miRTarBase - #MIRT177281


—
pre-miRNA Information
pre-miRNA hsa-mir-548am   
Genomic Coordinates chrX: 16627012 - 16627085
Description Homo sapiens miR-548am stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-548am-5p
Sequence 10| AAAAGUAAUUGCGGUUUUUGCC |31
Evidence Not_experimental
Experiments
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 3 X - 16627074 29233923 MiREDiBase
A-to-I 4 X - 16627073 29233923 MiREDiBase
A-to-I 7 X - 16627070 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs181147953 1 dbSNP
rs1023899452 12 dbSNP
rs1319380894 14 dbSNP
rs768483765 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol COMMD3-BMI1
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ccguuUUUGGCGUUAAUGAAAa 5'
               |||:|   |||||||| 
Target 5' ucauuAAAUC---AUUACUUUu 3'
 		1 - 19
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000602390.1 | 3UTR | UCAUUAAAUCAUUACUUUUACAUAUAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000602390.1 | 3UTR | UCAUUAAAUCAUUACUUUUACAUAUA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
184 hsa-miR-548am-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT057132 DDIT4 DNA damage inducible transcript 4 2 4
MIRT063379 ETNK1 ethanolamine kinase 1 2 2
MIRT072501 RAB8B RAB8B, member RAS oncogene family 2 2
MIRT082193 ACTN4 actinin alpha 4 2 6
MIRT083043 PTBP1 polypyrimidine tract binding protein 1 2 2
MIRT085196 SLC5A3 solute carrier family 5 member 3 2 4
MIRT088913 FOXN2 forkhead box N2 2 4
MIRT089506 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 6
MIRT092047 ABHD5 abhydrolase domain containing 5 2 2
MIRT094692 FEM1C fem-1 homolog C 2 2
MIRT095403 UBE2D2 ubiquitin conjugating enzyme E2 D2 2 2
MIRT096509 BRIX1 BRX1, biogenesis of ribosomes 2 2
MIRT101303 FAM135A family with sequence similarity 135 member A 2 2
MIRT103366 CBX3 chromobox 3 2 2
MIRT103883 FOXK1 forkhead box K1 2 2
MIRT104343 CLDN12 claudin 12 2 2
MIRT104508 PEG10 paternally expressed 10 2 6
MIRT111808 MPZL1 myelin protein zero like 1 2 2
MIRT177246 BMI1 BMI1 proto-oncogene, polycomb ring finger 2 2
MIRT177281 COMMD3-BMI1 COMMD3-BMI1 readthrough 2 2
MIRT177633 UBE2D1 ubiquitin conjugating enzyme E2 D1 2 6
MIRT178049 SAMD8 sterile alpha motif domain containing 8 2 2
MIRT179109 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 6
MIRT179594 CAPZA1 capping actin protein of muscle Z-line alpha subunit 1 2 6
MIRT195307 LEPROT leptin receptor overlapping transcript 2 2
MIRT203152 BACH1 BTB domain and CNC homolog 1 2 2
MIRT208437 ZBTB38 zinc finger and BTB domain containing 38 2 2
MIRT214585 SMAD5 SMAD family member 5 2 4
MIRT216112 IL6ST interleukin 6 signal transducer 2 2
MIRT216363 CCNB1 cyclin B1 2 4
MIRT220059 MDFIC MyoD family inhibitor domain containing 2 2
MIRT226737 ANP32B acidic nuclear phosphoprotein 32 family member B 2 4
MIRT227706 TBC1D13 TBC1 domain family member 13 2 2
MIRT230079 SH3BGRL SH3 domain binding glutamate rich protein like 2 2
MIRT248644 HMGN2 high mobility group nucleosomal binding domain 2 2 4
MIRT254799 XRCC6 X-ray repair cross complementing 6 2 6
MIRT264388 YAP1 Yes associated protein 1 2 2
MIRT266982 LRRC55 leucine rich repeat containing 55 2 4
MIRT273957 SPRYD4 SPRY domain containing 4 2 2
MIRT281809 MAP2K1 mitogen-activated protein kinase kinase 1 2 2
MIRT293262 DR1 down-regulator of transcription 1 2 2
MIRT297105 RGPD4 RANBP2-like and GRIP domain containing 4 2 2
MIRT308178 PDE12 phosphodiesterase 12 2 2
MIRT309022 USP53 ubiquitin specific peptidase 53 2 2
MIRT311477 PRRC1 proline rich coiled-coil 1 2 2
MIRT312595 G3BP1 G3BP stress granule assembly factor 1 2 4
MIRT328137 ZNF711 zinc finger protein 711 2 2
MIRT329321 FAM53C family with sequence similarity 53 member C 2 2
MIRT334649 NEK7 NIMA related kinase 7 2 2
MIRT340680 THRAP3 thyroid hormone receptor associated protein 3 2 2
