miRTarBase - #MIRT176641


—
pre-miRNA Information
pre-miRNA hsa-mir-382   
Genomic Coordinates chr14: 101054306 - 101054381
Synonyms MIRN382, hsa-mir-382, MIR382
Description Homo sapiens miR-382 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-382-5p
Sequence 11| GAAGUUGUUCGUGGUGGAUUCG |32
Evidence Experimental
Experiments Cloned
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs192719529 5 dbSNP
rs764920693 10 dbSNP
rs752396166 11 dbSNP
rs762649016 21 dbSNP
rs764006384 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SMC3   
Synonyms BAM, BMH, CDLS3, CSPG6, HCAP, SMC3L1
Description structural maintenance of chromosomes 3
Transcript NM_005445   
Expression
Putative miRNA Targets on SMC3
3'UTR of SMC3
(miRNA target sites are highlighted)		 
>SMC3|NM_005445|3'UTR
   1 TTGGAAAATACTACCTACTGGTTTGGGAGATGTATATAGTAATATGATTCTCATACCCAGGAACTGTAAATTTAAACCTA
  81 AATATTTGGCCAATAGTTTTCAGACTTAAAGCATCATAGTCCTTTTATATTTGTCTTTGTATTTTATAAGATACTCTGTA
 161 ATGTCATGTTTGTACTGATAGTTTAAGAATTTAATTTCCTGTACAACTTTTTGTAAAATGTTCTGCTCCTATTTTAAATG
 241 TTTTGAAACATGCTAAATATTCTTTCCTAATTATTTTATCACTTATACTACCTTTTTTATAGCTTCAATTAAATAATCGG
 321 TTTTATGACTAAAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gcUUAGGU---GGUGCUUGUUGAAg 5'
            |||::|   :| :| ||||||| 
Target 5' agAATTTAATTTCCTGTACAACTTt 3'
 186 - 210 156.00 -12.40
2 
miRNA  3' gcuUA-GGUGG--UGCUUGUUGAAg 5'
             || |:|||   :  |:|:||| 
Target 5' cttATACTACCTTTTTTATAGCTTc 3'
 282 - 306 113.00 -13.40
3 
miRNA  3' gcUUA-GGUG-----GUGCUUGUUGAAg 5'
            ||| :||:     :|| :|:|::|| 
Target 5' gtAATGTCATGTTTGTACTGATAGTTTa 3'
 158 - 185 104.00 -5.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
879045 13 ClinVar
298778 18 ClinVar
879046 37 ClinVar
879047 51 ClinVar
298779 78 ClinVar
298780 159 ClinVar
880258 229 ClinVar
298781 293 ClinVar
298782 298 ClinVar
880259 305 ClinVar
880260 328 ClinVar
298783 330 ClinVar
298784 333 ClinVar
COSN30133610 12 COSMIC
COSN30514759 28 COSMIC
COSN30188147 47 COSMIC
COSN13252783 51 COSMIC
COSN30130981 51 COSMIC
COSN30141442 83 COSMIC
COSN31564010 97 COSMIC
COSN30124446 123 COSMIC
COSN1471140 302 COSMIC
COSN15575582 325 COSMIC
COSN28415489 329 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs754702619 2 dbSNP
rs751980422 9 dbSNP
rs569847844 11 dbSNP
rs371970542 12 dbSNP
rs757465489 14 dbSNP
rs937143378 15 dbSNP
rs772636512 17 dbSNP
rs199611616 18 dbSNP
rs747520781 22 dbSNP
rs771014516 26 dbSNP
rs1293470909 27 dbSNP
rs552273300 28 dbSNP
rs1205808102 29 dbSNP
rs1467784722 30 dbSNP
rs1255993990 31 dbSNP
rs200928191 32 dbSNP
rs770007396 33 dbSNP
rs191584262 38 dbSNP
rs761581923 40 dbSNP
rs781411778 42 dbSNP
rs767261005 46 dbSNP
rs750342692 47 dbSNP
rs760559232 48 dbSNP
rs368890227 51 dbSNP
rs754612506 52 dbSNP
rs904461809 54 dbSNP
rs1000507234 57 dbSNP
rs965272604 60 dbSNP
rs1032377774 64 dbSNP
rs975897837 69 dbSNP
rs886046696 78 dbSNP
rs1238164058 83 dbSNP
rs1196883192 91 dbSNP
rs1188098799 92 dbSNP
rs1481868519 94 dbSNP
rs921388085 100 dbSNP
rs1012034558 113 dbSNP
rs1390866875 117 dbSNP
rs965070520 120 dbSNP
rs1209453662 128 dbSNP
rs1270524160 131 dbSNP
rs1348912017 136 dbSNP
rs762007005 138 dbSNP
rs1030386948 147 dbSNP
rs931388821 152 dbSNP
rs553471027 154 dbSNP
rs368999586 156 dbSNP
rs1391904728 157 dbSNP
rs183542538 159 dbSNP
rs983597123 162 dbSNP
rs908025506 167 dbSNP
rs536012285 181 dbSNP
rs908555675 181 dbSNP
rs1465079560 188 dbSNP
rs940242679 188 dbSNP
rs1175114631 204 dbSNP
rs1438303357 204 dbSNP
rs1380082700 205 dbSNP
rs942328376 207 dbSNP
rs974057727 208 dbSNP
rs927020576 212 dbSNP
rs936966345 215 dbSNP
rs751267099 223 dbSNP
rs562254518 226 dbSNP
rs1486030712 229 dbSNP
rs1282814548 230 dbSNP
rs1214724240 241 dbSNP
rs1353179171 253 dbSNP
rs1366768484 260 dbSNP
rs1230413186 262 dbSNP
rs1056820668 263 dbSNP
rs904910159 265 dbSNP
rs1259948780 267 dbSNP
rs1271250118 269 dbSNP
rs576286124 272 dbSNP
rs1255386055 279 dbSNP
rs1000576882 280 dbSNP
rs916971974 282 dbSNP
rs1337505999 286 dbSNP
rs945780587 287 dbSNP
rs1202028452 289 dbSNP
rs1031946546 291 dbSNP
rs1041560056 291 dbSNP
rs1464216609 293 dbSNP
rs886046697 293 dbSNP
rs188322637 298 dbSNP
rs1417500955 300 dbSNP
rs1248821726 302 dbSNP
rs755315364 305 dbSNP
rs1039987757 306 dbSNP
rs1476835948 309 dbSNP
rs538368899 310 dbSNP
rs1367288664 312 dbSNP
rs900508227 312 dbSNP
rs1377621749 314 dbSNP
rs996151026 319 dbSNP
rs190225025 320 dbSNP
rs1191532150 321 dbSNP
rs1030439322 328 dbSNP
rs182524436 330 dbSNP
rs1174758910 332 dbSNP
rs117538515 333 dbSNP
rs1352554462 334 dbSNP
rs778474364 336 dbSNP
rs375351999 338 dbSNP
rs1294622608 356 dbSNP
rs1397547565 356 dbSNP
rs1028169177 367 dbSNP
rs867680396 371 dbSNP
rs1384339362 377 dbSNP
rs534959202 384 dbSNP
rs1389026800 385 dbSNP
rs963838532 386 dbSNP
rs973716727 388 dbSNP
rs1384643479 390 dbSNP
rs1299977641 393 dbSNP
rs1477524332 396 dbSNP
rs1373912368 398 dbSNP
rs908524564 408 dbSNP
rs1331124877 412 dbSNP
rs1450018210 413 dbSNP
rs1265020980 424 dbSNP
rs1212789364 428 dbSNP
rs1468888242 430 dbSNP
rs201410268 432 dbSNP
rs1216313875 439 dbSNP
rs940064929 440 dbSNP
rs752055644 444 dbSNP
rs927525419 446 dbSNP
rs749349849 448 dbSNP
rs1328944394 452 dbSNP
rs755550715 456 dbSNP
rs958424137 459 dbSNP
rs1325684186 466 dbSNP
rs1328245137 469 dbSNP
rs576736009 471 dbSNP
rs1269053601 474 dbSNP
rs1329891783 476 dbSNP
rs1409524200 477 dbSNP
rs1418240351 488 dbSNP
rs1397309399 489 dbSNP
rs948987061 492 dbSNP
rs1486969377 493 dbSNP
rs1377244483 498 dbSNP
rs1208195786 500 dbSNP
rs553260142 521 dbSNP
rs375118725 539 dbSNP
rs1196673533 545 dbSNP
rs916885815 550 dbSNP
rs1273121329 551 dbSNP
rs1196988577 552 dbSNP
rs574456083 553 dbSNP
rs936407994 554 dbSNP
rs540734163 556 dbSNP
rs945808539 558 dbSNP
rs1053498862 562 dbSNP
rs541844875 568 dbSNP
rs1331013752 570 dbSNP
rs1412806163 576 dbSNP
rs1375124205 578 dbSNP
rs558975039 586 dbSNP
rs925849480 589 dbSNP
rs1396672255 604 dbSNP
rs1468583540 605 dbSNP
rs529884768 608 dbSNP
rs1233353283 611 dbSNP
rs753173532 624 dbSNP
rs996780793 625 dbSNP
rs935825220 633 dbSNP
rs755771833 638 dbSNP
rs1039653013 641 dbSNP
rs777248288 643 dbSNP
rs1228848501 644 dbSNP
rs998077841 645 dbSNP
rs1223540011 647 dbSNP
rs1374750933 655 dbSNP
rs10884993 657 dbSNP
rs890425775 658 dbSNP
rs563633141 668 dbSNP
rs140019681 672 dbSNP
rs1242925073 678 dbSNP
