miRTarBase - #MIRT175259


—
pre-miRNA Information
pre-miRNA hsa-mir-8067   
Genomic Coordinates chr15: 62304658 - 62304734
Description Homo sapiens miR-8067 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-8067
Sequence 11| CCUAGAAACUGUAAACUUAGUC |32
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1439702395 3 dbSNP
rs973468045 19 dbSNP
rs1474855764 20 dbSNP
rs183845458 20 dbSNP
Putative Targets

Gene Information
Gene Symbol PSAT1   
Synonyms EPIP, NLS2, PSA, PSAT, PSATD
Description phosphoserine aminotransferase 1
Transcript NM_021154   
Other Transcripts NM_058179   
Expression
Putative miRNA Targets on PSAT1
3'UTR of PSAT1
(miRNA target sites are highlighted)		 
>PSAT1|NM_021154|3'UTR
   1 ACACATCCTAACCAGGATATACTCTGTTCTTGAACAACATACAAAGTTTAAAGTAACTTGGGGATGGCTACAAAAAGTTA
  81 ACACAGTATTTTTCTCAAATGAACATGTTTATTGCAGATTCTTCTTTTTTGAAAGAACAACAGCAAAACATCCACAACTC
 161 TGTAAAGCTGGTGGGACCTAATGTCACCTTAATTCTGACTTGAACTGGAAGCATTTTAAGAAATCTTGTTGCTTTTCTAA
 241 CAAATTCCCGCGTATTTTGCCTTTGCTGCTACTTTTTCTAGTTAGATTTCAAACTTGCCTGTGGACTTAATAATGCAAGT
 321 TGCGATTAATTATTTCTGGAGTCATGGGAACACACAGCACAGAGGGTAGGGGGGCCCTCTAGGTGCTGAATCTACACATC
 401 TGTGGGGTCTCCTGGGTTCAGCGGCTGTTGATTCAAGGTCAACATTGACCATTGGAGGAGTGGTTTAAGAGTGCCAGGCG
 481 AAGGGCAAACTGTAGATCGATCTTTATGCTGTTATTACAGGAGAAGTGACATACTTTATATATGTTTATATTAGCAAGGT
 561 CTGTTTTTAATACCATATACTTTATATTTCTATACATTTATATTTCTAATAATACAGTTATCACTGATATATGTAGACAC
 641 TTTTAGAATTTATTAAATCCTTGACCTTGTGCATTATAGCATTCCATTAGCAAGAGTTGTACCCCCTCCCCAGTCTTCGC
 721 CTTCCTCTTTTTAAGCTGTTTTATGAAAAAGACCTAGAAGTTCTTGATTCATTTTTACCATTCTTTCCATAGGTAGAAGA
 801 GAAAGTTGATTGGTTGGTTGTTTTTCAATTATGCCATTAAACTAAACATTTCTGTTAAATTACCCTATCCTTTGTTCTCT
 881 ACTGTTTTCTTTGTAATGTATGACTACGAGAGTGATACTTTGCTGAAAAGTCTTTCCCCTATTGTTTATCTATTGTCAGT
 961 ATTTTATGTTGAATATGTAAAGAACATTAAAGTCCTAAAACATCTAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cuGAUUCAA--AUGUCAAAGAUCc 5'
            ||  | |  |||  ||||||| 
Target 5' gcCTTTGCTGCTACTTTTTCTAGt 3'
 259 - 282 150.00 -7.10
2 
miRNA  3' cuGAUUCAAAU--GUCAAAGAUCc 5'
            :|: | |||  :| |||||:| 
Target 5' agTTGCGATTAATTA-TTTCTGGa 3'
 318 - 340 133.00 -5.60
3 
miRNA  3' cugaUUCAA--AUGUC----AAAGAucc 5'
              |||||   ||||    |||||   
Target 5' caaaAAGTTAACACAGTATTTTTCTcaa 3'
 71 - 98 118.00 -5.92
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
912650 220 ClinVar
367462 242 ClinVar
912651 252 ClinVar
367463 253 ClinVar
912652 253 ClinVar
912653 294 ClinVar
912654 379 ClinVar
367464 423 ClinVar
913754 497 ClinVar
913755 499 ClinVar
913756 555 ClinVar
367465 593 ClinVar
367466 665 ClinVar
367467 671 ClinVar
914154 720 ClinVar
367468 790 ClinVar
367469 837 ClinVar
367470 866 ClinVar
914155 940 ClinVar
COSN30469335 9 COSMIC
COSN30116467 11 COSMIC
COSN31533554 58 COSMIC
COSN2328516 64 COSMIC
COSN30494688 70 COSMIC
COSN9523582 88 COSMIC
COSN31600842 131 COSMIC
COSN31573909 144 COSMIC
COSN22259776 480 COSMIC
COSN31963052 555 COSMIC
COSN29120568 756 COSMIC
COSN15827104 781 COSMIC
COSN16477356 829 COSMIC
