miRTarBase - #MIRT177570


—
pre-miRNA Information
pre-miRNA hsa-mir-4282   
Genomic Coordinates chr6: 72967687 - 72967753
Description Homo sapiens miR-4282 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4282
Sequence 40| UAAAAUUUGCAUCCAGGA |57
Evidence Experimental
Experiments SOLiD
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN32074657 13 COSMIC
COSN6331413 18 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1195771339 5 dbSNP
rs755058572 6 dbSNP
rs1245753664 11 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CSTF2T   
Synonyms CstF-64T
Description cleavage stimulation factor subunit 2 tau variant
Transcript NM_015235   
Expression
Putative miRNA Targets on CSTF2T
3'UTR of CSTF2T
(miRNA target sites are highlighted)		 
>CSTF2T|NM_015235|3'UTR
   1 AAGGTTTTAGAAAATATTTGGCTGTAGTCTCAAATTTTATTCTGTAGCATGGAGAATGGGTGCAAAAAGCTGACTTCTGT
  81 ATCCCCACACTTGGATTAGGGTTTCCCTCCTCCTAGAACCTAATCTTATTTTTTGTTCTTTTTCTTTCTTTCTGTTTTCC
 161 TTTTTTTTTTAATTGAGGGTGGGGGGAGGAGGGAGTGCGTCTGTTCACTTTAAGTTACTTTAAAATAACTCTGAACATGA
 241 TTATATTATGCCAAATAAGATTACAAAGAATAAGCAGCAATATTGAAGCATCTACAGTATGTTAACTACATTTTTTAAAT
 321 GTCGAGTAAAACTTCGTGAAAACTGCTCATAAAGACTAAAAGTTGACCTGTTAAAACGTTAATGTACTAAGATAGTTTTA
 401 AGATTTTTGGTTGTATAACAAAATAAAAGTTTACCCAAAAGTATAAGATACATTTTTTGGTAAACCATTTAAAATACAAA
 481 ATCCTATTTTGGAGGCAATAGGATAAGCATTGTCTTAGTGTTTTAGAATTATTTTTGAAACAGAGTTAACAGGATAAGGT
 561 TACACTTGTATTAGAATTGTTTTTTTCTAAAGTTATGTTACCTGAAAAATCAAGGAGTGCACCTGATTTACTGTTGCTTC
 641 ATTTATCCCATCCTTCAGAGACCAGCAAGGTTCTGCCAGGCCCCAAGCATCTGAGCATGATGATTTTGCTGTGACAATTC
 721 TAAGATCAACCAGGTTACTTAAGTCCGCTCTGATGAAACCCAGTCTCTCAATACCTTCCTATTTCTCAATAGTCTTTAAG
 801 CCCTAAATCTGAGTCAGTAATTCTCTAAAAATCCTTCCCAAAAATCAGTGTCTAGGGACTGGTTGATCTAGATGAGTTAT
 881 AAATGGTATTTGACTTTTCATAAGTAGTGGAAGGTTTCACTAAGTAAAGATCTGAGTTTCTTGGTATCTGACGTTTGTAT
 961 ACAGATGGTGTCCATTTGCTCAACCAGACAGGAGTTAACTTGTATTAGAATTGTTTTTTCTAAAGTTATGTTACCTGAGA
1041 AATTAAGGACTGCACCTGGTTTAATGTTGCTTCACTTATCCCACCCTACAGAGACCAGCAAGGTTCTGCCAGGCCTCGAG
1121 CATCCAAGCATGATTTTGCTGTGACAAATCTAAAATCAACCAGGCTACTTAAGTCTGCTCTGATGAAACCCAATAATCTC
1201 TCAATACCTTCCTATTTCTCAATAGTCTTTAAACCCTAAATCTGAGTCAGTAATTCTCTTACATCCTTCCCAAAAATCAG
1281 TGTCTAGGGACTAGTTGATCTGGATGAGTTATACATGATATTTGACTTTTCATAAGTAGTGGAAGGTTTCACTAAGTAAA
1361 ACTCTCAGTTTCTTGGTATCTGGCTTTCTTATACAGATGGTGTCCATTTGCTCCACCAGACAGGAGTTAAAAACCTTTAA
1441 AGAGCATTTAACATGCCTTTTAGTTTTCTTATTTCATAATCTACTTTTCTATCATTAATCATCTTACCAGGAATAATCAA
1521 GGCCCAGGTAGGTAGAAGTTTTTATATAGCCTGAATACTCACTTGACTTACTGCTCATTTTACTTTTTGCATGGAATACA
1601 GCCATTTAGTCCTAATATACATACCAATGAGACAATTAAAAATTGGTTGGAAGATGGAGCTTATCACATTGTGCTACTAC
1681 GACTTTATTTTTTCTTGAAAATAAAGCCTTGAGGATGTGAACATAAATGTTGGTATCATAAAACAAGTAGTAATAAAAGC
1761 ATAAATTATCAAATATCAGGTGATCTTACTATGGAGAAGAAAAACCAATATCTAGTTACAGATGAAAAAATGTTTAATAC
1841 AAAGAGCTGAAAATGTAGAAATTGAGTTATCTTCCCTTTGCAAAATTTTTACACTTTAAATTAGTAATTCTTTGTTTGCA
1921 AGGTTTTCATCCCTATGCTGTTGTTTTCTACTACCTGTTTTACTCTTGTTCATACTGCTACTTTCCCATGTTTCCTATAT
2001 GCCTCCCCTATATTGGAGAGGATAACTCGCGTTTACATATGTGATAGTTATGCTTAATACTAATTCACAGAGTTGGCTCG
2081 ATCATTTTGAGATTCTAGTTGCTTTATCTCAAAGCTTTCACTGAAGGGCTGTAACTGAAAATTATTAAATGTTAGTCTTT
2161 AGTCAAATCTCTGCATTGTTTCATGCAGAAAATAAAGATACAATTAAGGCTGAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agGACCUAC------GUUUAAAAu 5'
            :||| ||      |||||||| 
Target 5' atTTGGCTGTAGTCTCAAATTTTa 3'
 16 - 39 150.00 -8.40
2 
miRNA  3' aggaccuACG-UUUAAAAu 5'
                 ||| ||||||| 
Target 5' ttcccttTGCAAAATTTTt 3'
 1872 - 1890 147.00 -6.80
3 
miRNA  3' agGACCUACG-UUUAAAAu 5'
            :||  ||| |::|||| 
Target 5' ctTTGTTTGCAAGGTTTTc 3'
 1910 - 1928 120.00 -6.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31552922 5 COSMIC
COSN15658420 7 COSMIC
COSN31582276 10 COSMIC
COSN26972146 41 COSMIC
COSN30492036 58 COSMIC
COSN30127634 77 COSMIC
COSN31524119 80 COSMIC
COSN26972148 81 COSMIC
COSN30127635 85 COSMIC
COSN32053005 112 COSMIC
COSN31498413 138 COSMIC
COSN30140541 139 COSMIC