rs745739948 680 dbSNP
rs1265035686 686 dbSNP
rs1015709913 708 dbSNP
rs1015417545 710 dbSNP
rs1156714357 715 dbSNP
rs778395233 717 dbSNP
rs995398065 718 dbSNP
rs1408700824 719 dbSNP
rs1160220092 723 dbSNP
rs992803065 724 dbSNP
rs1483009712 727 dbSNP
rs1183465732 728 dbSNP
rs552419564 731 dbSNP
rs746081900 733 dbSNP
rs545033472 736 dbSNP
rs1422390949 739 dbSNP
rs1215586429 748 dbSNP
rs1260552474 748 dbSNP
rs1317884784 753 dbSNP
rs1392637528 755 dbSNP
rs948969417 758 dbSNP
rs1227114893 762 dbSNP
rs1163660313 764 dbSNP
rs111315980 767 dbSNP
rs1275598969 779 dbSNP
rs1426047542 795 dbSNP
rs1166167849 800 dbSNP
rs993008107 806 dbSNP
rs1410371314 807 dbSNP
rs772054350 814 dbSNP
rs1459831237 817 dbSNP
rs528454819 818 dbSNP
rs936208285 823 dbSNP
rs1053465177 825 dbSNP
rs1417024652 825 dbSNP
rs191125631 826 dbSNP
rs548642231 829 dbSNP
rs945130242 831 dbSNP
rs1248342251 832 dbSNP
rs977232414 838 dbSNP
rs925680066 848 dbSNP
rs1274328794 852 dbSNP
rs1235276674 860 dbSNP
rs1040687405 861 dbSNP
rs935872904 868 dbSNP
rs773259129 871 dbSNP
rs975670243 872 dbSNP
rs185570392 875 dbSNP
rs763250299 887 dbSNP
rs933901389 889 dbSNP
rs1050956541 898 dbSNP
rs1393709041 899 dbSNP
rs766306838 902 dbSNP
rs557259851 907 dbSNP
rs1253545493 910 dbSNP
rs888270823 914 dbSNP
rs1005425864 916 dbSNP
rs1428776043 916 dbSNP
rs940662063 919 dbSNP
rs1256501208 924 dbSNP
rs569402210 926 dbSNP
rs1454095394 927 dbSNP
rs1254250318 929 dbSNP
rs1216100602 931 dbSNP
rs1036473986 932 dbSNP
rs1479911252 938 dbSNP
rs1250852176 940 dbSNP
rs760109162 941 dbSNP
rs899266627 943 dbSNP
rs61861701 945 dbSNP
rs532341694 948 dbSNP
rs1231886943 961 dbSNP
rs1369976280 970 dbSNP
rs1303792806 977 dbSNP
rs149820913 979 dbSNP
rs1389015588 981 dbSNP
rs1443035517 981 dbSNP
rs1371034776 983 dbSNP
rs371612433 989 dbSNP
rs756382399 995 dbSNP
rs1357327114 996 dbSNP
rs1171357144 1004 dbSNP
rs1433642464 1011 dbSNP
rs145835171 1012 dbSNP
rs149058674 1019 dbSNP
rs1417886962 1021 dbSNP
rs1250397403 1022 dbSNP
rs1177904729 1024 dbSNP
rs1384656918 1028 dbSNP
rs1454787967 1034 dbSNP
rs1481652450 1034 dbSNP
rs574179047 1043 dbSNP
rs1278542930 1052 dbSNP
rs957621461 1054 dbSNP
rs1348803398 1056 dbSNP
rs977473861 1057 dbSNP
rs112801830 1065 dbSNP
rs1315104010 1066 dbSNP
rs563359301 1072 dbSNP
rs188948162 1073 dbSNP
rs1310481145 1078 dbSNP
rs1298419890 1083 dbSNP
rs545790158 1091 dbSNP
rs1413811814 1097 dbSNP
rs1041214652 1106 dbSNP
rs1370807243 1110 dbSNP
rs1175963498 1124 dbSNP
rs921100207 1128 dbSNP
rs933806953 1135 dbSNP
rs1363785898 1139 dbSNP
rs75761003 1146 dbSNP
rs528543721 1150 dbSNP
rs932337696 1153 dbSNP
rs1187254952 1154 dbSNP
rs1256965459 1166 dbSNP
rs1462880573 1170 dbSNP
rs1049667644 1171 dbSNP
rs35835625 1176 dbSNP
rs117553447 1179 dbSNP
rs1036787070 1191 dbSNP
rs1239695597 1192 dbSNP
rs529387380 1193 dbSNP
rs1449586206 1195 dbSNP
rs1005479917 1198 dbSNP
rs778380946 1201 dbSNP
rs61861702 1208 dbSNP
rs1335767086 1214 dbSNP
rs779707415 1219 dbSNP
rs1380954310 1220 dbSNP
rs1359188721 1229 dbSNP
rs1423052202 1229 dbSNP
rs1290025584 1230 dbSNP
rs569358268 1238 dbSNP
rs746859757 1238 dbSNP
rs1164425038 1242 dbSNP
rs1475668113 1244 dbSNP
rs1191113361 1247 dbSNP
rs1176622979 1248 dbSNP
rs1055882138 1251 dbSNP
rs879242643 1269 dbSNP
rs1408070476 1270 dbSNP
rs1466057157 1271 dbSNP
rs1271061435 1276 dbSNP
rs10884994 1277 dbSNP
rs142116493 1278 dbSNP
rs147760495 1284 dbSNP
rs1296877433 1291 dbSNP
rs1001451405 1299 dbSNP
rs1392669445 1303 dbSNP
rs1325660817 1304 dbSNP
rs370738980 1317 dbSNP
rs1290694915 1321 dbSNP
rs1166424564 1324 dbSNP
rs530517727 1327 dbSNP
rs188984199 1328 dbSNP
rs1250832246 1333 dbSNP
rs1451267001 1333 dbSNP
rs1192767455 1344 dbSNP
rs117281846 1354 dbSNP
rs1291547665 1356 dbSNP
rs570915278 1357 dbSNP
rs913383651 1358 dbSNP
rs370732810 1359 dbSNP
rs566866964 1359 dbSNP
rs573953392 1359 dbSNP
rs1369427972 1362 dbSNP
rs997037033 1369 dbSNP
rs776491393 1374 dbSNP
rs1333232393 1376 dbSNP
rs1414171059 1378 dbSNP
rs1327053972 1382 dbSNP
rs556977812 1386 dbSNP
rs932390030 1391 dbSNP
rs1267175892 1396 dbSNP
rs535235119 1399 dbSNP
rs1433010414 1404 dbSNP
rs575352458 1425 dbSNP
rs955217255 1426 dbSNP
rs1454524644 1427 dbSNP
rs1248270877 1432 dbSNP
rs1487851752 1436 dbSNP
rs941234525 1437 dbSNP
rs1037378329 1440 dbSNP
rs1250883412 1464 dbSNP
rs1206668837 1466 dbSNP
rs1204674965 1467 dbSNP
rs986653044 1469 dbSNP
rs908348521 1472 dbSNP
rs1235710747 1475 dbSNP
rs1347516817 1477 dbSNP
rs371274581 1480 dbSNP
rs1441662566 1481 dbSNP
rs1336572548 1482 dbSNP
rs1310147986 1492 dbSNP
rs961599586 1492 dbSNP
rs1411576112 1494 dbSNP
rs1412987819 1495 dbSNP
rs973978489 1496 dbSNP
rs1401516673 1499 dbSNP
rs1414989296 1508 dbSNP
rs1320458704 1512 dbSNP
rs896980358 1515 dbSNP
rs1348237094 1516 dbSNP
rs1469493245 1519 dbSNP
rs11195216 1535 dbSNP
rs1045572446 1537 dbSNP
rs7898064 1539 dbSNP
rs1001588882 1545 dbSNP
rs1212152485 1547 dbSNP
rs1055835906 1553 dbSNP
rs915977916 1554 dbSNP
rs1282849238 1559 dbSNP
rs1223561911 1562 dbSNP
rs1032953685 1563 dbSNP
rs1408447649 1570 dbSNP
rs1231715406 1571 dbSNP
rs867836457 1576 dbSNP
rs1313569320 1581 dbSNP
rs868198764 1585 dbSNP
rs1225151099 1591 dbSNP
rs1316196760 1592 dbSNP
rs1399867563 1599 dbSNP
rs201451616 1600 dbSNP
rs1160864976 1603 dbSNP
rs999513968 1605 dbSNP
rs1010473655 1607 dbSNP
rs1054709286 1609 dbSNP
rs556927653 1612 dbSNP
rs1181934064 1622 dbSNP
rs1473526002 1630 dbSNP
rs1020987723 1634 dbSNP
rs1447897646 1636 dbSNP
rs1270440529 1641 dbSNP
rs1211991329 1642 dbSNP
rs966232587 1642 dbSNP
rs1221618301 1647 dbSNP
rs976614532 1650 dbSNP
rs1029173653 1657 dbSNP
rs191938778 1661 dbSNP
rs1181289536 1663 dbSNP
rs1389031287 1666 dbSNP
rs1322303468 1669 dbSNP
rs1252279479 1677 dbSNP
rs1459739925 1680 dbSNP
rs35141427 1684 dbSNP
rs1160535508 1685 dbSNP
rs1165100478 1691 dbSNP
rs1027971261 1694 dbSNP
rs529262330 1710 dbSNP
rs754455101 1713 dbSNP
rs955123828 1715 dbSNP
rs1186393027 1719 dbSNP
rs375073401 1719 dbSNP
rs1164280418 1725 dbSNP
rs1450648929 1726 dbSNP
rs1192134961 1735 dbSNP
rs1367466339 1735 dbSNP
rs1007948687 1738 dbSNP
rs761485429 1739 dbSNP
rs1324492087 1741 dbSNP
rs1224095578 1745 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions BC-1
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM796038. RNA binding protein: AGO2. Condition:4-Thiouridine ...

