGCCUUUGCUGCUACUUUUUCUAGUUAGAUUUCAAACUUGCCUGUGGACUUAAUAAUGCAAGUUGCGAUUAAUUAUUUCUGGAGUCAUGGGAACACACAGCACAGAGGGUAGGGGGGCCCUCUAGGUGCUGAAUCUACACAUCUGUGGGGUCUCCUGGGUUCAGCGGCUGUUGAUUCAAGGUCAACAUUGACCAUUGGAGGAGUGGUUUAAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000376588.3 | 3UTR | AUUUCAAACUUGCCUGUGGACUUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000376588.3 | 3UTR | AUUUCAAACUUGCCUGUGGACUUAAU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000376588.3 | 3UTR | AAAUCUUGUUGCUUUUCUAACAAAUUCCCGCGUAUUUUGCCUUUGCUGCUACUUUUUCUAGUUAGAUUUCAAACUUGCCUGUGGACUUAAUAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
134 hsa-miR-4477a Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT055843 PLEKHA1 pleckstrin homology domain containing A1 2 10
MIRT061259 AMOTL1 angiomotin like 1 2 4
MIRT071895 BTF3L4 basic transcription factor 3 like 4 2 6
MIRT076933 MLLT6 MLLT6, PHD finger containing 2 2
MIRT078652 ICT1 mitochondrial ribosomal protein L58 2 2
MIRT083633 PRNP prion protein 2 2
MIRT091629 RPL15 ribosomal protein L15 2 4
MIRT107076 PPP6C protein phosphatase 6 catalytic subunit 2 2
MIRT111191 TRIM33 tripartite motif containing 33 2 2
MIRT114515 ARF6 ADP ribosylation factor 6 2 2
MIRT175250 PSAT1 phosphoserine aminotransferase 1 2 4
MIRT175430 ACSL4 acyl-CoA synthetase long chain family member 4 2 2
MIRT178687 FAM102B family with sequence similarity 102 member B 2 2
MIRT189771 CDADC1 cytidine and dCMP deaminase domain containing 1 2 2
MIRT229450 RPL10 ribosomal protein L10 2 2
MIRT244899 PHF6 PHD finger protein 6 2 2
MIRT249189 AKIRIN1 akirin 1 2 8
MIRT261134 TRIM8 tripartite motif containing 8 2 2
MIRT275561 ZIC5 Zic family member 5 2 4
MIRT275652 ABHD13 abhydrolase domain containing 13 2 2
MIRT288082 UTP18 UTP18, small subunit processome component 2 2
MIRT303605 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 2
MIRT307924 ARL8B ADP ribosylation factor like GTPase 8B 2 2
MIRT316787 FOXC1 forkhead box C1 2 2
MIRT326910 SCML2 Scm polycomb group protein like 2 2 2
MIRT327713 SPIN4 spindlin family member 4 2 2
MIRT331632 AASDHPPT aminoadipate-semialdehyde dehydrogenase-phosphopantetheinyl transferase 2 2
MIRT342506 TMOD3 tropomodulin 3 2 4
MIRT354470 LRRC58 leucine rich repeat containing 58 2 2
MIRT378711 TRIM24 tripartite motif containing 24 2 2
MIRT407462 YDJC YdjC chitooligosaccharide deacetylase homolog 2 2
MIRT408226 SMAD5 SMAD family member 5 2 4
MIRT441824 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT442783 CHD8 chromodomain helicase DNA binding protein 8 2 2
MIRT443184 NHS NHS actin remodeling regulator 2 4
MIRT447615 CUL3 cullin 3 2 2
MIRT450156 DSEL dermatan sulfate epimerase-like 2 2
MIRT454801 NEDD9 neural precursor cell expressed, developmentally down-regulated 9 2 2
MIRT463050 ZNF644 zinc finger protein 644 2 2
MIRT467400 SOCS3 suppressor of cytokine signaling 3 2 2
MIRT468174 SGMS1 sphingomyelin synthase 1 2 2
MIRT468949 RPS14 ribosomal protein S14 2 6
MIRT469835 R3HDM4 R3H domain containing 4 2 2
MIRT470724 POFUT1 protein O-fucosyltransferase 1 2 2
MIRT470902 PLIN3 perilipin 3 2 2
MIRT472467 NAPG NSF attachment protein gamma 2 12
MIRT472602 NAA50 N(alpha)-acetyltransferase 50, NatE catalytic subunit 2 2
MIRT492350 SEMA7A semaphorin 7A (John Milton Hagen blood group) 2 2
MIRT493840 FOXN3 forkhead box N3 2 4
MIRT496318 DOCK9 dedicator of cytokinesis 9 2 2
MIRT500159 CLEC2D C-type lectin domain family 2 member D 2 8
MIRT500535 XPO4 exportin 4 2 4
MIRT503916 FBXL13 F-box and leucine rich repeat protein 13 2 4
MIRT504003 SAT1 spermidine/spermine N1-acetyltransferase 1 2 4
MIRT505647 SHMT1 serine hydroxymethyltransferase 1 2 4
MIRT506574 MIER3 MIER family member 3 2 4
MIRT506945 HS3ST3B1 heparan sulfate-glucosamine 3-sulfotransferase 3B1 2 4
MIRT508196 RPS19 ribosomal protein S19 2 6
MIRT511417 HSPA13 heat shock protein family A (Hsp70) member 13 2 4
MIRT512326 ACTB actin beta 2 4
MIRT515376 RPL7 ribosomal protein L7 2 2
MIRT520422 TUBG1 tubulin gamma 1 2 4