COSN24938179 894 COSMIC
COSN26324655 908 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1376181327 3 dbSNP
rs777691208 4 dbSNP
rs1305709679 5 dbSNP
rs1345650393 7 dbSNP
rs373654141 8 dbSNP
rs1260941235 11 dbSNP
rs771164639 14 dbSNP
rs779224452 15 dbSNP
rs377546355 20 dbSNP
rs1415326767 21 dbSNP
rs1383091743 22 dbSNP
rs768266832 26 dbSNP
rs776559550 28 dbSNP
rs1195204907 30 dbSNP
rs375713892 40 dbSNP
rs772682516 43 dbSNP
rs762410248 44 dbSNP
rs765897031 46 dbSNP
rs912112640 48 dbSNP
rs751156869 50 dbSNP
rs1356601342 52 dbSNP
rs55735002 54 dbSNP
rs1357763425 55 dbSNP
rs1291443041 65 dbSNP
rs944711574 89 dbSNP
rs1041760380 97 dbSNP
rs373306764 102 dbSNP
rs1380015320 121 dbSNP
rs532073374 122 dbSNP
rs1339518091 132 dbSNP
rs767572870 136 dbSNP
rs1406331941 138 dbSNP
rs1363509822 139 dbSNP
rs1336863412 141 dbSNP
rs924600684 144 dbSNP
rs773305506 150 dbSNP
rs936131415 156 dbSNP
rs1363797738 161 dbSNP
rs550727446 169 dbSNP
rs764963253 170 dbSNP
rs894334384 171 dbSNP
rs1012724932 179 dbSNP
rs1268679273 189 dbSNP
rs1196726330 191 dbSNP
rs1481941403 202 dbSNP
rs368179744 210 dbSNP
rs1297266168 211 dbSNP
rs1250125164 215 dbSNP
rs1045685672 221 dbSNP
rs1316766861 225 dbSNP
rs907078101 227 dbSNP
rs1004532311 233 dbSNP
rs1343218095 235 dbSNP
rs1057515673 242 dbSNP
rs962678923 250 dbSNP
rs187331280 251 dbSNP
rs76966550 252 dbSNP
rs17064358 253 dbSNP
rs1484933240 261 dbSNP
rs986225228 262 dbSNP
rs1377272781 267 dbSNP
rs912059641 271 dbSNP
rs566608311 272 dbSNP
rs966301702 276 dbSNP
rs1195754938 290 dbSNP
rs1462124280 291 dbSNP
rs1263262669 294 dbSNP
rs978065995 300 dbSNP
rs1273873087 308 dbSNP
rs1321040687 308 dbSNP
rs1239229691 317 dbSNP
rs1337321849 322 dbSNP
rs924660684 324 dbSNP
rs534118383 325 dbSNP
rs1338851919 332 dbSNP
rs753980162 333 dbSNP
rs1468297276 346 dbSNP
rs935978492 350 dbSNP
rs990261195 352 dbSNP
rs1471253466 355 dbSNP
rs1362454793 359 dbSNP
rs755260572 361 dbSNP
rs1174679828 369 dbSNP
rs371726153 373 dbSNP
rs1431864718 375 dbSNP
rs915962826 377 dbSNP
rs1184969647 402 dbSNP
rs1179083794 403 dbSNP
rs1205392793 406 dbSNP
rs1352360659 408 dbSNP
rs1258796924 410 dbSNP
rs948535954 421 dbSNP
rs10867185 423 dbSNP
rs1465614317 424 dbSNP
rs1317084248 426 dbSNP
rs1450286422 428 dbSNP
rs1339968741 444 dbSNP
rs907027317 453 dbSNP
rs1402701290 463 dbSNP
rs1383042643 465 dbSNP
rs1344157884 468 dbSNP
rs1425680906 478 dbSNP
rs570860296 480 dbSNP
rs1290278116 481 dbSNP
rs1037337607 484 dbSNP
rs898178242 487 dbSNP
rs553854445 497 dbSNP
rs573775683 499 dbSNP
rs1028033654 500 dbSNP
rs1359907248 501 dbSNP
rs1281201926 504 dbSNP
rs1293612163 506 dbSNP
rs1347149403 510 dbSNP
rs1226568732 511 dbSNP
rs1355517463 516 dbSNP
rs889572522 518 dbSNP
rs1432959017 523 dbSNP
rs1007924919 532 dbSNP
rs1224121340 534 dbSNP
rs1405712716 537 dbSNP
rs1291455735 541 dbSNP
rs1019102180 544 dbSNP
rs376749590 555 dbSNP
rs1217982074 561 dbSNP
rs1032312948 568 dbSNP
rs1420836078 569 dbSNP
rs568308325 576 dbSNP
rs1168062593 577 dbSNP