COSN30705819 148 COSMIC
COSN20107105 161 COSMIC
COSN23606389 198 COSMIC
COSN30127748 205 COSMIC
COSN8711362 915 COSMIC
COSN15124437 962 COSMIC
COSN21503867 1055 COSMIC
COSN6973041 1086 COSMIC
COSN17210860 1093 COSMIC
COSN22903877 1154 COSMIC
COSN20107104 1437 COSMIC
COSN25931172 1687 COSMIC
COSN31646289 2197 COSMIC
rs14168 1897 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs763289523 3 dbSNP
rs1235717345 9 dbSNP
rs757108476 11 dbSNP
rs753632908 15 dbSNP
rs763957208 17 dbSNP
rs1327257425 18 dbSNP
rs759639363 20 dbSNP
rs1383729331 23 dbSNP
rs751830434 24 dbSNP
rs766347859 29 dbSNP
rs763061471 38 dbSNP
rs1332899876 39 dbSNP
rs1235332075 44 dbSNP
rs375932725 45 dbSNP
rs1273944264 52 dbSNP
rs140943180 63 dbSNP
rs1214357831 69 dbSNP
rs924701077 74 dbSNP
rs1486403965 81 dbSNP
rs1043087392 92 dbSNP
rs947422212 99 dbSNP
rs557534493 104 dbSNP
rs915872436 106 dbSNP
rs1166634042 108 dbSNP
rs1418033705 110 dbSNP
rs1345856369 115 dbSNP
rs1316151437 122 dbSNP
rs1320577823 128 dbSNP
rs770329927 129 dbSNP
rs572448215 137 dbSNP
rs1418072145 138 dbSNP
rs1431242654 147 dbSNP
rs991485630 148 dbSNP
rs918258323 154 dbSNP
rs973803541 154 dbSNP
rs796317370 162 dbSNP
rs962475101 165 dbSNP
rs937956590 169 dbSNP
rs747587915 170 dbSNP
rs1210006849 171 dbSNP
rs1286979535 171 dbSNP
rs139403403 171 dbSNP
rs537541770 172 dbSNP
rs961162425 181 dbSNP
rs367823598 183 dbSNP
rs1189632066 185 dbSNP
rs1257709186 187 dbSNP
rs1427109580 187 dbSNP
rs548585998 194 dbSNP
rs1477449816 195 dbSNP
rs1409490788 197 dbSNP
rs773843170 198 dbSNP
rs568925720 199 dbSNP
rs1195464481 204 dbSNP
rs1416318735 206 dbSNP
rs1313725204 207 dbSNP
rs1350049435 212 dbSNP
rs1440148818 212 dbSNP
rs952430988 217 dbSNP
rs1285756047 225 dbSNP
rs748874228 227 dbSNP
rs1350523140 229 dbSNP
rs375755078 229 dbSNP
rs1350483326 231 dbSNP
rs1280638367 233 dbSNP
rs182181937 237 dbSNP
rs1000903918 245 dbSNP
rs1470194212 248 dbSNP
rs1192934713 249 dbSNP
rs996517803 266 dbSNP
rs1219124875 267 dbSNP
rs1436377263 280 dbSNP
rs901461692 283 dbSNP
rs755829142 289 dbSNP
rs1395480514 290 dbSNP
rs1408491360 297 dbSNP
rs1271952376 299 dbSNP
rs1398417445 305 dbSNP
rs1336436352 309 dbSNP
rs1340045327 310 dbSNP
rs1435779128 322 dbSNP
rs1301910465 324 dbSNP
rs7908187 325 dbSNP
rs566264949 333 dbSNP
rs11601 335 dbSNP
rs751757473 336 dbSNP
rs1360680243 346 dbSNP
rs942834824 349 dbSNP
rs529479702 354 dbSNP
rs563529892 359 dbSNP
rs1051322464 362 dbSNP
rs1419644966 363 dbSNP
rs1212464770 367 dbSNP
rs73343318 368 dbSNP
rs947480294 378 dbSNP
rs1476642188 381 dbSNP
rs1262088426 382 dbSNP
rs1188209623 383 dbSNP
rs1484465733 389 dbSNP
rs745331818 396 dbSNP
rs1236063386 399 dbSNP
rs894544948 400 dbSNP
rs1308556601 414 dbSNP
rs1169887316 415 dbSNP
rs1397419969 424 dbSNP
rs1260082053 429 dbSNP
rs1324016894 435 dbSNP
rs1396759877 441 dbSNP
rs1442354468 443 dbSNP
rs973771094 445 dbSNP
rs1056235824 449 dbSNP
rs1412740058 452 dbSNP
rs1229996435 459 dbSNP
rs1325052088 459 dbSNP
rs1271587384 471 dbSNP
rs1339609097 482 dbSNP
rs938696673 483 dbSNP
rs962445091 486 dbSNP
rs1317361944 488 dbSNP
rs560368042 499 dbSNP
rs1270791408 500 dbSNP
rs1294207342 510 dbSNP
rs1214254967 517 dbSNP
rs2339815 524 dbSNP
rs1416827227 525 dbSNP
rs1260891385 532 dbSNP
rs1445091181 537 dbSNP
rs1373401385 543 dbSNP
rs1381141416 543 dbSNP
rs927870809 545 dbSNP
rs772638495 546 dbSNP
rs1163035772 549 dbSNP
rs981993139 551 dbSNP
rs532894504 555 dbSNP
rs1184873738 565 dbSNP
rs867017678 569 dbSNP
rs1461967901 577 dbSNP
rs1158510378 580 dbSNP
rs1447243903 583 dbSNP
rs546908092 586 dbSNP
rs529817271 588 dbSNP
rs971230334 589 dbSNP
rs908353345 592 dbSNP
rs1491289582 596 dbSNP
rs752820805 596 dbSNP
rs1491369496 597 dbSNP
rs1233316214 598 dbSNP
rs952599236 602 dbSNP
rs1348505923 606 dbSNP
rs1028070047 610 dbSNP
rs975487445 611 dbSNP
rs964979276 613 dbSNP
rs1186079890 617 dbSNP
rs1259804196 619 dbSNP
rs1019835073 621 dbSNP
rs1158423690 626 dbSNP
rs1362100930 631 dbSNP