MIRT524844 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT526320 UGT2A1 UDP glucuronosyltransferase family 2 member A1 complex locus 2 2
MIRT526561 UGT2A2 UDP glucuronosyltransferase family 2 member A2 2 2
MIRT528027 FEZ2 fasciculation and elongation protein zeta 2 2 2
MIRT529874 RBM43 RNA binding motif protein 43 2 2
MIRT530826 CLEC4D C-type lectin domain family 4 member D 2 2
MIRT531334 GDPD1 glycerophosphodiester phosphodiesterase domain containing 1 2 2
MIRT532068 CCNB1 cyclin B1 2 4
MIRT532870 ZNF566 zinc finger protein 566 2 2
MIRT535580 NUP35 nucleoporin 35 2 2
MIRT537644 ERGIC2 ERGIC and golgi 2 2 4
MIRT537725 ELAVL2 ELAV like RNA binding protein 2 2 2
MIRT538894 BRI3BP BRI3 binding protein 2 2
MIRT538945 BMP2K BMP2 inducible kinase 2 2
MIRT540703 PDPK1 3-phosphoinositide dependent protein kinase 1 2 4
MIRT543210 TMEM117 transmembrane protein 117 2 3
MIRT543357 LYRM2 LYR motif containing 2 2 2
MIRT544905 CLSPN claspin 2 2
MIRT545532 ARF3 ADP ribosylation factor 3 2 2
MIRT546446 SMOC1 SPARC related modular calcium binding 1 2 2
MIRT546882 PURB purine rich element binding protein B 2 4
MIRT547440 MED13 mediator complex subunit 13 2 2
MIRT548027 GOLIM4 golgi integral membrane protein 4 2 2
MIRT548673 CRNKL1 crooked neck pre-mRNA splicing factor 1 2 2
MIRT550435 LLGL2 LLGL2, scribble cell polarity complex component 2 2
MIRT551850 RPS3 ribosomal protein S3 2 2
MIRT556072 MRFAP1 Morf4 family associated protein 1 2 2
MIRT556554 LIMS1 LIM zinc finger domain containing 1 2 2
MIRT557132 HOXA13 homeobox A13 2 2
MIRT557875 FEM1B fem-1 homolog B 2 4
MIRT558146 ELK4 ELK4, ETS transcription factor 2 2
MIRT558862 CD2AP CD2 associated protein 2 2
MIRT558884 CCNE1 cyclin E1 2 4
MIRT558907 CBX5 chromobox 5 2 2
MIRT559175 BRAP BRCA1 associated protein 2 2
MIRT560860 GAL3ST3 galactose-3-O-sulfotransferase 3 2 2
MIRT561729 PPIF peptidylprolyl isomerase F 2 2
MIRT564024 CEBPB CCAAT/enhancer binding protein beta 2 2
MIRT564366 TRMT5 tRNA methyltransferase 5 2 2
MIRT564609 ZNF703 zinc finger protein 703 2 2
MIRT565494 AZF1 azoospermia factor 1 2 2
MIRT565577 SLC6A8 solute carrier family 6 member 8 2 2
MIRT566947 LEPROT leptin receptor overlapping transcript 2 2
MIRT567293 HNRNPA2B1 heterogeneous nuclear ribonucleoprotein A2/B1 2 2
MIRT567308 HMGN2 high mobility group nucleosomal binding domain 2 2 2
MIRT568048 CHSY1 chondroitin sulfate synthase 1 2 2
MIRT571807 PHF19 PHD finger protein 19 2 2
MIRT609234 RBM23 RNA binding motif protein 23 2 2
MIRT610328 SSX5 SSX family member 5 2 2
MIRT611428 UGT8 UDP glycosyltransferase 8 2 4
MIRT611709 SLFN13 schlafen family member 13 2 2
MIRT612069 CEP135 centrosomal protein 135 2 4
MIRT617676 JRKL JRK like 2 2
MIRT623684 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 2
MIRT635634 PRR15L proline rich 15 like 2 2
MIRT636422 MBOAT2 membrane bound O-acyltransferase domain containing 2 2 2
MIRT637011 GPATCH11 G-patch domain containing 11 2 2
MIRT644150 C4orf3 chromosome 4 open reading frame 3 2 2
MIRT648562 MEMO1 mediator of cell motility 1 2 2
MIRT650752 WNT16 Wnt family member 16 2 2
MIRT651914 UEVLD UEV and lactate/malate dehyrogenase domains 2 2
MIRT653556 SLC38A7 solute carrier family 38 member 7 2 2
MIRT692277 XRN2 5'-3' exoribonuclease 2 2 2
MIRT697650 WNK1 WNK lysine deficient protein kinase 1 2 2
MIRT703876 ERCC6 ERCC excision repair 6, chromatin remodeling factor 2 2
MIRT704615 CLIP1 CAP-Gly domain containing linker protein 1 2 2
MIRT708562 BBOX1 gamma-butyrobetaine hydroxylase 1 2 2
MIRT709614 KBTBD6 kelch repeat and BTB domain containing 6 2 2
MIRT712955 SGCD sarcoglycan delta 2 2
MIRT713502 DCAF17 DDB1 and CUL4 associated factor 17 2 2
MIRT720239 GPBP1 GC-rich promoter binding protein 1 2 2
MIRT724255 GLUD1 glutamate dehydrogenase 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4477a Imatinib 5291 NSC743414 approved sensitive High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-miR-4477a Osimertinib 71496458 NSC779217 approved resistant cell line (HCC827)
hsa-miR-4477a Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)

Error report submission