rs1488301628 581 dbSNP
rs1476112152 582 dbSNP
rs1420765077 591 dbSNP
rs115361057 593 dbSNP
rs553947293 596 dbSNP
rs572620565 605 dbSNP
rs778172800 607 dbSNP
rs1219082974 609 dbSNP
rs915910394 618 dbSNP
rs948814663 636 dbSNP
rs981510527 657 dbSNP
rs41277903 665 dbSNP
rs1277586377 666 dbSNP
rs143748888 671 dbSNP
rs1347601579 680 dbSNP
rs1301750390 686 dbSNP
rs1036963176 704 dbSNP
rs1345251010 706 dbSNP
rs1355414871 711 dbSNP
rs1331476854 716 dbSNP
rs1423674638 719 dbSNP
rs898367741 720 dbSNP
rs1480586822 722 dbSNP
rs1049419781 723 dbSNP
rs1367217417 752 dbSNP
rs1189319180 771 dbSNP
rs1477576296 781 dbSNP
rs889437649 784 dbSNP
rs1007957619 787 dbSNP
rs1057515674 790 dbSNP
rs1278912566 798 dbSNP
rs576799548 803 dbSNP
rs1326004618 805 dbSNP
rs1299475549 812 dbSNP
rs544321070 826 dbSNP
rs562487070 829 dbSNP
rs957896304 835 dbSNP
rs41277905 837 dbSNP
rs1400180451 854 dbSNP
rs1022999589 859 dbSNP
rs529821810 866 dbSNP
rs981541758 868 dbSNP
rs928681662 872 dbSNP
rs1413502646 882 dbSNP
rs961239861 884 dbSNP
rs748940129 894 dbSNP
rs1490618598 901 dbSNP
rs973017363 908 dbSNP
rs1231699471 909 dbSNP
rs542019513 914 dbSNP
rs1471472276 917 dbSNP
rs1178271572 922 dbSNP
rs1408169193 931 dbSNP
rs545654977 933 dbSNP
rs1161300205 940 dbSNP
rs931260171 948 dbSNP
rs1285036496 953 dbSNP
rs1049615930 955 dbSNP
rs1386656453 958 dbSNP
rs1376897466 970 dbSNP
rs910907044 973 dbSNP
rs183713691 979 dbSNP
rs1454994463 980 dbSNP
rs943681493 986 dbSNP
rs768478418 991 dbSNP
rs527575923 1005 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 29968.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cuGAUUCAA--AUGUCAAAGAUCc 5'
            ||  | |  |||  ||||||| 
Target 5' --CUUUGCUGCUACUUUUUCUAG- 3'
 		1 - 21
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 29968.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000376588.3 | 3UTR | GCUUUUCUAACAAAUUCCCGCGUAUUUUGCCUUUGCUGCUACUUUUUCUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000376588.3 | 3UTR | CUUUGCUGCUACUUUUUCUAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000376588.3 | 3UTR | AAAUCUUGUUGCUUUUCUAACAAAUUCCCGCGUAUUUUGCCUUUGCUGCUACUUUUUCUAGUUAGAUUUCAAACUUGCCUGUGGACUUAAUAAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
68 hsa-miR-8067 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT084581 BCL2L11 BCL2 like 11 2 4
MIRT088215 NUP50 nucleoporin 50 2 2
MIRT092085 ABHD5 abhydrolase domain containing 5 2 2
MIRT135269 TMBIM6 transmembrane BAX inhibitor motif containing 6 2 8
MIRT175259 PSAT1 phosphoserine aminotransferase 1 2 6
MIRT182508 KLHL20 kelch like family member 20 2 2
MIRT286224 TMEM97 transmembrane protein 97 2 4
MIRT301718 TEF TEF, PAR bZIP transcription factor 2 2
MIRT329381 CCNG1 cyclin G1 2 2
MIRT362146 MTRNR2L6 MT-RNR2-like 6 2 4
MIRT366561 EIF2S3 eukaryotic translation initiation factor 2 subunit gamma 2 2
MIRT442002 NDUFV3 NADH:ubiquinone oxidoreductase subunit V3 2 2
MIRT442039 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT443045 HPS4 HPS4, biogenesis of lysosomal organelles complex 3 subunit 2 2 2