rs1165256087 632 dbSNP
rs7916579 633 dbSNP
rs1030952979 636 dbSNP
rs1412116008 640 dbSNP
rs1433188518 642 dbSNP
rs571987008 650 dbSNP
rs1310723750 651 dbSNP
rs903425053 658 dbSNP
rs1481254578 661 dbSNP
rs1396220874 670 dbSNP
rs1305735043 679 dbSNP
rs1240638349 682 dbSNP
rs1333465801 683 dbSNP
rs555410926 684 dbSNP
rs533070489 686 dbSNP
rs1346898369 697 dbSNP
rs1007400733 701 dbSNP
rs894594090 702 dbSNP
rs142914640 705 dbSNP
rs1247293607 710 dbSNP
rs1320102627 711 dbSNP
rs1248577259 715 dbSNP
rs556393681 717 dbSNP
rs117136630 727 dbSNP
rs897434618 730 dbSNP
rs1046366299 737 dbSNP
rs760079734 742 dbSNP
rs41305705 746 dbSNP
rs908446771 747 dbSNP
rs1175963476 750 dbSNP
rs1376422534 757 dbSNP
rs940965796 762 dbSNP
rs761154331 769 dbSNP
rs1297244607 770 dbSNP
rs1048744579 771 dbSNP
rs1373779570 773 dbSNP
rs1333325577 775 dbSNP
rs148650617 785 dbSNP
rs558202391 787 dbSNP
rs1305411919 789 dbSNP
rs114755068 794 dbSNP
rs1459124663 799 dbSNP
rs917087184 807 dbSNP
rs1481673689 815 dbSNP
rs1196418008 825 dbSNP
rs1252419993 840 dbSNP
rs190347507 852 dbSNP
rs16921608 860 dbSNP
rs1396135779 861 dbSNP
rs868616577 862 dbSNP
rs1169323948 866 dbSNP
rs1370935645 876 dbSNP
rs749005741 876 dbSNP
rs1463097819 879 dbSNP
rs1032853907 885 dbSNP
rs912251586 890 dbSNP
rs779038832 891 dbSNP
rs978668716 915 dbSNP
rs1368059621 924 dbSNP
rs774959366 940 dbSNP
rs1382523813 950 dbSNP
rs769648093 952 dbSNP
rs549306246 953 dbSNP
rs967635947 964 dbSNP
rs1272688499 970 dbSNP
rs1467191982 982 dbSNP
rs1253742041 983 dbSNP
rs1216104921 996 dbSNP
rs1247741183 1000 dbSNP
rs185713831 1002 dbSNP
rs1018257406 1008 dbSNP
rs1264259096 1015 dbSNP
rs1429977778 1020 dbSNP
rs1170928961 1028 dbSNP
rs755219842 1029 dbSNP
rs1459365065 1030 dbSNP
rs149460133 1032 dbSNP
rs1265148768 1039 dbSNP
rs1216725091 1042 dbSNP
rs1354206584 1044 dbSNP
rs180671912 1046 dbSNP
rs891242116 1047 dbSNP
rs1237909259 1050 dbSNP
rs796660163 1054 dbSNP
rs1375970574 1059 dbSNP
rs1301376386 1064 dbSNP
rs533542900 1069 dbSNP
rs1292834377 1070 dbSNP
rs1388070248 1075 dbSNP
rs1364873278 1080 dbSNP
rs958870600 1081 dbSNP
rs1292626400 1083 dbSNP
rs1453977968 1084 dbSNP
rs1034863207 1086 dbSNP
rs1362873120 1088 dbSNP
rs569745437 1103 dbSNP
rs35249954 1104 dbSNP
rs564056334 1112 dbSNP
rs547456545 1115 dbSNP
rs1473958325 1117 dbSNP
rs1396154828 1118 dbSNP
rs1413859272 1121 dbSNP
rs35869827 1138 dbSNP
rs1400109531 1139 dbSNP
rs1156836371 1148 dbSNP
rs1038607249 1159 dbSNP
rs1420026277 1167 dbSNP
rs1036394129 1168 dbSNP
rs1353749506 1174 dbSNP
rs905509683 1176 dbSNP
rs757322539 1177 dbSNP
rs1289579052 1185 dbSNP
rs887026451 1189 dbSNP
rs1048272821 1193 dbSNP
rs949822651 1195 dbSNP
rs1286874668 1202 dbSNP
rs916952626 1206 dbSNP
rs527339517 1221 dbSNP
rs921082980 1222 dbSNP
rs561666634 1239 dbSNP
rs925804071 1242 dbSNP
rs1287898975 1244 dbSNP
rs1237620813 1249 dbSNP
rs1039921882 1260 dbSNP
rs1175428724 1262 dbSNP
rs978637756 1264 dbSNP
rs964620558 1265 dbSNP
rs1172819409 1270 dbSNP
rs753808049 1272 dbSNP
rs1436879966 1276 dbSNP
rs1335097409 1279 dbSNP
rs1440037753 1284 dbSNP
rs1281814687 1300 dbSNP
rs1378346520 1312 dbSNP
rs985896635 1318 dbSNP
rs541802881 1332 dbSNP
rs576411350 1336 dbSNP
rs977097542 1339 dbSNP
rs562522304 1357 dbSNP
rs955409242 1358 dbSNP
rs778030720 1359 dbSNP
rs758359970 1364 dbSNP
rs575705138 1365 dbSNP
rs1192915440 1366 dbSNP
rs1296753771 1367 dbSNP
rs1478848314 1371 dbSNP
rs1173389629 1378 dbSNP
rs1408398591 1382 dbSNP
rs1419027266 1382 dbSNP
rs1399852226 1383 dbSNP
rs1403315776 1385 dbSNP
rs914818938 1387 dbSNP
rs562734741 1388 dbSNP
rs1174875159 1389 dbSNP
rs752976401 1391 dbSNP
rs959147080 1392 dbSNP
rs546040255 1411 dbSNP
rs116357941 1413 dbSNP
rs188365307 1416 dbSNP
rs1193213708 1421 dbSNP
rs545155801 1427 dbSNP
rs113063983 1440 dbSNP
rs113758518 1440 dbSNP
rs368228136 1440 dbSNP
rs1017138532 1442 dbSNP
rs1256569251 1443 dbSNP
rs1202130537 1456 dbSNP
rs761086149 1457 dbSNP
rs1342741629 1469 dbSNP
