miRTarBase - #MIRT177273


—
pre-miRNA Information
pre-miRNA hsa-mir-548w   
Genomic Coordinates chr16: 26025237 - 26025310
Description Homo sapiens miR-548w stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-548w
Sequence 10| AAAAGUAACUGCGGUUUUUGCCU |32
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 16 + 26025249 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs918935898 1 dbSNP
rs573018690 4 dbSNP
rs1355338018 5 dbSNP
rs1232952112 7 dbSNP
rs768527810 12 dbSNP
rs1331351492 13 dbSNP
rs925963272 14 dbSNP
rs1299975801 16 dbSNP
rs1247960808 17 dbSNP
rs1217191628 23 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol COMMD3-BMI1
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uccguuUUUGGCGUCAAUGAAAa 5'
                |||:  || ||||||| 
Target 5' -ucauuAAAU--CA-UUACUUUu 3'
 		1 - 19
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_001204062 | 3UTR | UCUAUACUUUAUAUACUUUUCUCCAGUAAUACAUGUUUACUUUAAAGAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903834
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_b
Location of target site NM_001204062 | 3UTR | UGUUUACUUUAAAGAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM4903835
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_c
Location of target site NM_001204062 | 3UTR | AGUAAUACAUGUUUACUUUAAAGAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM4903836
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_a
Location of target site NM_001204062 | 3UTR | UUCUCCAGUAAUACAUGUUUACUUUAAAGAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM4903837
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / 124_TD_21_b
Location of target site NM_001204062 | 3UTR | AUACAUGUUUACUUUAAAGAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000602390.1 | 3UTR | UCAUUAAAUCAUUACUUUUACAUAUAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000602390.1 | 3UTR | UCAUUAAAUCAUUACUUUUACAUAUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
184 hsa-miR-548w Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT057125 DDIT4 DNA damage inducible transcript 4 2 4
MIRT063369 ETNK1 ethanolamine kinase 1 2 2
MIRT072492 RAB8B RAB8B, member RAS oncogene family 2 2
MIRT082186 ACTN4 actinin alpha 4 2 6
MIRT083033 PTBP1 polypyrimidine tract binding protein 1 2 2
MIRT085188 SLC5A3 solute carrier family 5 member 3 2 4
MIRT088905 FOXN2 forkhead box N2 2 4
MIRT089494 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 6
MIRT092039 ABHD5 abhydrolase domain containing 5 2 2
MIRT094685 FEM1C fem-1 homolog C 2 2
MIRT095393 UBE2D2 ubiquitin conjugating enzyme E2 D2 2 2
MIRT096501 BRIX1 BRX1, biogenesis of ribosomes 2 2
MIRT101296 FAM135A family with sequence similarity 135 member A 2 2
MIRT103356 CBX3 chromobox 3 2 2
MIRT103872 FOXK1 forkhead box K1 2 2
MIRT104334 CLDN12 claudin 12 2 2
MIRT104501 PEG10 paternally expressed 10 2 6
MIRT111795 MPZL1 myelin protein zero like 1 2 2
MIRT177238 BMI1 BMI1 proto-oncogene, polycomb ring finger 2 2
MIRT177273 COMMD3-BMI1 COMMD3-BMI1 readthrough 2 2
MIRT177626 UBE2D1 ubiquitin conjugating enzyme E2 D1 2 6
MIRT178042 SAMD8 sterile alpha motif domain containing 8 2 2
MIRT179102 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 6