- Gottwein E; Corcoran DL; Mukherjee N; et al., 2011, Cell host & microbe.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gcUUAGGU---GGUGCUUGUUGAAg 5'
            |||::|   :| :| ||||||| 
Target 5' agAAUUUAAUUUCCUGUACAACUUu 3'
 		4 - 28
Article - Gottwein E; Corcoran DL; Mukherjee N; et al.
- Cell host & microbe, 2011
Primary effusion lymphoma (PEL) is caused by Kaposi's sarcoma-associated herpesvirus (KSHV) and frequently also harbors Epstein-Barr virus (EBV). The expression of KSHV- and EBV-encoded microRNAs (miRNAs) in PELs suggests a role for these miRNAs in latency and lymphomagenesis. Using PAR-CLIP, a technology which allows the direct and transcriptome-wide identification of miRNA targets, we delineate the target sites for all viral and cellular miRNAs expressed in PEL cell lines. The resulting data set revealed that KSHV miRNAs directly target more than 2000 cellular mRNAs, including many involved in pathways relevant to KSHV pathogenesis. Moreover, 58% of these mRNAs are also targeted by EBV miRNAs, via distinct binding sites. In addition to a known viral analog of cellular miR-155, we show that KSHV encodes a viral miRNA that mimics cellular miR-142-3p function. In summary, this study identifies an extensive list of KSHV miRNA targets, which are likely to influence viral replication and pathogenesis.
LinkOut: [PMID: 22100165]
CLIP-seq Support 1 for dataset GSM796038
Method / RBP PAR-CLIP / AGO2
Cell line / Condition BC-1 / 4-Thiouridine
Location of target site ENST00000361804.4 | 3UTR | UUAAGAAUUUAAUUUCCUGUACAACUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22100165 / GSE32109
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19350 CNS germ cell tumors -0.602 1.9e-2 -0.531 3.8e-2 12 Click to see details
GSE38226 Liver fibrosis 0.438 2.4e-2 0.568 3.6e-3 21 Click to see details
GSE17306 Multiple myeloma 0.257 3.7e-2 0.290 2.2e-2 49 Click to see details
GSE19783 ER- ER- breast cancer -0.174 6.3e-2 -0.170 6.7e-2 79 Click to see details
GSE19536 Breast cancer -0.154 6.3e-2 -0.166 4.9e-2 100 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.252 1.1e-1 0.323 5.8e-2 25 Click to see details
GSE17498 Multiple myeloma -0.163 1.6e-1 -0.155 1.7e-1 40 Click to see details
GSE42095 Differentiated embryonic stem cells -0.2 1.8e-1 -0.306 7.8e-2 23 Click to see details
GSE28544 Breast cancer -0.166 2.2e-1 -0.246 1.2e-1 24 Click to see details
GSE28260 Renal cortex and medulla 0.215 2.4e-1 0.203 2.5e-1 13 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.133 2.9e-1 -0.200 2.0e-1 20 Click to see details
GSE26953 Aortic valvular endothelial cells 0.095 3.3e-1 -0.090 3.4e-1 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.092 3.3e-1 0.142 2.5e-1 25 Click to see details
GSE32688 Pancreatic cancer 0.08 3.3e-1 0.231 1.0e-1 32 Click to see details
GSE21849 B cell lymphoma -0.074 3.5e-1 0.212 1.3e-1 29 Click to see details
GSE27834 Pluripotent stem cells -0.06 4.1e-1 -0.115 3.4e-1 16 Click to see details
GSE21687 Ependynoma primary tumors -0.02 4.4e-1 0.041 3.7e-1 64 Click to see details
GSE21032 Prostate cancer 0.017 4.4e-1 -0.012 4.6e-1 83 Click to see details
GSE19783 ER+ ER+ breast cancer -0.017 4.7e-1 0.110 3.2e-1 20 Click to see details
GSE14794 Lymphoblastoid cells 0.002 4.9e-1 0.138 9.7e-2 90 Click to see details
GSE14794 Lymphoblastoid cells 0.002 4.9e-1 0.138 9.7e-2 90 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
COAD -0.651 0.04 -0.619 0.05 8 Click to see details
LUAD 0.502 0.05 0.420 0.09 12 Click to see details
THCA 0.206 0.07 0.209 0.06 55 Click to see details
CHOL -0.539 0.07 -0.300 0.22 9 Click to see details
KICH 0.286 0.09 0.258 0.11 24 Click to see details
BLCA -0.299 0.11 -0.030 0.45 18 Click to see details
STAD -0.219 0.11 -0.227 0.11 32 Click to see details
UCEC -0.286 0.12 -0.361 0.06 19 Click to see details
BRCA -0.119 0.14 -0.094 0.2 84 Click to see details
KIRP 0.191 0.15 0.239 0.09 32 Click to see details
CESC -0.884 0.15 -0.500 0.33 3 Click to see details
HNSC -0.146 0.18 -0.098 0.27 42 Click to see details
ESCA -0.211 0.27 -0.136 0.35 11 Click to see details
PAAD -0.452 0.27 -0.800 0.1 4 Click to see details
KIRC -0.061 0.32 -0.087 0.25 62 Click to see details
LIHC 0.062 0.34 0.023 0.44 49 Click to see details
LUSC -0.058 0.36 -0.137 0.21 38 Click to see details
PCPG 0.15 0.45 0.500 0.33 3 Click to see details
PRAD 0.012 0.47 0.042 0.39 50 Click to see details
PRAD 0.012 0.47 0.042 0.39 50 Click to see details
PRAD 0.012 0.47 0.042 0.39 50 Click to see details
112 hsa-miR-382-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT053778 PTEN phosphatase and tensin homolog 4 1
MIRT060847 XPR1 xenotropic and polytropic retrovirus receptor 1 1 1
MIRT064748 CCND2 cyclin D2 2 6
MIRT066666 DYRK2 dual specificity tyrosine phosphorylation regulated kinase 2 2 4
MIRT077432 PNPO pyridoxamine 5'-phosphate oxidase 2 2
MIRT082804 ZNF264 zinc finger protein 264 2 4
MIRT089341 PCBP1 poly(rC) binding protein 1 2 6
MIRT176641 SMC3 structural maintenance of chromosomes 3 2 2
MIRT223217 ZKSCAN5 zinc finger with KRAB and SCAN domains 5 2 2
MIRT229780 GNL3L G protein nucleolar 3 like 2 2
MIRT244332 ARL4A ADP ribosylation factor like GTPase 4A 1 1
MIRT326971 EIF1AX eukaryotic translation initiation factor 1A, X-linked 2 4
MIRT369626 APCDD1 APC down-regulated 1 2 2
MIRT407707 MXD1 MAX dimerization protein 1 2 1
MIRT437905 NFIA nuclear factor I A 2 1
MIRT438103 DRD1 dopamine receptor D1 1 1
MIRT439190 ZNF652 zinc finger protein 652 1 1
MIRT439248 ZCCHC14 zinc finger CCHC-type containing 14 1 1
MIRT439276 XPO1 exportin 1 1 1
MIRT439382 TSPYL1 TSPY like 1 1 1
MIRT439494 SYT13 synaptotagmin 13 1 1
MIRT439497 SYNJ2 synaptojanin 2 1 1
MIRT439516 STT3A STT3A, catalytic subunit of the oligosaccharyltransferase complex 1 1
MIRT439564 SOGA2 microtubule crosslinking factor 1 1 1
MIRT439677 SERGEF secretion regulating guanine nucleotide exchange factor 1 1
MIRT439709 SAR1B secretion associated Ras related GTPase 1B 1 1
MIRT439802 RBM39 RNA binding motif protein 39 1 1
MIRT439819 RAPH1 Ras association (RalGDS/AF-6) and pleckstrin homology domains 1 1 1
MIRT439894 PRNP prion protein 1 1
MIRT439921 PPM1A protein phosphatase, Mg2+/Mn2+ dependent 1A 1 1
MIRT439942 PNMA2 paraneoplastic Ma antigen 2 1 1
MIRT439999 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 1 1
MIRT440023 PCNXL2 pecanex homolog 2 1 1
MIRT440041 PARM1 prostate androgen-regulated mucin-like protein 1 1 1
MIRT440180 MTRNR2L8 MT-RNR2-like 8 1 1
MIRT440191 MTRNR2L2 MT-RNR2-like 2 1 1
MIRT440195 MTRNR2L1 MT-RNR2-like 1 1 1
MIRT440198 MTPN myotrophin 1 1
MIRT440303 LUZP6 leucine zipper protein 6 1 1