rs1228313141 1470 dbSNP
rs1173090006 1471 dbSNP
rs1424439961 1475 dbSNP
rs1254912058 1478 dbSNP
rs971507361 1483 dbSNP
rs1393467963 1485 dbSNP
rs1387824670 1491 dbSNP
rs1318128153 1492 dbSNP
rs1319375159 1494 dbSNP
rs184020815 1499 dbSNP
rs1428293090 1513 dbSNP
rs1014977549 1514 dbSNP
rs1004894485 1533 dbSNP
rs887755560 1538 dbSNP
rs572396903 1542 dbSNP
rs377029256 1544 dbSNP
rs577199524 1544 dbSNP
rs1014300719 1546 dbSNP
rs1358446378 1546 dbSNP
rs755221284 1549 dbSNP
rs1336509665 1550 dbSNP
rs555350411 1554 dbSNP
rs1264114050 1561 dbSNP
rs1394805280 1562 dbSNP
rs1027334486 1565 dbSNP
rs1370242825 1577 dbSNP
rs1332614185 1579 dbSNP
rs754255455 1583 dbSNP
rs899731484 1584 dbSNP
rs925768320 1586 dbSNP
rs146280304 1589 dbSNP
rs576100516 1593 dbSNP
rs16921605 1597 dbSNP
rs117456834 1611 dbSNP
rs890879918 1612 dbSNP
rs1041415935 1617 dbSNP
rs750892718 1618 dbSNP
rs1368868982 1623 dbSNP
rs1413766547 1624 dbSNP
rs571017857 1625 dbSNP
rs762202700 1627 dbSNP
rs990204952 1630 dbSNP
rs191733426 1632 dbSNP
rs1255461307 1635 dbSNP
rs1348309877 1636 dbSNP
rs1218470787 1648 dbSNP
rs16921604 1656 dbSNP
rs973214770 1668 dbSNP
rs1208980807 1670 dbSNP
rs561723230 1680 dbSNP
rs981646441 1681 dbSNP
rs1181737683 1687 dbSNP
rs1362514231 1687 dbSNP
rs548221591 1711 dbSNP
rs1197655036 1715 dbSNP
rs1356527289 1716 dbSNP
rs1005690901 1722 dbSNP
rs775214253 1730 dbSNP
rs1243144373 1732 dbSNP
rs531302615 1737 dbSNP
rs769401327 1740 dbSNP
rs1396062976 1753 dbSNP
rs983511717 1753 dbSNP
rs1023616688 1759 dbSNP
rs952209563 1760 dbSNP
rs1309781994 1780 dbSNP
rs1232371041 1785 dbSNP
rs1027681828 1788 dbSNP
rs1483632744 1798 dbSNP
rs1310682047 1808 dbSNP
rs562797104 1812 dbSNP
rs1014523531 1814 dbSNP
rs1248468508 1824 dbSNP
rs895461342 1826 dbSNP
rs1449625523 1827 dbSNP
rs1394862172 1832 dbSNP
rs1452900941 1834 dbSNP
rs1052814950 1839 dbSNP
rs546061300 1842 dbSNP
rs904312319 1852 dbSNP
rs1297154927 1854 dbSNP
rs540166587 1860 dbSNP
rs1448988894 1866 dbSNP
rs577003757 1879 dbSNP
rs1369990345 1889 dbSNP
rs1008024830 1892 dbSNP
rs14168 1897 dbSNP
rs1226951396 1903 dbSNP
rs1256315232 1904 dbSNP
rs1320009864 1910 dbSNP
rs1052087549 1919 dbSNP
rs1199836734 1919 dbSNP
rs1467444103 1923 dbSNP
rs1041467984 1935 dbSNP
rs945841011 1941 dbSNP
rs892864320 1947 dbSNP
rs1169303283 1954 dbSNP
rs1420837246 1955 dbSNP
rs759311534 1955 dbSNP
rs540006407 1962 dbSNP
rs1171324907 1965 dbSNP
rs937000759 1974 dbSNP
rs775971684 1979 dbSNP
rs927537284 1986 dbSNP
rs909929099 1997 dbSNP
rs1295118304 2007 dbSNP
rs770540671 2010 dbSNP
rs1368038107 2012 dbSNP
rs984225644 2013 dbSNP
rs1276475081 2015 dbSNP
rs1235830743 2028 dbSNP
rs141882960 2029 dbSNP
rs950215737 2030 dbSNP
rs187285576 2031 dbSNP
rs1224414739 2038 dbSNP
rs1266467956 2039 dbSNP
rs960355946 2041 dbSNP
rs1045767 2051 dbSNP
rs952193853 2052 dbSNP
rs1028150623 2058 dbSNP
rs1193802766 2067 dbSNP
rs1416493649 2070 dbSNP
rs1403603195 2078 dbSNP
rs748240511 2079 dbSNP
rs1007275470 2080 dbSNP
rs1452724951 2084 dbSNP
rs888934063 2105 dbSNP
rs1362738680 2111 dbSNP
rs556242432 2131 dbSNP
rs1018162483 2135 dbSNP
rs1292814627 2142 dbSNP
rs138751969 2144 dbSNP
rs1308644861 2145 dbSNP
rs1230527689 2152 dbSNP
rs777704440 2155 dbSNP
rs1313988029 2160 dbSNP
rs185169340 2167 dbSNP
rs897707261 2173 dbSNP
rs1036284872 2175 dbSNP
rs1489095038 2180 dbSNP
rs939980378 2182 dbSNP
rs74132567 2183 dbSNP
rs1471490479 2184 dbSNP
rs1020103377 2198 dbSNP
rs755199985 2203 dbSNP
rs1010478167 2204 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' aggaccuacGUUUAAAAu 5'
                   |||||||| 
Target 5' ------ucuCAAAUUUUa 3'
 		1 - 12
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 23283.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' aggaccuacGUUUAAAAu 5'
                   |||||||| 
Target 5' ------ucuCAAAUUUUa 3'
 		1 - 12