MIRT179587 CAPZA1 capping actin protein of muscle Z-line alpha subunit 1 2 6
MIRT195299 LEPROT leptin receptor overlapping transcript 2 2
MIRT203143 BACH1 BTB domain and CNC homolog 1 2 2
MIRT208430 ZBTB38 zinc finger and BTB domain containing 38 2 2
MIRT214578 SMAD5 SMAD family member 5 2 4
MIRT216103 IL6ST interleukin 6 signal transducer 2 2
MIRT216355 CCNB1 cyclin B1 2 4
MIRT220050 MDFIC MyoD family inhibitor domain containing 2 2
MIRT226729 ANP32B acidic nuclear phosphoprotein 32 family member B 2 4
MIRT227698 TBC1D13 TBC1 domain family member 13 2 2
MIRT230071 SH3BGRL SH3 domain binding glutamate rich protein like 2 2
MIRT248637 HMGN2 high mobility group nucleosomal binding domain 2 2 4
MIRT254790 XRCC6 X-ray repair cross complementing 6 2 6
MIRT264376 YAP1 Yes associated protein 1 2 2
MIRT266972 LRRC55 leucine rich repeat containing 55 2 4
MIRT273949 SPRYD4 SPRY domain containing 4 2 2
MIRT281802 MAP2K1 mitogen-activated protein kinase kinase 1 2 2
MIRT293252 DR1 down-regulator of transcription 1 2 2
MIRT297097 RGPD4 RANBP2-like and GRIP domain containing 4 2 2
MIRT308170 PDE12 phosphodiesterase 12 2 2
MIRT309013 USP53 ubiquitin specific peptidase 53 2 2
MIRT311470 PRRC1 proline rich coiled-coil 1 2 2
MIRT312586 G3BP1 G3BP stress granule assembly factor 1 2 4
MIRT328130 ZNF711 zinc finger protein 711 2 2
MIRT329313 FAM53C family with sequence similarity 53 member C 2 2
MIRT334642 NEK7 NIMA related kinase 7 2 2
MIRT340673 THRAP3 thyroid hormone receptor associated protein 3 2 2
MIRT378858 ITGB8 integrin subunit beta 8 2 2
MIRT395789 SPCS3 signal peptidase complex subunit 3 2 2
MIRT405639 WBP4 WW domain binding protein 4 2 4
MIRT408287 GRPEL2 GrpE like 2, mitochondrial 2 2
MIRT442097 ZNRF2 zinc and ring finger 2 2 8
MIRT442840 GTF2H5 general transcription factor IIH subunit 5 2 2
MIRT443116 VLDLR very low density lipoprotein receptor 2 2
MIRT443147 ZDHHC21 zinc finger DHHC-type containing 21 2 2
MIRT443298 PRPS1L1 phosphoribosyl pyrophosphate synthetase 1-like 1 2 2
MIRT445080 ZNF207 zinc finger protein 207 2 2
MIRT445384 PTCHD1 patched domain containing 1 2 4
MIRT447070 MCC mutated in colorectal cancers 2 2
MIRT447300 ZNF562 zinc finger protein 562 2 2
MIRT447512 MRPS5 mitochondrial ribosomal protein S5 2 2
MIRT449511 TM6SF1 transmembrane 6 superfamily member 1 2 2
MIRT449902 C11orf34 placenta expressed transcript 1 1 2
MIRT450551 SHFM1 SEM1, 26S proteasome complex subunit 2 2
MIRT450719 PVRL3 nectin cell adhesion molecule 3 2 2
MIRT454923 ANKEF1 ankyrin repeat and EF-hand domain containing 1 2 12
MIRT455892 KIF2C kinesin family member 2C 2 2
MIRT463732 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 2 8
MIRT471182 PHB2 prohibitin 2 2 2
MIRT472764 MTMR6 myotubularin related protein 6 2 8
MIRT474457 KLHL11 kelch like family member 11 2 8
MIRT475985 GTPBP2 GTP binding protein 2 2 2
MIRT482277 AGO2 argonaute 2, RISC catalytic component 2 4
MIRT485858 ALG9 ALG9, alpha-1,2-mannosyltransferase 2 2
MIRT486192 ERH ERH, mRNA splicing and mitosis factor 2 4
MIRT488609 FAM3C family with sequence similarity 3 member C 2 6
MIRT489984 DDB1 damage specific DNA binding protein 1 2 2