MIRT440365 KIF5C kinesin family member 5C 1 1
MIRT440376 KIAA2022 neurite extension and migration factor 1 1
MIRT440514 HERC2 HECT and RLD domain containing E3 ubiquitin protein ligase 2 1 1
MIRT440626 FNIP1 folliculin interacting protein 1 1 1
MIRT440679 FAM199X family with sequence similarity 199, X-linked 1 1
MIRT440762 DYNC1H1 dynein cytoplasmic 1 heavy chain 1 1 1
MIRT440814 DICER1 dicer 1, ribonuclease III 1 1
MIRT440839 DDOST dolichyl-diphosphooligosaccharide--protein glycosyltransferase non-catalytic subunit 1 1
MIRT440851 DAD1 defender against cell death 1 1 1
MIRT440909 COPS4 COP9 signalosome subunit 4 1 1
MIRT440931 CLTC clathrin heavy chain 1 1
MIRT441003 CASP3 caspase 3 1 1
MIRT441121 BBS4 Bardet-Biedl syndrome 4 1 1
MIRT441181 ARMCX3 armadillo repeat containing, X-linked 3 1 1
MIRT441259 ADM adrenomedullin 1 1
MIRT441796 EXOSC2 exosome component 2 2 2
MIRT443001 SLC3A1 solute carrier family 3 member 1 2 2
MIRT445896 FAM46A family with sequence similarity 46 member A 2 2
MIRT445930 UFL1 UFM1 specific ligase 1 2 2
MIRT447479 NYAP2 neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2 2 2
MIRT450664 SMURF2 SMAD specific E3 ubiquitin protein ligase 2 2 2
MIRT454105 TMEM209 transmembrane protein 209 2 2
MIRT459477 HIST1H3G histone cluster 1 H3 family member g 2 2
MIRT464867 UBB ubiquitin B 2 8
MIRT466300 TM4SF1 transmembrane 4 L six family member 1 2 2
MIRT470024 PTP4A2 protein tyrosine phosphatase type IVA, member 2 2 2
MIRT472335 NETO2 neuropilin and tolloid like 2 2 4
MIRT472973 MSANTD3 Myb/SANT DNA binding domain containing 3 2 2
MIRT478514 CTTN cortactin 2 6
MIRT501170 SLC10A7 solute carrier family 10 member 7 2 6
MIRT501800 NHLRC3 NHL repeat containing 3 2 6
MIRT504301 ZNF318 zinc finger protein 318 2 6
MIRT507913 CALM1 calmodulin 1 2 4
MIRT511139 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 2
MIRT512231 ATXN3 ataxin 3 2 6
MIRT514375 UBBP4 ubiquitin B pseudogene 4 2 6
MIRT516686 ZNF860 zinc finger protein 860 2 4
MIRT523197 HIST1H3F histone cluster 1 H3 family member f 2 2
MIRT529767 SF3B1 splicing factor 3b subunit 1 2 2
MIRT533901 TBL1XR1 transducin beta like 1 X-linked receptor 1 2 2
MIRT534934 PTGDR prostaglandin D2 receptor 2 2
MIRT535125 PLSCR4 phospholipid scramblase 4 2 2
MIRT536454 KLHL3 kelch like family member 3 2 2
MIRT537076 GPR176 G protein-coupled receptor 176 2 2
MIRT537336 FRAXA fragile site, folic acid type, rare, fra(X)(q27.3) A (macroorchidism, mental retardation) 2 2
MIRT537513 FAM105A family with sequence similarity 105 member A 2 2
MIRT544499 SLC25A46 solute carrier family 25 member 46 2 2
MIRT546072 VEZF1 vascular endothelial zinc finger 1 2 2
MIRT546537 NHS NHS actin remodeling regulator 2 4
MIRT552796 YAF2 YY1 associated factor 2 2 2
MIRT559300 ATXN1 ataxin 1 2 2
MIRT559851 GSKIP GSK3B interacting protein 2 2
MIRT563341 RPLP0 ribosomal protein lateral stalk subunit P0 2 2
MIRT563969 RAB6A RAB6A, member RAS oncogene family 2 2
MIRT564767 ZFP36L1 ZFP36 ring finger protein like 1 2 2
MIRT565057 VAMP3 vesicle associated membrane protein 3 2 2
MIRT565585 SLC6A8 solute carrier family 6 member 8 2 2
MIRT574166 ATG10 autophagy related 10 2 2
MIRT612545 RPAP2 RNA polymerase II associated protein 2 2 4
MIRT613882 ADO 2-aminoethanethiol dioxygenase 2 2
MIRT617251 SPIC Spi-C transcription factor 2 2
MIRT620608 SAP30 Sin3A associated protein 30 2 2
MIRT620665 MRPS18C mitochondrial ribosomal protein S18C 2 2
MIRT630854 KLHDC10 kelch domain containing 10 2 2
MIRT661986 DSN1 DSN1 homolog, MIS12 kinetochore complex component 2 4
MIRT686138 B4GALT7 beta-1,4-galactosyltransferase 7 2 2
MIRT698032 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT700741 PLEKHA8 pleckstrin homology domain containing A8 2 2
MIRT716928 G3BP2 G3BP stress granule assembly factor 2 2 2
MIRT731079 YBX1 Y-box binding protein 1 3 1
MIRT733642 TOP1 DNA topoisomerase I 2 0
MIRT734728 NR3C1 nuclear receptor subfamily 3 group C member 1 3 0
MIRT756465 NR1H4 nuclear receptor subfamily 1 group H member 4 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-382 Vorinostat (SAHA) approved 5311 Microarray A549 human non-small cell lung cancer cells 19513533 2009 up-regulated
miR-382 Morphine approved 5288826 Quantitative real-time PCR HIV 21224041 2011 down-regulated
miR-382 Budesonide approved 5281004 Microarray neonatal mice liver 20145010 2010 down-regulated
miR-382 Phenethyl isothiocyanate(PEITC) NULL 16741 Microarray neonatal mice liver 20145010 2010 down-regulated
miR-382 Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 up-regulated
miR-382 Propranolol approved 4946 Quantitative real-time PCR heart 22847192 2012 down-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-382 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-382 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-382-5p (11r,15s,17s)-17-methyl-14,16-dioxatetracyclo[8.7.0.03,8.011,15]heptadeca-1(10),3,5,7-tetraene-2,9-dione 54611663 NSC722392 resistant
hsa-miR-382-5p (2E,5Z)-2-[(5-acetyl-4-methyl-1,3-thiazol-2-yl)hydrazinylidene]-5-[(2-methoxyphenyl)methylidene]-1,3-thiazolidin-4-one 135472679 NSC658292 sensitive
hsa-miR-382-5p (2R)-2-(1H-benzimidazol-2-yl)-2-(2-chloro-6-methylpyrimidin-4-yl)acetonitrile 390694 NSC688326 resistant
hsa-miR-382-5p (2S,6S,7S,12R)-16-bromo-9-tert-butyl-4-phenyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 372657 NSC648154 sensitive
hsa-miR-382-5p (3-(trifluoromethyl)anilino)(2-(trifluoromethyl)phenyl)acetonitrile 375079 NSC654017 resistant
hsa-miR-382-5p (4-chlorophenyl)-[5-(2,4-dichloro-5-fluorophenyl)-5-hydroxy-3-(4-methoxyphenyl)-4h-pyrazol-1-yl]methanone 400818 NSC713324 resistant
hsa-miR-382-5p (4-chlorophenyl) 3-methyl-5-nitroimidazole-4-sulfonate 236063 NSC38086 resistant
hsa-miR-382-5p (4E)-2-(2-hydroxybenzoyl)-5-methyl-4-[(4-nitrophenyl)methylidene]pyrazol-3-one 5467414 NSC652175 sensitive
hsa-miR-382-5p (4e,12z,27z,43z)-hexatetraconta-4,12,27,43-tetraen-1,18,21,45-tetrayne-3,20-diol 5470605 NSC703544 resistant
hsa-miR-382-5p (5e)-5-[(3,4-dimethoxyphenyl)methylidene]-3-phenyl-2-propylimino-1,3-thiazolidin-4-one 5471348 NSC710598 sensitive
hsa-miR-382-5p (5s,8ar,9r)-5-[(3-fluorophenyl)methylamino]-9-(4-hydroxy-3,5-dimethoxyphenyl)-5a,6,8a,9-tetrahydro-5h-[2]benzofuro[6,5-f][1,3]benzodioxol-8-one 369915 NSC642282 sensitive
hsa-miR-382-5p (7E)-6-(methoxymethoxy)-2-methylcyclododec-7-en-3-yn-1-one 5467712 NSC658114 resistant
hsa-miR-382-5p (E)-3-(3-chlorophenyl)-N-[2-[(1,1-dioxothian-4-yl)-methylamino]-2-oxoethyl]prop-2-enamide 51003603 NSC761184 resistant
hsa-miR-382-5p (e)-phenyl(2-pyridinyl)methanone (6-chloro-4-pyrimidinyl)hydrazone 9571636 NSC693248 resistant