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000331173.4 | 3UTR | UCUCAAAUUUUAUUCUGUAGCAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000331173.4 | 3UTR | UCUCAAAUUUUAUUCUGUAGCAUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
280 hsa-miR-4282 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT057628 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT060732 RPS3 ribosomal protein S3 2 2
MIRT063371 ETNK1 ethanolamine kinase 1 2 2
MIRT066257 LRIG3 leucine rich repeats and immunoglobulin like domains 3 2 4
MIRT070774 HIF1A hypoxia inducible factor 1 alpha subunit 2 2
MIRT070871 EIF2S1 eukaryotic translation initiation factor 2 subunit alpha 2 4
MIRT078056 PCTP phosphatidylcholine transfer protein 2 2
MIRT078408 DCAF7 DDB1 and CUL4 associated factor 7 2 4
MIRT084059 PPP1R3D protein phosphatase 1 regulatory subunit 3D 2 2
MIRT093537 GALNT7 polypeptide N-acetylgalactosaminyltransferase 7 2 6
MIRT096072 SFXN1 sideroflexin 1 2 2
MIRT098316 REV3L REV3 like, DNA directed polymerase zeta catalytic subunit 2 2
MIRT100493 UHRF1BP1 UHRF1 binding protein 1 2 2
MIRT102254 HBP1 HMG-box transcription factor 1 2 4
MIRT105318 VPS37A VPS37A, ESCRT-I subunit 2 2
MIRT114143 MZT1 mitotic spindle organizing protein 1 2 4
MIRT114873 DICER1 dicer 1, ribonuclease III 2 2
MIRT134683 PNRC2 proline rich nuclear receptor coactivator 2 2 2
MIRT137640 RCOR1 REST corepressor 1 2 2
MIRT155449 CCNT2 cyclin T2 2 4
MIRT165656 DCTN4 dynactin subunit 4 2 2
MIRT177570 CSTF2T cleavage stimulation factor subunit 2 tau variant 2 4
MIRT188514 E2F7 E2F transcription factor 7 2 10
MIRT193019 TMOD3 tropomodulin 3 2 4
MIRT195823 GADD45A growth arrest and DNA damage inducible alpha 2 2
MIRT195885 DEPDC1 DEP domain containing 1 2 6
MIRT206029 NUP50 nucleoporin 50 2 6
MIRT212148 CLCN3 chloride voltage-gated channel 3 2 2
MIRT213999 DCP2 decapping mRNA 2 2 2
MIRT214650 HNRNPA0 heterogeneous nuclear ribonucleoprotein A0 2 2
MIRT221568 CBX3 chromobox 3 2 2
MIRT224544 ZNF623 zinc finger protein 623 2 2
MIRT227654 SET SET nuclear proto-oncogene 2 2
MIRT229992 CHIC1 cysteine rich hydrophobic domain 1 2 2
MIRT238968 QKI QKI, KH domain containing RNA binding 2 2
MIRT239825 ACTB actin beta 2 2
MIRT241084 ZXDA zinc finger, X-linked, duplicated A 2 4
MIRT244852 ZBTB5 zinc finger and BTB domain containing 5 2 2
MIRT264534 TARDBP TAR DNA binding protein 2 2
MIRT271438 SKI SKI proto-oncogene 2 2
MIRT271597 ENAH ENAH, actin regulator 2 2
MIRT294332 ZNF264 zinc finger protein 264 2 2
MIRT296341 PARD6B par-6 family cell polarity regulator beta 2 2
MIRT301715 TEF TEF, PAR bZIP transcription factor 2 2
MIRT308549 ZNF654 zinc finger protein 654 2 2
MIRT313866 DEPDC1B DEP domain containing 1B 2 2
MIRT315529 MARCKS myristoylated alanine rich protein kinase C substrate 2 2
MIRT321066 RABGEF1 RAB guanine nucleotide exchange factor 1 2 2
MIRT343777 NUTF2 nuclear transport factor 2 2 2
MIRT359109 MAP1B microtubule associated protein 1B 2 2
MIRT397393 GOLGA3 golgin A3 2 4
MIRT400822 CPEB2 cytoplasmic polyadenylation element binding protein 2 2 2
MIRT442171 DSEL dermatan sulfate epimerase-like 2 2
MIRT442777 JAG1 jagged 1 2 2
MIRT442862 SCARF1 scavenger receptor class F member 1 2 4
MIRT442919 PCBD2 pterin-4 alpha-carbinolamine dehydratase 2 2 2
MIRT444567 TRA2B transformer 2 beta homolog 2 2
MIRT444718 CMSS1 cms1 ribosomal small subunit homolog (yeast) 2 2
MIRT445018 RBMS3 RNA binding motif single stranded interacting protein 3 2 2
MIRT445853 LRRC1 leucine rich repeat containing 1 2 2
MIRT446242 HELZ helicase with zinc finger 2 2
MIRT446542 GOLGA8B golgin A8 family member B 2 2
MIRT446643 SPTY2D1 SPT2 chromatin protein domain containing 1 2 2
MIRT446948 ZMAT3 zinc finger matrin-type 3 2 4
MIRT447061 KCNAB1 potassium voltage-gated channel subfamily A member regulatory beta subunit 1 2 2
MIRT447327 ZSCAN21 zinc finger and SCAN domain containing 21 2 2
MIRT447995 CDX1 caudal type homeobox 1 2 2
MIRT448543 RHEBP1 RHEB pseudogene 1 2 6
MIRT448752 HINT1 histidine triad nucleotide binding protein 1 2 2