MIRT493476 IPMK inositol polyphosphate multikinase 2 2
MIRT494280 CEP120 centrosomal protein 120 2 2
MIRT497992 ZBTB20 zinc finger and BTB domain containing 20 2 2
MIRT498473 PTBP2 polypyrimidine tract binding protein 2 2 10
MIRT498559 TMEM30B transmembrane protein 30B 2 2
MIRT499867 SVOP SV2 related protein 2 10
MIRT500220 INHBA inhibin beta A subunit 2 10
MIRT500694 TRIM37 tripartite motif containing 37 2 2
MIRT500988 SPPL2A signal peptide peptidase like 2A 2 4
MIRT501023 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 2 6
MIRT502736 CLIP1 CAP-Gly domain containing linker protein 1 2 8
MIRT502798 CELSR3 cadherin EGF LAG seven-pass G-type receptor 3 2 6
MIRT502887 CDK4 cyclin dependent kinase 4 2 8
MIRT503483 ZNF154 zinc finger protein 154 2 6
MIRT503717 GRM5 glutamate metabotropic receptor 5 2 2
MIRT505137 YOD1 YOD1 deubiquitinase 2 2
MIRT505802 RSBN1 round spermatid basic protein 1 2 8
MIRT505841 POLR1B RNA polymerase I subunit B 2 4
MIRT509284 NPM3 nucleophosmin/nucleoplasmin 3 2 6
MIRT516829 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT520519 TRA2B transformer 2 beta homolog 2 2
MIRT520723 TM9SF3 transmembrane 9 superfamily member 3 2 6
MIRT525403 SHISA9 shisa family member 9 2 4
MIRT525867 ARL13B ADP ribosylation factor like GTPase 13B 2 2
MIRT526013 RBM4B RNA binding motif protein 4B 2 2
MIRT526084 TMEM41B transmembrane protein 41B 2 2
MIRT527931 FRY FRY microtubule binding protein 2 2
MIRT528818 RAB32 RAB32, member RAS oncogene family 2 2
MIRT531062 SLC9A4 solute carrier family 9 member A4 2 4
MIRT535495 PANX1 pannexin 1 2 2
MIRT536682 IKZF5 IKAROS family zinc finger 5 2 2
MIRT536835 HMBOX1 homeobox containing 1 2 2
MIRT537202 GDE1 glycerophosphodiester phosphodiesterase 1 2 4
MIRT537834 EFNA5 ephrin A5 2 2
MIRT538345 CSE1L chromosome segregation 1 like 2 4
MIRT541242 GPC4 glypican 4 2 2
MIRT543235 PEX7 peroxisomal biogenesis factor 7 2 2
MIRT543450 PARP15 poly(ADP-ribose) polymerase family member 15 2 2
MIRT543711 XKR9 XK related 9 2 2
MIRT543907 ESYT1 extended synaptotagmin 1 2 2
MIRT543999 KLRC3 killer cell lectin like receptor C3 2 2
MIRT544070 METTL8 methyltransferase like 8 2 2
MIRT544187 ANGPTL3 angiopoietin like 3 2 2
MIRT544808 ACSM2B acyl-CoA synthetase medium chain family member 2B 2 2
MIRT545046 PRELID1 PRELI domain containing 1 2 2
MIRT545214 HIST1H2BD histone cluster 1 H2B family member d 2 2
MIRT545289 SPC25 SPC25, NDC80 kinetochore complex component 2 2
MIRT545550 GIMAP4 GTPase, IMAP family member 4 2 2
MIRT546497 SIK1 salt inducible kinase 1 2 2
MIRT546914 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 2
MIRT547675 KPNA1 karyopherin subunit alpha 1 2 4
MIRT547770 KATNAL1 katanin catalytic subunit A1 like 1 2 2
MIRT548687 CRNKL1 crooked neck pre-mRNA splicing factor 1 2 2
MIRT548901 CHEK2 checkpoint kinase 2 2 4
MIRT549957 RPL7L1 ribosomal protein L7 like 1 2 4
MIRT550489 TMEM241 transmembrane protein 241 2 2
MIRT551049 MKLN1 muskelin 1 2 2
MIRT552811 XIAP X-linked inhibitor of apoptosis 2 4
MIRT553145 UBE2H ubiquitin conjugating enzyme E2 H 2 2
MIRT553830 SYNCRIP synaptotagmin binding cytoplasmic RNA interacting protein 2 2