hsa-miR-382-5p (NE)-N-[(6E)-2-[(hydroxyamino)-(4-phenylmethoxyphenyl)methyl]-6-[(4-phenylmethoxyphenyl)methylidene]cyclohexylidene]hydroxylamine 5928828 NSC632824 resistant
hsa-miR-382-5p [(1h-benzimidazole-2-yl)dithio]-9h-purine 54613148 NSC750485 resistant
hsa-miR-382-5p [(3aR,8S)-8-acetyloxy-6-methyl-3,9-dimethylidene-2-oxo-4,6a,7,8,9a,9b-hexahydro-3aH-azuleno[4,5-b]furan-4-yl] 3-acetyloxy-2-hydroxy-2-methylbutanoate 380982 NSC666858 resistant
hsa-miR-382-5p [(4e)-4-[2-(3,3,6a,10b-tetramethyl-8-methylidene-1,4a,5,6,7,9,10,10a-octahydronaphtho[2,1-d][1,3]dioxin-7-yl)ethylidene]-5-oxooxolan-3-yl] acetate 25121273 NSC750035 resistant
hsa-miR-382-5p [(5R,6S)-4-cyclohexyl-6-(2,2-diphenylcyclopentyl)oxy-2-oxido-5,6-dihydro-4H-oxazin-2-ium-5-yl] acetate 395278 NSC699756 resistant
hsa-miR-382-5p [(8R,10S,13R)-7,12-diacetyloxy-17-[5,5-bis(4-chlorophenyl)pent-4-en-2-yl]-10,13-dimethyl-2,3,4,5,6,7,8,9,11,12,14,15,16,17-tetradecahydro-1H-cyclopenta[a]phenanthren-3-yl] acetate 376380 NSC657282 sensitive
hsa-miR-382-5p [(E)-1-chloropropylideneamino] N-[2-(trifluoromethoxy)phenyl]carbamate 5466266 NSC682836 resistant
hsa-miR-382-5p [(Z)-(1-chloro-2-methylpropylidene)amino] N-(4-bromophenyl)carbamate 9556248 NSC682825 resistant
hsa-miR-382-5p [1-[(e)-(5-nitrofuran-2-yl)methylideneamino]benzimidazol-2-yl]methanol 9572565 NSC720255 resistant
hsa-miR-382-5p [1-[[[2-amino-6-chloro-5-[(4-chlorophenyl)diazenyl]pyrimidin-4-yl]amino]methyl]-3-phenylmethoxycyclobutyl]methanol 385284 NSC676395 resistant
hsa-miR-382-5p [3,4,5-triacetyloxy-6-(3-cyano-6-phenyl-2-sulfanyl-4-thiophen-2-yl-4h-pyridin-1-yl)oxan-2-yl]methyl acetate 381303 NSC667740 sensitive
hsa-miR-382-5p [3,4,5-triacetyloxy-6-[(e)-2-(azidomethyl)-3-oxobut-1-enoxy]oxan-2-yl]methyl acetate 5471355 NSC710716 resistant
hsa-miR-382-5p [4-[(4-bromophenyl)carbamothioyl]phenyl] n-(4-chlorophenyl)carbamate 5471250 NSC710003 resistant
hsa-miR-382-5p [acetyl-[5-(trityloxymethyl)spiro[3a,5,6,6a-tetrahydrofuro[2,3-d][1,3]dioxole-2,1'-cyclopentane]-6-yl]amino] acetate 374290 NSC651809 sensitive
hsa-miR-382-5p 1-(2-methoxyphenyl)-3-[(z)-1-(2-pyridyl)ethylideneamino]thiourea 5367237 NSC668297 resistant
hsa-miR-382-5p 1-(9-methoxy-11,12-dihydro-6h-indolo[1,2-b][2]benzazepin-13-yl)ethanone 365697 NSC633551 sensitive
hsa-miR-382-5p 1-[(4-bromophenyl)amino]cyclopentanecarbonitrile 238637 NSC43101 resistant
hsa-miR-382-5p 1-[1-(3,4-dimethoxyphenyl)-5-ethyl-7,8-dimethoxy-4-methyl-2,3-benzodiazepin-3-yl]ethanone 343249 NSC382585 resistant
hsa-miR-382-5p 1-[5-[[[4-chlorobutyl(methyl)amino]-[(5-nitrofuran-2-yl)methoxy]phosphoryl]oxymethyl]-2,5-dihydrofuran-2-yl]-5-methylpyrimidine-2,4-dione 404846 NSC721390 sensitive
hsa-miR-382-5p 1-benzyl-2-methyl-1-(2-phenylethyl)-4,5-dihydroimidazol-1-ium 413544 NSC49460 sensitive
hsa-miR-382-5p 14,22-dioxa-6,30,36-triazahexacyclo[29.2.2.22,5.116,20.08,13.023,28]octatriaconta-1(34),2(38),3,5(37),6,8,10,12,16(36),17,19,23,25,27,29,31(35),32-heptadecaene 388224 NSC682817 sensitive
hsa-miR-382-5p 16-methoxy-4-(4-methoxyphenyl)-9-propan-2-yl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 390916 NSC689137 sensitive
hsa-miR-382-5p 17-acetyl-15-benzyl-9,14-dihydroxy-16-methyl-15-azatetracyclo[8.7.0.01,14.03,8]heptadeca-3,5,7,9,12,16-hexaene-2,11-dione 24203201 NSC727113 resistant
hsa-miR-382-5p 17-acetyl-9,14-dihydroxy-16-methyl-15-(4-methylphenyl)-15-azatetracyclo[8.7.0.01,14.03,8]heptadeca-3,5,7,9,12,16-hexaene-2,11-dione 405612 NSC722982 resistant
hsa-miR-382-5p 2'-(4-chlorobenzoyl)-1'-(4-chlorophenyl)-1'-hydroxyspiro[1,3-dihydro-1-benzazepine-4,4'-cyclohexane]-2,5-dione 388188 NSC682756 sensitive
hsa-miR-382-5p 2-(1-anilino-4-methyl-5-phenylimidazol-2-yl)sulfanyl-n-[4-(4-methoxyphenyl)-1,3-thiazol-2-yl]acetamide 60148160 NSC753772 resistant
hsa-miR-382-5p 2-(2-chloro-4,5-dimethoxyphenyl)-1-(1h-indol-3-yl)ethanone 266625 NSC105348 sensitive
hsa-miR-382-5p 2-(hydroxymethyl)-5-[6-(2-propan-2-ylidenehydrazinyl)purin-9-yl]oxolane-3,4-diol 60147745 NSC752330 resistant
hsa-miR-382-5p 2-[(1-anilino-4h-thiochromeno[3,4-d]imidazol-2-yl)sulfanyl]-n-[4-(4-chlorophenyl)-1,3-thiazol-2-yl]acetamide 60148157 NSC753769 sensitive
hsa-miR-382-5p 2-[[4-[methyl-[(2,4,7-triaminopteridin-6-yl)methyl]amino]benzoyl]amino]pentanedioic acid 387951 NSC682306 resistant
hsa-miR-382-5p 2-[2-[5-(ethoxycarbonylcarbamoyl)-3-methyl-2,4-dioxopyrimidin-1-yl]ethylsulfanyl]ethyl n-[6-[2-[2-[5-(ethoxycarbonylcarbamoyl)-3-methyl-2,4-dioxopyrimidin-1-yl]ethylsulfanyl]ethoxycarbonylamino]hexyl] 367630 NSC637505 sensitive
hsa-miR-382-5p 2-[2-methoxy-5-[(E)-2-(3,4,5-trimethoxyphenyl)ethenyl]phenoxy]acetic acid 5934333 NSC643813 sensitive
hsa-miR-382-5p 2-[9-[(7-oxocyclohepta-1,3,5-trien-1-yl)amino]nonylamino]cyclohepta-2,4,6-trien-1-one 358331 NSC618296 sensitive
hsa-miR-382-5p 2-amino-1-N,9-N-bis[10-[(4-hydroxyphenyl)methyl]-7,11,14-trimethyl-2,5,9,12,15-pentaoxo-3-propan-2-yl-8-oxa-1,4,11,14-tetrazabicyclo[14.3.0]nonadecan-6-yl]-4,6-dimethyl-3-oxophenoxazine-1,9-dicarboxamide 16129921 NSC684901 sensitive
hsa-miR-382-5p 2-azaadenine 5480214 NSC57048 resistant
hsa-miR-382-5p 2-hydroxy-3-[(8-hydroxyquinolin-7-yl)-(4-methoxyphenyl)methyl]-6-propan-2-ylcyclohepta-2,4,6-trien-1-one 361375 NSC624401 sensitive
hsa-miR-382-5p 2-methyl-4,4-diphenyl-1,4-benzoxaphosphinin-4-ium;bromide 24199840 NSC346098 sensitive
hsa-miR-382-5p 2-methylellpticinium 21123185 NSC351710 sensitive
hsa-miR-382-5p 2-methylellpticinium 21123185 NSC351710 sensitive
hsa-miR-382-5p 2-methylolivacinium acetate 5458752 NSC336003 sensitive
hsa-miR-382-5p 2-n-methyl-6-oxaellipticinium acetate 10018975 NSC638788 sensitive
hsa-miR-382-5p 2-n-methyl-6-thiaellipticinum iodide 367888 NSC638066 sensitive
hsa-miR-382-5p 2-phenyl-6-((1-phenyl-1h-tetraazol-5-yl)oxy)-4h-chromen-4-one 386037 NSC677603 sensitive
hsa-miR-382-5p 2,2'-spirobi[indane]-5,5'-dicarbaldehyde 382743 NSC670421 sensitive
hsa-miR-382-5p 2,4-dinitro-1-benzofuran 332391 NSC329127 resistant
hsa-miR-382-5p 2,5,11-trimethyl-9-phenoxy-6h-pyrido[4,3-b]carbazol-2-ium;acetate 10431819 NSC650269 sensitive
hsa-miR-382-5p 2,5,12-trimethyl-[1,4]benzodioxino[3,2-g]isoquinolin-2-ium acetate 388316 NSC683048 sensitive
hsa-miR-382-5p 2,9-dimethylellipticinium acetate 10472068 NSC639364 sensitive
hsa-miR-382-5p 3-(4-bromophenyl)-4-methyl-8-pyrrolidin-1-yl-8H-thieno[2,3-b]pyrrolizin-4-ium;iodide 388536 NSC683517 sensitive
hsa-miR-382-5p 3-(4-chlorophenyl)-2-(3,4,5-trimethoxyphenyl)-1,3-thiazolidin-4-one 396385 NSC702338 resistant
hsa-miR-382-5p 3-(hydroxymethyl)-5-(6-methylsulfanylpurin-9-yl)-1,4-dioxane-2,6-diol 269951 NSC111702 resistant