MIRT448772 GOLGA8A golgin A8 family member A 2 2
MIRT449342 WDR26 WD repeat domain 26 2 2
MIRT450011 SLC16A6 solute carrier family 16 member 6 2 4
MIRT450229 PCNX pecanex homolog 1 2 2
MIRT450340 MRPL17 mitochondrial ribosomal protein L17 2 4
MIRT450381 MSI2 musashi RNA binding protein 2 2 2
MIRT450759 PGGT1B protein geranylgeranyltransferase type I subunit beta 2 2
MIRT450809 NRCAM neuronal cell adhesion molecule 2 2
MIRT450947 ATAD2 ATPase family, AAA domain containing 2 2 2
MIRT459095 CCPG1 cell cycle progression 1 2 2
MIRT462428 TWISTNB TWIST neighbor 2 2
MIRT465200 TROVE2 TROVE domain family member 2 2 4
MIRT467382 SON SON DNA binding protein 2 4
MIRT468546 SERP1 stress associated endoplasmic reticulum protein 1 2 2
MIRT471506 PDE4D phosphodiesterase 4D 2 2
MIRT471981 NR3C1 nuclear receptor subfamily 3 group C member 1 2 2
MIRT474478 KLHL11 kelch like family member 11 2 8
MIRT475011 KANSL1 KAT8 regulatory NSL complex subunit 1 2 8
MIRT480341 C5orf51 chromosome 5 open reading frame 51 2 2
MIRT482696 TEX9 testis expressed 9 2 6
MIRT483462 YTHDF1 YTH N6-methyladenosine RNA binding protein 1 2 6
MIRT485623 FAM217B family with sequence similarity 217 member B 2 2
MIRT485714 CASP16 caspase 16, pseudogene 2 8
MIRT486279 SEC23A Sec23 homolog A, coat complex II component 2 2
MIRT491000 PEBP1 phosphatidylethanolamine binding protein 1 2 4
MIRT492594 PPIL4 peptidylprolyl isomerase like 4 2 2
MIRT493365 KIF5B kinesin family member 5B 2 2
MIRT494316 CDKN1B cyclin dependent kinase inhibitor 1B 2 2
MIRT495208 EDN3 endothelin 3 2 2
MIRT497011 TCF15 transcription factor 15 2 2
MIRT498512 FRK fyn related Src family tyrosine kinase 2 2
MIRT498778 PARP15 poly(ADP-ribose) polymerase family member 15 2 2
MIRT501045 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 2 6
MIRT502939 CDC37L1 cell division cycle 37 like 1 2 8
MIRT504806 VHL von Hippel-Lindau tumor suppressor 2 6
MIRT505656 SHMT1 serine hydroxymethyltransferase 1 2 6
MIRT505964 RAB5C RAB5C, member RAS oncogene family 2 6
MIRT506322 OTUD4 OTU deubiquitinase 4 2 4
MIRT506803 KLHL15 kelch like family member 15 2 6
MIRT506917 KBTBD8 kelch repeat and BTB domain containing 8 2 4
MIRT507400 EMC7 ER membrane protein complex subunit 7 2 8
MIRT507471 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 6
MIRT508058 ATP13A3 ATPase 13A3 2 4
MIRT508135 AMD1 adenosylmethionine decarboxylase 1 2 2
MIRT509895 RPS23 ribosomal protein S23 2 4
MIRT510881 RAN RAN, member RAS oncogene family 2 8
MIRT513766 PEX5L peroxisomal biogenesis factor 5 like 2 4
MIRT516898 COPS8 COP9 signalosome subunit 8 2 2
MIRT518703 TIMD4 T-cell immunoglobulin and mucin domain containing 4 2 4
MIRT520429 TTPAL alpha tocopherol transfer protein like 2 6
MIRT521843 PNISR PNN interacting serine and arginine rich protein 2 4
MIRT522116 NUDT3 nudix hydrolase 3 2 4
MIRT525467 TMPRSS12 transmembrane protease, serine 12 2 2
MIRT525583 MTRNR2L7 MT-RNR2-like 7 2 2
MIRT525906 BUB1 BUB1 mitotic checkpoint serine/threonine kinase 2 2
MIRT526072 C11orf54 chromosome 11 open reading frame 54 2 2
MIRT526232 MTRNR2L5 MT-RNR2-like 5 2 4
MIRT526455 FAM71F2 family with sequence similarity 71 member F2 2 4
MIRT526515 POU5F1B POU class 5 homeobox 1B 2 2
MIRT528032 FEZ2 fasciculation and elongation protein zeta 2 2 2
MIRT528422 MRPS16 mitochondrial ribosomal protein S16 2 2
MIRT528995 ISLR2 immunoglobulin superfamily containing leucine rich repeat 2 2 4
MIRT529311 ATRNL1 attractin like 1 2 2
MIRT529376 SKP1 S-phase kinase associated protein 1 2 4
MIRT530015 SRRM1 serine and arginine repetitive matrix 1 2 2
MIRT530089 FMN2 formin 2 2 2
MIRT530942 ENPP6 ectonucleotide pyrophosphatase/phosphodiesterase 6 2 2
MIRT531229 HIST1H2BD histone cluster 1 H2B family member d 2 2
MIRT533088 YTHDF3 YTH N6-methyladenosine RNA binding protein 3 2 2
MIRT533299 USP46 ubiquitin specific peptidase 46 2 2
MIRT533318 UNKL unkempt family like zinc finger 2 2