MIRT378865 ITGB8 integrin subunit beta 8 2 2
MIRT395798 SPCS3 signal peptidase complex subunit 3 2 2
MIRT405648 WBP4 WW domain binding protein 4 2 4
MIRT408294 GRPEL2 GrpE like 2, mitochondrial 2 2
MIRT442112 ZNRF2 zinc and ring finger 2 2 8
MIRT442855 GTF2H5 general transcription factor IIH subunit 5 2 2
MIRT443131 VLDLR very low density lipoprotein receptor 2 2
MIRT443162 ZDHHC21 zinc finger DHHC-type containing 21 2 2
MIRT443313 PRPS1L1 phosphoribosyl pyrophosphate synthetase 1-like 1 2 2
MIRT445095 ZNF207 zinc finger protein 207 2 2
MIRT445399 PTCHD1 patched domain containing 1 2 4
MIRT447085 MCC mutated in colorectal cancers 2 2
MIRT447315 ZNF562 zinc finger protein 562 2 2
MIRT447528 MRPS5 mitochondrial ribosomal protein S5 2 2
MIRT449526 TM6SF1 transmembrane 6 superfamily member 1 2 2
MIRT449917 C11orf34 placenta expressed transcript 1 1 2
MIRT450566 SHFM1 SEM1, 26S proteasome complex subunit 2 2
MIRT450734 PVRL3 nectin cell adhesion molecule 3 2 2
MIRT454938 ANKEF1 ankyrin repeat and EF-hand domain containing 1 2 12
MIRT455907 KIF2C kinesin family member 2C 2 2
MIRT463747 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 2 8
MIRT471197 PHB2 prohibitin 2 2 2
MIRT472779 MTMR6 myotubularin related protein 6 2 8
MIRT474472 KLHL11 kelch like family member 11 2 8
MIRT476000 GTPBP2 GTP binding protein 2 2 2
MIRT482291 AGO2 argonaute 2, RISC catalytic component 2 4
MIRT485873 ALG9 ALG9, alpha-1,2-mannosyltransferase 2 2
MIRT486207 ERH ERH, mRNA splicing and mitosis factor 2 4
MIRT488624 FAM3C family with sequence similarity 3 member C 2 6
MIRT489999 DDB1 damage specific DNA binding protein 1 2 2
MIRT493491 IPMK inositol polyphosphate multikinase 2 2
MIRT494295 CEP120 centrosomal protein 120 2 2
MIRT498007 ZBTB20 zinc finger and BTB domain containing 20 2 2
MIRT498488 PTBP2 polypyrimidine tract binding protein 2 2 10
MIRT498575 TMEM30B transmembrane protein 30B 2 2
MIRT499882 SVOP SV2 related protein 2 10
MIRT500235 INHBA inhibin beta A subunit 2 10
MIRT500709 TRIM37 tripartite motif containing 37 2 2
MIRT501003 SPPL2A signal peptide peptidase like 2A 2 4
MIRT501038 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 2 6
MIRT502751 CLIP1 CAP-Gly domain containing linker protein 1 2 8
MIRT502813 CELSR3 cadherin EGF LAG seven-pass G-type receptor 3 2 6
MIRT502903 CDK4 cyclin dependent kinase 4 2 8
MIRT503498 ZNF154 zinc finger protein 154 2 6
MIRT503732 GRM5 glutamate metabotropic receptor 5 2 2
MIRT505152 YOD1 YOD1 deubiquitinase 2 2
MIRT505817 RSBN1 round spermatid basic protein 1 2 8
MIRT505856 POLR1B RNA polymerase I subunit B 2 4
MIRT509299 NPM3 nucleophosmin/nucleoplasmin 3 2 6
MIRT516844 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT520534 TRA2B transformer 2 beta homolog 2 2
MIRT520738 TM9SF3 transmembrane 9 superfamily member 3 2 6
MIRT525418 SHISA9 shisa family member 9 2 4
MIRT525882 ARL13B ADP ribosylation factor like GTPase 13B 2 2
MIRT526028 RBM4B RNA binding motif protein 4B 2 2
MIRT526099 TMEM41B transmembrane protein 41B 2 2
MIRT527946 FRY FRY microtubule binding protein 2 2
MIRT528833 RAB32 RAB32, member RAS oncogene family 2 2
MIRT531077 SLC9A4 solute carrier family 9 member A4 2 4
MIRT535510 PANX1 pannexin 1 2 2
MIRT536697 IKZF5 IKAROS family zinc finger 5 2 2
MIRT536850 HMBOX1 homeobox containing 1 2 2
MIRT537217 GDE1 glycerophosphodiester phosphodiesterase 1 2 4
MIRT537849 EFNA5 ephrin A5 2 2
MIRT538360 CSE1L chromosome segregation 1 like 2 4
MIRT541257 GPC4 glypican 4 2 2
MIRT543250 PEX7 peroxisomal biogenesis factor 7 2 2
MIRT543465 PARP15 poly(ADP-ribose) polymerase family member 15 2 2
MIRT543726 XKR9 XK related 9 2 2
MIRT543922 ESYT1 extended synaptotagmin 1 2 2
MIRT544014 KLRC3 killer cell lectin like receptor C3 2 2
MIRT544085 METTL8 methyltransferase like 8 2 2