hsa-miR-382-5p 3-[10-(3-cyanophenyl)-3,5,9,11-tetraoxo-4,10-diazatetracyclo[5.5.2.02,6.08,12]tetradec-13-en-4-yl]benzonitrile 365552 NSC633258 sensitive
hsa-miR-382-5p 3-[3-[2-chloro-4-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)phenoxy]propylcarbamoylamino]benzenesulfonyl fluoride;ethanesulfonic acid 275314 NSC122060 sensitive
hsa-miR-382-5p 3-bromo-2,4,6-trinitrotoluene 219376 NSC596 resistant
hsa-miR-382-5p 3-bromo-4-(3,3-dimethyl-but-1-ynyl)-2(5h)-furanone 11413833 NSC726328 resistant
hsa-miR-382-5p 3-chloro-6-[(4-fluorophenoxy)methyl]-2-phenylquinoxaline 392817 NSC693773 sensitive
hsa-miR-382-5p 3-deazacytidine 1652 NSC133115 resistant
hsa-miR-382-5p 3-methoxy-1-[(2-methoxyphenyl)methyl]-5-nitroindazole 386342 NSC678125 sensitive
hsa-miR-382-5p 3-methyl-1-(4-nitrobenzoyl)-5-(2-phenylethyl)-2-[[4-tri(propan-2-yl)silyloxyphenyl]methyl]pyrrolidine-3-carbaldehyde 401723 NSC715453 sensitive
hsa-miR-382-5p 3-methyl-4-methylsulfanyl-5-phenyl-6h-pyrazolo[3,4-c]pyrazole 135450457 NSC692021 resistant
hsa-miR-382-5p 3-phenacyliden-5-brom-2-indolinon 5351299 NSC294961 resistant
hsa-miR-382-5p 3,3'-diethyl-9-methylthiacarbocyanine iodide 5351210 NSC96932 sensitive
hsa-miR-382-5p 3,3-bis(3-(trifluoromethyl)phenyl)naphtho[1,2-c]furan-1(3h)-one 362080 NSC625603 sensitive
hsa-miR-382-5p 3,4-dihydroxy-2-methyl-3,4-bis(p-tolyl)isoquinolin-1-one 387986 NSC682352 sensitive
hsa-miR-382-5p 3h-xanthen-3-one, 2,6,7-trihydroxy-9-(o-hydroxy-phenyl)- 72722 NSC9037 sensitive
hsa-miR-382-5p 3no2-2pyrid-so2-ph 371687 NSC646125 resistant
hsa-miR-382-5p 4-((3-chlorobenzyl)oxy)-n-hydroxybenzamide 392397 NSC692761 resistant
hsa-miR-382-5p 4-(4-methoxyphenyl)-16-methyl-9-phenyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 390919 NSC689140 sensitive
hsa-miR-382-5p 4-(4-methoxyphenyl)-16-phenylmethoxy-9-propan-2-yl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 390917 NSC689138 sensitive
hsa-miR-382-5p 4-(bromomethyl)-2,2,5,5-tetramethyl-1-imidazolidinol 3-oxide 378673 NSC661470 resistant
hsa-miR-382-5p 4-[(5s,8ar)-5-(4-fluoroanilino)-5,5a,6,8,8a,9-hexahydro-[2]benzofuro[6,5-f][1,3]benzodioxol-9-yl]-2,6-dimethoxyphenol 378224 NSC660027 sensitive
hsa-miR-382-5p 4-[(e)-(5-nitrofuran-2-yl)methylideneamino]-3-phenyl-1h-1,2,4-triazol-5-one 9556349 NSC698058 resistant
hsa-miR-382-5p 4-[[(4S,9aR)-9-(4-hydroxy-3,5-dimethoxyphenyl)-6,7-dimethoxy-1-oxo-3a,4,9,9a-tetrahydro-3H-benzo[f][2]benzofuran-4-yl]amino]benzonitrile 369961 NSC642328 sensitive
hsa-miR-382-5p 4-[[(Z)-N-benzamido-C-[4-[bis(2-cyanoethyl)amino]-2-methylphenyl]carbonimidoyl]diazenyl]benzoic acid 135493923 NSC681974 sensitive
hsa-miR-382-5p 4-[2-(methylamino)-1-methylsulfanylethyl]benzene-1,2-diol 412349 NSC39215 resistant
hsa-miR-382-5p 4-[4-(diethylamino)phenyl]-2-(4-hydroxypiperidin-1-yl)-6-(3,4,5-trimethoxyphenyl)pyridine-3-carbonitrile 60148088 NSC753601 resistant
hsa-miR-382-5p 4-[4-[2,3-bis(hydroxymethyl)pyrrol-1-yl]butanoylamino]-n-[5-[[5-[3-(dimethylamino)propylcarbamoyl]-1-methylpyrrol-3-yl]carbamoyl]-1-methylpyrrol-3-yl]-1-methylpyrrole-2-carboxamide 384021 NSC673131 sensitive
hsa-miR-382-5p 4-methoxy-1,5-benzothiazepine-1,1-dioxide 358940 NSC619102 resistant
hsa-miR-382-5p 4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1H-2-benzofuran-1-yl)-N-[3-(trifluoromethyl)phenyl]butanamide 369471 NSC641241 sensitive
hsa-miR-382-5p 4-nitro-n-[(7s)-1,2,3-trihydroxy-10-methylsulfanyl-9-oxo-6,7-dihydro-5h-benzo[a]heptalen-7-yl]benzamide 391582 NSC691037 sensitive
hsa-miR-382-5p 4-pyridin-3-yl-2-(2,3,5-trichlorophenyl)-1,3-thiazole 24814783 NSC742842 resistant
hsa-miR-382-5p 4,10-bis(3-ethynylphenyl)-4,10-diazatetracyclo[5.5.2.02,6.08,12]tetradec-13-ene-3,5,9,11-tetrone 365547 NSC633253 sensitive
hsa-miR-382-5p 4,16-difluoro-8,11,20-trimethyl-8-aza-20-azoniapentacyclo[11.7.1.02,7.09,21.014,19]henicosa-1(20),2(7),3,5,9,11,13(21),14(19),15,17-decaene;methyl sulfate 9804187 NSC714187 sensitive
hsa-miR-382-5p 5-(3,5-dimethoxybenzyl)-2-hydroxy-5,11-dihydro-6h-benzo[b]carbazol-6-one 403878 NSC719411 resistant
hsa-miR-382-5p 5-acetyl-6-(2-diethylaminoethylsulfanyl)-1,3-diphenyl-2-thioxo-pyrimidin-4-one NSC707006 resistant
hsa-miR-382-5p 5-chloro-N-[(E)-[phenyl(pyridin-2-yl)methylidene]amino]pyridin-2-amine 6519698 NSC693627 resistant
hsa-miR-382-5p 5-hydroxy-3,7-dimethoxy-3',4'-methylenedioxyflavone 5466137 NSC678102 sensitive
hsa-miR-382-5p 5-methyl-2-{[(2)-3-phenylprop-2-enoyl]amino}benzamide 53329052 NSC748147 sensitive
hsa-miR-382-5p 5-methyl-2-thiophenecarbaldehyde (7-methoxy-4-methyl-2-quinolinyl)hydrazone 9556289 NSC683922 resistant
hsa-miR-382-5p 5,10-dihydroxy-3-[[4-(2-hydroxyethyl)piperazin-1-yl]methyl]-1H-naphtho[2,3-f]indole-4,11-dione;hydrochloride 135585401 NSC726442 resistant
hsa-miR-382-5p 5,7-dichloro-3-[(2-nitrophenyl)diazenyl]-1H-indol-2-ol 3724036 NSC117187 sensitive
hsa-miR-382-5p 6-amino-1,3-dichloro-5,6-dihydrocyclopenta[c]thiophen-4-one 378800 NSC662120 resistant
hsa-miR-382-5p 6-aminotoyocamycin 300567 NSC175630 resistant
hsa-miR-382-5p 6-benzyl-3,8,9-trimethoxy-11-methyl-6,11-dihydro-5h-indeno[1,2-c]isoquinolin-5-one 373164 NSC649107 sensitive
hsa-miR-382-5p 6-bromosangivamycin 270853 NSC113943 resistant
hsa-miR-382-5p 6-butyl-12-methyl-5,6-dihydrobenzimidazolo[2,1-a]isoquinolin-7-ium-3,10-diol;6-butyl-12-methyl-5,6-dihydrobenzimidazolo[2,1-a]isoquinolin-12-ium-3,9-diol;diiodide 403475 NSC718370 sensitive
hsa-miR-382-5p 6-ethoxy-2-(hydroxymethyl)-2h-pyran-3(6h)-one 398342 NSC708062 resistant
hsa-miR-382-5p 7'-but-3-en-2-yl-7'-(3-phenylmethoxypropyl)spiro[1,3-dioxolane-2,2'-3,4,7a,8,9,10-hexahydro-1h-cyclopenta[i]indolizine]-6'-thione 361486 NSC624523 sensitive
hsa-miR-382-5p 7-chlorobenzo[c]quinolizin-11-ium-6-amine;chloride 386892 NSC679795 sensitive
hsa-miR-382-5p 7-hydroxy-2-nonyl-4h-chromen-4-one 5375154 NSC631965 sensitive
hsa-miR-382-5p 8-(6-fluorohexyl)-3-methyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380336 NSC665863 resistant
hsa-miR-382-5p 8-[3-(1,3-dioxolan-2-yl)-2-(4-fluorophenyl)propyl]-3-ethyl-1-phenyl-1,3,8-triazaspiro[4.5]decan-4-one;hydrochloride 380308 NSC665789 resistant
hsa-miR-382-5p 8-aminoadenosine 259812 NSC90394 resistant
hsa-miR-382-5p 8-chloro-7-methyl-5,5-dioxo-n-phenyl-[1,2,4]triazolo[4,3-b][1,4,2]benzodithiazin-3-amine 400657 NSC713019 sensitive
hsa-miR-382-5p 8-chloro-7-methyl-n-(4-methylphenyl)-5,5-dioxo-[1,2,4]triazolo[4,3-b][1,4,2]benzodithiazin-3-amine 400656 NSC713018 sensitive
hsa-miR-382-5p 8-trichloromethyldihydroberberine 320713 NSC269192 sensitive
hsa-miR-382-5p 8b-hydroxy-9b,10b-epoxyverrucarin a 5351311 NSC328166 sensitive
hsa-miR-382-5p 9-((2-chloroethyl)thio)acridine 395387 NSC699923 resistant