MIRT446861 SAMD9L sterile alpha motif domain containing 9 like 2 2
MIRT450346 LHFPL3 LHFPL tetraspan subfamily member 3 2 2
MIRT454306 ZNF134 zinc finger protein 134 2 2
MIRT481951 ANKRD11 ankyrin repeat domain 11 2 2
MIRT484816 ZNFX1 zinc finger NFX1-type containing 1 2 2
MIRT497596 EBAG9 estrogen receptor binding site associated, antigen, 9 2 2
MIRT498620 MTRNR2L10 MT-RNR2-like 10 2 12
MIRT501852 MTRNR2L8 MT-RNR2-like 8 2 15
MIRT502628 DDX3X DEAD-box helicase 3, X-linked 2 8
MIRT503298 GTF2A1 general transcription factor IIA subunit 1 2 6
MIRT506789 KLHL15 kelch like family member 15 2 6
MIRT515069 PLA2G2C phospholipase A2 group IIC 2 2
MIRT521334 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 2
MIRT523692 FHL2 four and a half LIM domains 2 2 4
MIRT524416 CNOT6L CCR4-NOT transcription complex subunit 6 like 2 4
MIRT525526 FSIP2 fibrous sheath interacting protein 2 2 2
MIRT525771 SOD2 superoxide dismutase 2 2 2
MIRT526262 CCDC169 coiled-coil domain containing 169 2 2
MIRT526545 MDM2 MDM2 proto-oncogene 2 2
MIRT527522 CD59 CD59 molecule (CD59 blood group) 2 2
MIRT530875 TRUB1 TruB pseudouridine synthase family member 1 2 4
MIRT532991 ZKSCAN8 zinc finger with KRAB and SCAN domains 8 2 2
MIRT535581 NUP35 nucleoporin 35 2 2
MIRT536922 HEPHL1 hephaestin like 1 2 2
MIRT540004 NT5DC3 5'-nucleotidase domain containing 3 2 2
MIRT540779 SCO1 SCO1, cytochrome c oxidase assembly protein 2 2
MIRT541006 ZNF136 zinc finger protein 136 2 2
MIRT542072 ASS1 argininosuccinate synthase 1 2 6
MIRT544103 IPMK inositol polyphosphate multikinase 2 2
MIRT547669 KPNA1 karyopherin subunit alpha 1 2 4
MIRT549914 MRPS30 mitochondrial ribosomal protein S30 2 2
MIRT551741 HIST1H2BD histone cluster 1 H2B family member d 2 2
MIRT556374 LUZP1 leucine zipper protein 1 2 2
MIRT557320 HIC2 HIC ZBTB transcriptional repressor 2 2 2
MIRT561442 TOB2 transducer of ERBB2, 2 2 2
MIRT563938 TAF7 TATA-box binding protein associated factor 7 2 2
MIRT622315 SEH1L SEH1 like nucleoporin 2 2
MIRT622334 SEC63 SEC63 homolog, protein translocation regulator 2 2
MIRT627928 KANSL1 KAT8 regulatory NSL complex subunit 1 2 2
MIRT636122 YPEL1 yippee like 1 2 2
MIRT644871 C2orf48 chromosome 2 open reading frame 48 2 2
MIRT645105 LANCL3 LanC like 3 2 2
MIRT650430 BBS9 Bardet-Biedl syndrome 9 2 2
MIRT653330 SMIM18 small integral membrane protein 18 2 2
MIRT658101 FOXN3 forkhead box N3 2 2
MIRT690032 CCDC90B coiled-coil domain containing 90B 2 2
MIRT697283 ZNF800 zinc finger protein 800 2 2
MIRT700266 RAP2B RAP2B, member of RAS oncogene family 2 2
MIRT700310 RABGEF1 RAB guanine nucleotide exchange factor 1 2 2
MIRT705431 ATP11A ATPase phospholipid transporting 11A 2 2
MIRT706193 MED24 mediator complex subunit 24 2 2
MIRT707928 PPP1R3D protein phosphatase 1 regulatory subunit 3D 2 2
MIRT716123 RPL24 ribosomal protein L24 2 2
MIRT720940 PPP1R3E protein phosphatase 1 regulatory subunit 3E 2 2

Error report submission