MIRT544202 ANGPTL3 angiopoietin like 3 2 2
MIRT544823 ACSM2B acyl-CoA synthetase medium chain family member 2B 2 2
MIRT545061 PRELID1 PRELI domain containing 1 2 2
MIRT545229 HIST1H2BD histone cluster 1 H2B family member d 2 2
MIRT545304 SPC25 SPC25, NDC80 kinetochore complex component 2 2
MIRT545565 GIMAP4 GTPase, IMAP family member 4 2 2
MIRT546512 SIK1 salt inducible kinase 1 2 2
MIRT546929 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 2
MIRT547690 KPNA1 karyopherin subunit alpha 1 2 4
MIRT547783 KATNAL1 katanin catalytic subunit A1 like 1 2 2
MIRT548702 CRNKL1 crooked neck pre-mRNA splicing factor 1 2 2
MIRT548916 CHEK2 checkpoint kinase 2 2 4
MIRT549972 RPL7L1 ribosomal protein L7 like 1 2 4
MIRT550504 TMEM241 transmembrane protein 241 2 2
MIRT551064 MKLN1 muskelin 1 2 2
MIRT552826 XIAP X-linked inhibitor of apoptosis 2 4
MIRT553160 UBE2H ubiquitin conjugating enzyme E2 H 2 2
MIRT553845 SYNCRIP synaptotagmin binding cytoplasmic RNA interacting protein 2 2
MIRT554273 SIX4 SIX homeobox 4 2 2
MIRT555796 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 2 2
MIRT556333 MAP2K4 mitogen-activated protein kinase kinase 4 2 2
MIRT556514 LIPA lipase A, lysosomal acid type 2 2
MIRT556708 KLHL28 kelch like family member 28 2 2
MIRT556767 KLF7 Kruppel like factor 7 2 2
MIRT557005 HPRT1 hypoxanthine phosphoribosyltransferase 1 2 2
MIRT557161 HOXA13 homeobox A13 2 2
MIRT557502 GPR27 G protein-coupled receptor 27 2 4
MIRT558117 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 2 2
MIRT559359 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT560350 ZWINT ZW10 interacting kinetochore protein 2 2
MIRT561314 ZBTB43 zinc finger and BTB domain containing 43 2 2
MIRT561898 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT561942 MFSD9 major facilitator superfamily domain containing 9 2 2
MIRT562950 TNIP2 TNFAIP3 interacting protein 2 2 2
MIRT563306 BBS10 Bardet-Biedl syndrome 10 2 2
MIRT563420 KIF3A kinesin family member 3A 2 2
MIRT563577 KIAA1586 KIAA1586 2 2
MIRT565891 NHS NHS actin remodeling regulator 2 2
MIRT566096 RCC2 regulator of chromosome condensation 2 2 2
MIRT566411 PLAGL2 PLAG1 like zinc finger 2 2 2
MIRT567274 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 2
MIRT571483 CCDC80 coiled-coil domain containing 80 2 2
MIRT572954 VDAC2 voltage dependent anion channel 2 2 2
MIRT573643 ZNF724P zinc finger protein 724 2 2
MIRT573732 KHSRP KH-type splicing regulatory protein 2 2
MIRT609103 SMIM15 small integral membrane protein 15 2 6
MIRT617951 EBNA1BP2 EBNA1 binding protein 2 2 2
MIRT618394 PRKG2 protein kinase, cGMP-dependent, type II 2 2
MIRT619642 PLEKHG7 pleckstrin homology and RhoGEF domain containing G7 2 2
MIRT623470 KDM5A lysine demethylase 5A 2 2
MIRT629160 CTCFL CCCTC-binding factor like 2 2
MIRT638536 LYRM2 LYR motif containing 2 2 2
MIRT649498 CLDN16 claudin 16 2 2
MIRT683163 MTHFD1 methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 2 2
MIRT691675 SLC43A3 solute carrier family 43 member 3 2 2
MIRT693216 MKI67 marker of proliferation Ki-67 2 2
MIRT695349 AQP3 aquaporin 3 (Gill blood group) 2 2
MIRT701038 PCGF5 polycomb group ring finger 5 2 2
MIRT708768 RYBP RING1 and YY1 binding protein 2 2
MIRT717573 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT719301 SETD7 SET domain containing lysine methyltransferase 7 2 2
MIRT725187 SDAD1 SDA1 domain containing 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-548am-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549, HCC827)
hsa-miR-548am-5p Gefitinib 123631 NSC715055 approved resistant High Non-Small Cell Lung Cancer cell line (A549, HCC827)
hsa-miR-548am-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-548am-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)

Error report submission