hsa-miR-382-5p 9-(benzylsulfinyl)-2,7-dimethoxyacridine 395397 NSC699933 resistant
hsa-miR-382-5p 9-bromo-2,3-dimethoxy-7,12-dihydro-5H-indolo[3,2-d][1]benzazepin-6-one 395805 NSC700693 resistant
hsa-miR-382-5p 9-chloro-12,13-dimethoxy-6-phenyl-2,10-diazatetracyclo[6.6.2.04,16.011,15]hexadeca-1(14),4(16),5,7,9,11(15),12-heptaen-3-one 5470922 NSC706236 resistant
hsa-miR-382-5p 9-ethoxy-2,5,11-trimethyl-6h-pyrido[4,3-b]carbazol-2-ium acetate 373614 NSC650263 sensitive
hsa-miR-382-5p 9-hydroxy-2-(.beta.-diethylaminoethyl)ellipticinium acetate 72034 NSC311152 sensitive
hsa-miR-382-5p 9-tert-butyl-4-(4-methoxyphenyl)-16-methyl-4,20-diazapentacyclo[11.7.0.02,6.07,12.014,19]icosa-1(13),14(19),15,17-tetraene-3,5-dione 376302 NSC657017 sensitive
hsa-miR-382-5p Allopurinol 2094 NSC1390 approved resistant
hsa-miR-382-5p Antibiotic x-14766a 434840 NSC359239 sensitive
hsa-miR-382-5p Antineoplastic-d648114 372647 NSC648114 sensitive
hsa-miR-382-5p Bafilomycin antibiotic NSC381867 resistant
hsa-miR-382-5p Benzyl n-[5-[(2-methylpropan-2-yl)oxycarbonylamino]-6-[2-[[4-[2-[[2-[(2-methylpropan-2-yl)oxycarbonylamino]-6-(phenylmethoxycarbonylamino)hexanoyl]amino]ethylamino]-9,10-dioxoanthracen-1-yl]amino]ethy 438923 NSC684439 sensitive
hsa-miR-382-5p Berberal 5351462 NSC5355 sensitive
hsa-miR-382-5p Berberine chloride 12456 NSC163088 sensitive
hsa-miR-382-5p Berberine iodide 72350 NSC150446 sensitive
hsa-miR-382-5p Chloroplatinum(1+);2-(4-methylpiperidin-1-yl)ethanethiolate;dihydrate 431390 NSC292596 resistant
hsa-miR-382-5p Chrysarobin 221502 NSC6152 sensitive
hsa-miR-382-5p Diaporthein b 54612739 NSC751295 resistant
hsa-miR-382-5p Diethyl (Z)-2-(2,4-dioxo-3-prop-2-ynylpyrimidin-1-yl)but-2-enedioate 5469884 NSC693983 resistant
hsa-miR-382-5p Diethyl 2-[[4-[[6-(trifluoromethyl)quinoxalin-2-yl]amino]benzoyl]amino]pentanedioate 384948 NSC675772 sensitive
hsa-miR-382-5p Diethyl 4-hydroxy-2-(4-methoxyphenyl)-6-oxo-4-phenyl-1,3-cyclohexanedicarboxylate 386764 NSC679443 sensitive
hsa-miR-382-5p Ellipticine 3213 NSC71795 sensitive
hsa-miR-382-5p Ellipticine 3213 NSC71795 sensitive
hsa-miR-382-5p Elliptinium acetate 42722 NSC264137 sensitive
hsa-miR-382-5p Ethyl 16-(3,4-dimethoxyphenyl)-12,14-diphenyl-10-oxa-3,5,6,8,12,13-hexazatetracyclo[7.7.0.02,6.011,15]hexadeca-1(9),2,4,7,11(15),13-hexaene-4-carboxylate 391836 NSC691424 sensitive
hsa-miR-382-5p Ethyl 2-[4-(16-methyl-8-oxo-5-phenyl-2,3,4,7,16-pentazatetracyclo[7.7.0.02,6.010,15]hexadeca-1(9),3,5,10,12,14-hexaen-7-yl)butanoylamino]acetate 24205302 NSC734977 sensitive
hsa-miR-382-5p Ethyl 3,5-dinitro-2-(7H-purin-6-ylsulfanyl)benzoate 4331266 NSC244714 resistant
hsa-miR-382-5p Ethyl 7-(3,4-dihydro-2h-1,5-benzodioxepin-7-yl)-10-methylsulfanyl-2-thia-5,7,9,11-tetrazatricyclo[6.3.1.04,12]dodeca-1(11),3,8(12),9-tetraene-3-carboxylate 399951 NSC711103 sensitive
hsa-miR-382-5p Eupachlorin 5458217 NSC114567 resistant
hsa-miR-382-5p Euphorbia substance spr5 5459191 NSC640929 sensitive
hsa-miR-382-5p Fixierer p 70397 NSC63839 resistant
hsa-miR-382-5p Granatomycin a 135476747 NSC355063 resistant
hsa-miR-382-5p Gtpl10345 378629 NSC661421 resistant
hsa-miR-382-5p Gw701427a 10276395 NSC756323 sensitive
hsa-miR-382-5p Gw832467x 6539439 NSC756401 resistant
hsa-miR-382-5p Haloprogin 3561 NSC100071 resistant
hsa-miR-382-5p Heteromine a 391982 NSC691767 sensitive
hsa-miR-382-5p Hsdb 8106 16129719 NSC676825 resistant
hsa-miR-382-5p Inosine, 6-thio-, 2',3',5'-tripentanoate 4208664 NSC77495 resistant
hsa-miR-382-5p Isobaccharin 5358646 NSC269760 sensitive
hsa-miR-382-5p Isobrucein a 322357 NSC279503 sensitive
hsa-miR-382-5p J3.522.543i 6163542 NSC113053 resistant
hsa-miR-382-5p Justicidin b 122805 NSC254665 resistant
hsa-miR-382-5p Kinetin riboside 3832 NSC120958 resistant
hsa-miR-382-5p Laurusin 135476719 NSC106486 resistant
hsa-miR-382-5p Litomycin 135460332 NSC77038 resistant
hsa-miR-382-5p Ls-94160 135408599 NSC52426 resistant
hsa-miR-382-5p Maxima isoflavone d 343081 NSC382028 sensitive
hsa-miR-382-5p Mefloquine hydrochloride 456309 NSC157387 resistant
hsa-miR-382-5p Methyl (3r)-3-[[(3r)-3-[[(3r)-3-[(2-methylpropan-2-yl)oxycarbonylamino]-5-methylsulfanylpentanoyl]amino]-5-methylsulfanylpentanoyl]amino]-5-methylsulfanylpentanoate 403118 NSC717705 sensitive
hsa-miR-382-5p Methyl (Z)-4-[(5-bromothiophen-2-yl)methylideneamino]-4,4-dicyanobut-2-enoate 5470186 NSC698282 resistant
hsa-miR-382-5p Methyl (Z)-4,4-dicyano-4-[(3-methoxyphenyl)methylideneamino]but-2-enoate 5470182 NSC698278 resistant
hsa-miR-382-5p Methyl 4-[3-(2-thienyl)quinoxalin-2-yl]oxybenzoate 388002 NSC682365 sensitive
hsa-miR-382-5p Methyl 6-[bis-(4-methylphenyl)sulfonylamino]-7-methoxy-12-oxo-3,13,23-triazahexacyclo[11.10.1.02,11.04,9.014,19.020,24]tetracosa-1(24),2(11),3,5,7,9,14,16,18,20,22-undecaene-22-carboxylate 45028276 NSC742036 sensitive
hsa-miR-382-5p Methyl ester prodigiosene 136040158 NSC753661 resistant
hsa-miR-382-5p Musennin 267361 NSC106554 sensitive
hsa-miR-382-5p N'-[(Z)-[(4Z)-2-(1,3-benzodioxol-5-yl)-4-[[4-oxo-4-[2-(trifluoromethyl)anilino]butanoyl]hydrazinylidene]chromen-3-ylidene]amino]-N-[2-(trifluoromethyl)phenyl]butanediamide 6399328 NSC641210 sensitive
hsa-miR-382-5p N-(1,3-benzothiazol-2-yl)-2-phenyl-7-(3,4,5-trimethoxyphenyl)pyrazolo[1,5-a]pyrimidine-5-carboxamide 71624130 NSC763635 sensitive
hsa-miR-382-5p N-(6-methyl-1,3-benzothiazol-2-yl)-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1h-2-benzofuran-1-yl)butanamide 369455 NSC641225 sensitive
hsa-miR-382-5p N-[(e)-1-pyridin-2-ylethylideneamino]-[1,3]thiazolo[5,4-b]pyridin-2-amine 9572047 NSC693635 resistant
hsa-miR-382-5p N-[(e)-1-pyridin-2-ylethylideneamino]-5-(trifluoromethyl)-1,3-benzothiazol-2-amine 9572095 NSC703110 resistant
hsa-miR-382-5p N-[(z)-[phenyl(pyridin-2-yl)methylidene]amino]quinoxalin-2-amine 5869744 NSC693626 resistant
hsa-miR-382-5p N-[[4-[10-[4-[[acetyl(2-phenylethyl)amino]-cyanomethyl]phenoxy]decoxy]phenyl]-cyanomethyl]-n-(2-phenylethyl)acetamide 387721 NSC681750 sensitive
hsa-miR-382-5p N-[2-(dimethylamino)ethyl]-4-(furo[3,2-c]quinolin-4-ylamino)benzamide 24204686 NSC732490 resistant
hsa-miR-382-5p N-[2-chloro-5-(trifluoromethyl)phenyl]-4-naphthalen-2-yl-2,4-dioxo-3-(3-oxo-1h-2-benzofuran-1-yl)butanamide 369469 NSC641239 sensitive
hsa-miR-382-5p N-[3-[(z)-n-methoxy-c-methylcarbonimidoyl]phenyl]-11h-indolo[3,2-c]quinolin-6-amine 9572585 NSC721041 resistant
hsa-miR-382-5p N-benzyl-1-[10-[4-(benzylamino)-2-methylquinolin-1-ium-1-yl]decyl]-2-methylquinolin-1-ium-4-amine;perchlorate 387881 NSC682094 sensitive
hsa-miR-382-5p N,n-dimethyl-4-[(e)-2-(1-methyl-2,5-diphenylpyrazol-1-ium-3-yl)ethenyl]aniline;trifluoromethanesulfonate 5469868 NSC693576 sensitive