MIRT533721 TMEM30A transmembrane protein 30A 2 2
MIRT534096 AZF1 azoospermia factor 1 2 2
MIRT534188 SLC7A11 solute carrier family 7 member 11 2 2
MIRT534493 SAR1B secretion associated Ras related GTPase 1B 2 2
MIRT536077 MBOAT2 membrane bound O-acyltransferase domain containing 2 2 2
MIRT536242 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT537524 FAM104A family with sequence similarity 104 member A 2 2
MIRT538088 DGKH diacylglycerol kinase eta 2 2
MIRT538475 CNBP CCHC-type zinc finger nucleic acid binding protein 2 2
MIRT538853 BTG1 BTG anti-proliferation factor 1 2 4
MIRT539075 GDNF glial cell derived neurotrophic factor 2 2
MIRT539480 ACVR2B activin A receptor type 2B 2 4
MIRT540210 ARHGAP18 Rho GTPase activating protein 18 2 2
MIRT541940 TSPAN2 tetraspanin 2 2 2
MIRT543812 COCH cochlin 2 2
MIRT545120 PDZRN4 PDZ domain containing ring finger 4 2 2
MIRT545571 GIMAP4 GTPase, IMAP family member 4 2 2
MIRT545989 XKR4 XK related 4 2 2
MIRT547213 PANK3 pantothenate kinase 3 2 4
MIRT547740 KIAA1468 KIAA1468 2 2
MIRT548022 GRB2 growth factor receptor bound protein 2 2 4
MIRT548032 GOLIM4 golgi integral membrane protein 4 2 2
MIRT548102 GFPT1 glutamine--fructose-6-phosphate transaminase 1 2 4
MIRT548217 FKBP1A FK506 binding protein 1A 2 2
MIRT548588 DDX3X DEAD-box helicase 3, X-linked 2 4
MIRT548953 CDC27 cell division cycle 27 2 2
MIRT549072 CACUL1 CDK2 associated cullin domain 1 2 2
MIRT550368 INCENP inner centromere protein 2 6
MIRT550546 MYZAP myocardial zonula adherens protein 2 2
MIRT551491 TMEM192 transmembrane protein 192 2 4
MIRT553078 UEVLD UEV and lactate/malate dehyrogenase domains 2 2
MIRT554104 SMU1 DNA replication regulator and spliceosomal factor 2 2
MIRT555127 PTPRG protein tyrosine phosphatase, receptor type G 2 2
MIRT555477 POC1B-GALNT4 POC1B-GALNT4 readthrough 2 2
MIRT555978 NPTN neuroplastin 2 2
MIRT557011 HPRT1 hypoxanthine phosphoribosyltransferase 1 2 2
MIRT557706 GALNT4 polypeptide N-acetylgalactosaminyltransferase 4 2 2
MIRT558333 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 4
MIRT558488 DBN1 drebrin 1 2 2
MIRT559942 ZNF567 zinc finger protein 567 2 2
MIRT561127 ATP2B1 ATPase plasma membrane Ca2+ transporting 1 2 2
MIRT561791 PAWR pro-apoptotic WT1 regulator 2 2
MIRT562438 EEF2 eukaryotic translation elongation factor 2 2 2
MIRT563102 PABPC4L poly(A) binding protein cytoplasmic 4 like 2 2
MIRT563212 ZNF813 zinc finger protein 813 2 2
MIRT563426 KIF3A kinesin family member 3A 2 2
MIRT563473 SPIN4 spindlin family member 4 2 2
MIRT564015 HSPA4 heat shock protein family A (Hsp70) member 4 2 4
MIRT564117 ZYG11B zyg-11 family member B, cell cycle regulator 2 2
MIRT564223 SDE2 SDE2 telomere maintenance homolog 2 2
MIRT564503 CACNG1 calcium voltage-gated channel auxiliary subunit gamma 1 2 2
MIRT564515 DUSP3 dual specificity phosphatase 3 2 2
MIRT564811 ZBTB21 zinc finger and BTB domain containing 21 2 2
MIRT565265 TPD52 tumor protein D52 2 2
MIRT566012 RHOB ras homolog family member B 2 2
MIRT566216 PTMA prothymosin, alpha 2 2
MIRT566638 NFYA nuclear transcription factor Y subunit alpha 2 2
MIRT566821 MAPK8 mitogen-activated protein kinase 8 2 2
MIRT566948 LEPROT leptin receptor overlapping transcript 2 2
MIRT567290 HNRNPAB heterogeneous nuclear ribonucleoprotein A/B 2 2
MIRT567895 CSTF2 cleavage stimulation factor subunit 2 2 2
MIRT568731 MTRNR2L3 MT-RNR2-like 3 2 2
MIRT571263 ZNF239 zinc finger protein 239 2 2
MIRT572593 EIF2AK4 eukaryotic translation initiation factor 2 alpha kinase 4 2 2
MIRT573827 TGOLN2 trans-golgi network protein 2 2 2
MIRT576391 Fhl2 four and a half LIM domains 2 2 2
MIRT609901 SMS spermine synthase 2 2
MIRT613710 ELMSAN1 ELM2 and Myb/SANT domain containing 1 2 2
MIRT614406 ADAT1 adenosine deaminase, tRNA specific 1 2 2
MIRT615042 DCX doublecortin 2 2
MIRT617514 C5orf45 MRN complex interacting protein 2 2
MIRT619476 PRDM10 PR/SET domain 10 2 2
MIRT620349 TLN1 talin 1 2 2
MIRT620910 PLA2G7 phospholipase A2 group VII 2 2