MIRT554258 SIX4 SIX homeobox 4 2 2
MIRT555781 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 2 2
MIRT556318 MAP2K4 mitogen-activated protein kinase kinase 4 2 2
MIRT556499 LIPA lipase A, lysosomal acid type 2 2
MIRT556693 KLHL28 kelch like family member 28 2 2
MIRT556752 KLF7 Kruppel like factor 7 2 2
MIRT556990 HPRT1 hypoxanthine phosphoribosyltransferase 1 2 2
MIRT557146 HOXA13 homeobox A13 2 2
MIRT557487 GPR27 G protein-coupled receptor 27 2 4
MIRT558102 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 2 2
MIRT559344 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT560335 ZWINT ZW10 interacting kinetochore protein 2 2
MIRT561299 ZBTB43 zinc finger and BTB domain containing 43 2 2
MIRT561883 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT561927 MFSD9 major facilitator superfamily domain containing 9 2 2
MIRT562935 TNIP2 TNFAIP3 interacting protein 2 2 2
MIRT563291 BBS10 Bardet-Biedl syndrome 10 2 2
MIRT563405 KIF3A kinesin family member 3A 2 2
MIRT563562 KIAA1586 KIAA1586 2 2
MIRT565876 NHS NHS actin remodeling regulator 2 2
MIRT566081 RCC2 regulator of chromosome condensation 2 2 2
MIRT566396 PLAGL2 PLAG1 like zinc finger 2 2 2
MIRT567259 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 2
MIRT571468 CCDC80 coiled-coil domain containing 80 2 2
MIRT572939 VDAC2 voltage dependent anion channel 2 2 2
MIRT573628 ZNF724P zinc finger protein 724 2 2
MIRT573717 KHSRP KH-type splicing regulatory protein 2 2
MIRT609088 SMIM15 small integral membrane protein 15 2 6
MIRT617936 EBNA1BP2 EBNA1 binding protein 2 2 2
MIRT618379 PRKG2 protein kinase, cGMP-dependent, type II 2 2
MIRT619627 PLEKHG7 pleckstrin homology and RhoGEF domain containing G7 2 2
MIRT623455 KDM5A lysine demethylase 5A 2 2
MIRT629145 CTCFL CCCTC-binding factor like 2 2
MIRT638521 LYRM2 LYR motif containing 2 2 2
MIRT649483 CLDN16 claudin 16 2 2
MIRT683148 MTHFD1 methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 2 2
MIRT691660 SLC43A3 solute carrier family 43 member 3 2 2
MIRT693201 MKI67 marker of proliferation Ki-67 2 2
MIRT695334 AQP3 aquaporin 3 (Gill blood group) 2 2
MIRT701023 PCGF5 polycomb group ring finger 5 2 2
MIRT708753 RYBP RING1 and YY1 binding protein 2 2
MIRT717558 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT719286 SETD7 SET domain containing lysine methyltransferase 7 2 2
MIRT725172 SDAD1 SDA1 domain containing 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-548w Paclitaxel 36314 NSC125973 approved sensitive cell line (W1)
hsa-mir-548w Cisplatin 5460033 NSC119875 approved sensitive cell line (W1)
hsa-miR-548w Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-548w Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-548w Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-548w Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-548w Cisplatin 5460033 NSC119875 approved resistant cell line (MGC-803)
hsa-miR-548w Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-548w Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-548w Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)
hsa-miR-548w Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)

Error report submission