hsa-miR-382-5p Naphtho[1,2-b]quinolizinium, 9-methyl-, bromide 21144314 NSC77810 sensitive
hsa-miR-382-5p NSC372474 NSC372474 resistant
hsa-miR-382-5p NSC636476 NSC636476 sensitive
hsa-miR-382-5p NSC670163 NSC670163 sensitive
hsa-miR-382-5p NSC751830 NSC751830 resistant
hsa-miR-382-5p Oxidanium;1,3-diphenylpropane-1,3-dione;neodymium(3+);hydroxide 24202397 NSC647042 sensitive
hsa-miR-382-5p Paucin 282787 NSC136722 resistant
hsa-miR-382-5p Pectenotoxin ii 5468320 NSC668555 sensitive
hsa-miR-382-5p Phenoxathiin-2-ylmethyl carbamimidothioate;hydrochloride 392088 NSC691900 resistant
hsa-miR-382-5p Phosphonium, 1,8-octanediylbis[triphenyl-, diiodide 382552 NSC670162 sensitive
hsa-miR-382-5p Phosphonium, triphenylpropenyl-, bromide, (e)- (8ci) 10714966 NSC289922 sensitive
hsa-miR-382-5p Pinnatin b 5470399 NSC700892 resistant
hsa-miR-382-5p Platinum(2+);2,5,11-trimethyl-6H-pyrido[4,3-b]carbazol-2-ium-9-ol;tetrachloride 6477738 NSC620256 sensitive
hsa-miR-382-5p Propan-2-ylsulfanyl-(2,3,5,6-tetrachloropyridin-4-yl)sulfanylmethanethione 399833 NSC710969 resistant
hsa-miR-382-5p Protein: pahiv4 NSC678525 sensitive
hsa-miR-382-5p Pyrazoloadenine 75420 NSC1393 resistant
hsa-miR-382-5p Roridin a, 8-hydroxy-9b,10b-epoxy- 5458716 NSC327993 sensitive
hsa-miR-382-5p S-[2-(2,6-dichlorophenyl)-3-oxoinden-1-yl] N,N-dimethylcarbamothioate 333069 NSC332837 resistant
hsa-miR-382-5p Salicyl n-salicylidenehydrazide 135445765 NSC87864 resistant
hsa-miR-382-5p Sarcoviolin 24202820 NSC726045 sensitive
hsa-miR-382-5p Sb-236687 17892742 NSC756422 resistant
hsa-miR-382-5p Sergeolide,desacetyl 125729 NSC364170 sensitive
hsa-miR-382-5p Silver methylsulfonate 6712944 NSC83223 resistant
hsa-miR-382-5p Stl298328 387753 NSC681782 resistant
hsa-miR-382-5p Stl323102 375895 NSC656208 resistant
hsa-miR-382-5p Stl361983 256661 NSC83715 resistant
hsa-miR-382-5p Stl434863 394348 NSC697730 resistant
hsa-miR-382-5p Stl523755 334956 NSC342610 sensitive
hsa-miR-382-5p Suavedol 65631 NSC141545 resistant
hsa-miR-382-5p Tetramethyl (1r,5r,6s,9s)-3,5-dihydroxy-7-[4-[(e)-3-phenylprop-2-enoyl]oxyphenyl]bicyclo[3.3.1]non-2-ene-2,4,6,9-tetracarboxylate 54681586 NSC717065 resistant
hsa-miR-382-5p Tetramethyl (1r,5r,6s,9s)-7-[4-[(e)-2,3-bis(4-chlorophenyl)prop-2-enoyl]oxyphenyl]-3,5-dihydroxybicyclo[3.3.1]non-2-ene-2,4,6,9-tetracarboxylate 54681588 NSC717067 resistant
hsa-miR-382-5p Tetrocarcin a, sodium salt 6474412 NSC333856 sensitive
hsa-miR-382-5p Tridecyl 5-[(Z)-[3-methoxy-5-(1H-pyrrol-2-yl)pyrrol-2-ylidene]methyl]-2,4-dimethyl-1H-pyrrole-3-carboxylate 136226144 NSC763730 resistant
hsa-miR-382-5p Tris(1,10-phenanthroline)lanthanum(iii)-trithiocyanate 24202211 NSC632737 resistant
hsa-miR-382-5p Varacin trifluoroacetate salt 54611558 NSC722218 resistant
hsa-miR-382-5p Xestin a 5352066 NSC647638 resistant
hsa-miR-382-5p Xk-469 148183 NSC656889 sensitive
hsa-miR-382-5p Doxorubicin 31703 NSC123127 approved resistant High Small Cell Lung Cancer cell line (NCI-H69)
hsa-miR-382-5p Etoposide 36462 NSC141540 approved sensitive High Breast Cancer cell line (MCF-7)
hsa-miR-382-5p Cisplatin 5460033 NSC119875 approved sensitive Low Squamous Cell Carcinoma cell line (SCC-11)
hsa-miR-382-5p Oxaliplatin 6857599 NSC266046 approved sensitive High Colorectal Cancer cell line (RKO)
hsa-miR-382-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-miR-382-5p Cisplatin 5460033 NSC119875 approved sensitive Low Osteosarcoma tissue and cell line (U-2-OS, MG-63)
hsa-miR-382-5p Methotrexate 126941 NSC740 approved sensitive Low Osteosarcoma tissue and cell line (U-2-OS, MG-63)
hsa-miR-382-5p Doxorubicin 31703 NSC123127 approved sensitive Low Osteosarcoma tissue and cell line (U-2-OS, MG-63)
hsa-miR-382-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-382-5p Imatinib 5291 NSC743414 approved sensitive High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-miR-382-5p Paclitaxel 36314 NSC125973 approved sensitive Low Ovarian Cancer cell line (SKOV3)
hsa-miR-382-5p Cisplatin 5460033 NSC119875 approved sensitive High Ovarian Cancer tissue
hsa-miR-382-5p Aromatase Inhibitor resistant Low Breast Cancer cell line (MCF-7)
hsa-miR-382-5p Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-382-5p Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-382-5p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-382-5p Bromocriptine 31101 NSC169774 approved resistant High Prolactinoma tissue
hsa-miR-382-5p Platinum 23939 resistant High High-Grade Serous Ovarian Cancer tissue
hsa-miR-382-5p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HCT-116)
hsa-miR-382-5p Ruxolitinib 25126798 NSC763371 approved resistant Low Myelofibrosis tissue
hsa-miR-382-5p Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (MGC803)
hsa-miR-382-5p Osimertinib 71496458 NSC779217 approved resistant Low Non-Small Cell Lung Cancer tissue
hsa-miR-382-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-382-5p Palbociclib 5330286 NSC758247 approved resistant cell line (T47D)
hsa-miR-382-5p Palbociclib 5330286 NSC758247 approved resistant tissue (breast cancer)
hsa-miR-382-5p Oxaliplatin 6857599 NSC266046 approved resistant cell line (HCT116)
hsa-miR-382-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-382-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-382-5p Prednisone/Azathioprine/Methotrexate/Cyclophosphamide/Mycophenolate mofetil sensitive tissue (myasthenia gravis)
hsa-miR-382-5p Paclitaxel 36314 NSC125973 approved sensitive cell line (BAS)
hsa-miR-382-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (HS578T)
hsa-miR-382-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (BAS)
hsa-miR-382-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-382-5p Tamoxifen+Fulvestrant resistant cell line (LCC9)
hsa-miR-382-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-382-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (RPMI2650)
hsa-miR-382-5p Sunitinib 5329102 NSC750690 approved sensitive tissue (CardA)
hsa-miR-382-5p Pegylated interferon alpha+Ribavirin sensitive tissue (chronic hepatitis C)
hsa-miR-382-5p Doxorubicin 31703 NSC123127 approved sensitive cell line (K562)
hsa-miR-382-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (T24)
hsa-miR-382-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-382-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-382-5p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)
hsa-miR-382-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-382-5p Cisplatin 5460033 NSC119875 approved resistant cell line (H23)
hsa-miR-382-5p Cisplatin 5460033 NSC119875 approved resistant cell line (TOV-112D)

Error report submission