MIRT622131 SP4 Sp4 transcription factor 2 2
MIRT622955 OTUD7B OTU deubiquitinase 7B 2 2
MIRT623351 MAGI3 membrane associated guanylate kinase, WW and PDZ domain containing 3 2 2
MIRT623619 INTU inturned planar cell polarity protein 2 2
MIRT624409 CCDC171 coiled-coil domain containing 171 2 2
MIRT625171 CCS copper chaperone for superoxide dismutase 2 2
MIRT625685 RPP40 ribonuclease P/MRP subunit p40 2 2
MIRT625875 ALDH18A1 aldehyde dehydrogenase 18 family member A1 2 2
MIRT626002 FAM107A family with sequence similarity 107 member A 2 2
MIRT626872 HRH4 histamine receptor H4 2 4
MIRT628220 FKBP9 FK506 binding protein 9 2 2
MIRT628265 DIO2 iodothyronine deiodinase 2 2 2
MIRT628402 C8orf37 chromosome 8 open reading frame 37 2 2
MIRT630564 C3orf36 chromosome 3 open reading frame 36 2 4
MIRT631577 RASSF9 Ras association domain family member 9 2 2
MIRT635730 CCDC58 coiled-coil domain containing 58 2 2
MIRT636224 SLC8A1 solute carrier family 8 member A1 2 2
MIRT636613 CLIC5 chloride intracellular channel 5 2 2
MIRT638899 CDK9 cyclin dependent kinase 9 2 2
MIRT640167 ATXN7L1 ataxin 7 like 1 2 2
MIRT642070 GTDC1 glycosyltransferase like domain containing 1 2 2
MIRT643034 CHCHD7 coiled-coil-helix-coiled-coil-helix domain containing 7 2 2
MIRT644572 SPOP speckle type BTB/POZ protein 2 2
MIRT644954 IFNB1 interferon beta 1 2 2
MIRT645948 TTF2 transcription termination factor 2 2 2
MIRT646440 XRCC2 X-ray repair cross complementing 2 2 2
MIRT647896 EPN2 epsin 2 2 2
MIRT648276 ZNF582 zinc finger protein 582 2 2
MIRT649381 NEDD1 neural precursor cell expressed, developmentally down-regulated 1 2 2
MIRT650254 CD68 CD68 molecule 2 2
MIRT650333 ATP5S ATP synthase, H+ transporting, mitochondrial Fo complex subunit s (factor B) 2 2
MIRT651707 VMP1 vacuole membrane protein 1 2 2
MIRT651774 VASP vasodilator stimulated phosphoprotein 2 2
MIRT653144 SRPK2 SRSF protein kinase 2 2 2
MIRT654112 RPS6KA5 ribosomal protein S6 kinase A5 2 2
MIRT654161 RORB RAR related orphan receptor B 2 2
MIRT655716 MLF2 myeloid leukemia factor 2 2 2
MIRT657476 HDAC4 histone deacetylase 4 2 2
MIRT658095 FOXO1 forkhead box O1 2 2
MIRT658860 DTX3L deltex E3 ubiquitin ligase 3L 2 2
MIRT658988 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 2
MIRT660767 ALDH6A1 aldehyde dehydrogenase 6 family member A1 2 2
MIRT661622 C2orf15 chromosome 2 open reading frame 15 2 2
MIRT661694 TFDP2 transcription factor Dp-2 2 2
MIRT662208 PLA2G4E phospholipase A2 group IVE 2 2
MIRT662443 RALGAPA1 Ral GTPase activating protein catalytic alpha subunit 1 2 2
MIRT664422 ADH5 alcohol dehydrogenase 5 (class III), chi polypeptide 2 2
MIRT687505 NECAB1 N-terminal EF-hand calcium binding protein 1 2 2
MIRT689910 SOD2 superoxide dismutase 2 2 2
MIRT690781 PLA2G2C phospholipase A2 group IIC 2 2
MIRT698488 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT699685 SFMBT2 Scm like with four mbt domains 2 2 2
MIRT700926 PDS5A PDS5 cohesin associated factor A 2 2
MIRT702258 LMNB1 lamin B1 2 2
MIRT703166 GPR137C G protein-coupled receptor 137C 2 2
MIRT703242 GNS glucosamine (N-acetyl)-6-sulfatase 2 2
MIRT704737 CENPQ centromere protein Q 2 2
MIRT707310 GLRX2 glutaredoxin 2 2 2
MIRT710021 KCNQ5 potassium voltage-gated channel subfamily Q member 5 2 2
MIRT712212 SCOC short coiled-coil protein 2 2
MIRT714742 SETBP1 SET binding protein 1 2 2
MIRT718268 ZNF749 zinc finger protein 749 2 2
MIRT720553 DYRK4 dual specificity tyrosine phosphorylation regulated kinase 4 2 2
MIRT722248 RBM41 RNA binding motif protein 41 2 2
MIRT723767 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT723977 KIAA0146 scaffolding protein involved in DNA repair 1 1
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-4282 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-4282 Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-4282 Neoadjuvant chemotherapy sensitive tissue (breast cancer)

Error report submission