miRTarBase - #MIRT177614


—
pre-miRNA Information
pre-miRNA hsa-mir-4699   
Genomic Coordinates chr12: 81158388 - 81158461
Description Homo sapiens miR-4699 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4699-3p
Sequence 46| AAUUUACUCUGCAAUCUUCUCC |67
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN20804631 9 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1419816940 6 dbSNP
rs919201645 9 dbSNP
rs950685323 11 dbSNP
rs985212635 14 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol UBE2D1   
Synonyms E2(17)KB1, SFT, UBC4/5, UBCH5, UBCH5A
Description ubiquitin conjugating enzyme E2 D1
Transcript NM_003338   
Expression
Putative miRNA Targets on UBE2D1
3'UTR of UBE2D1
(miRNA target sites are highlighted)		 
>UBE2D1|NM_003338|3'UTR
   1 AAATCAAAAACATTTTCATATATACCAGAGTACTGTAAAATCTAGGTTTTTTTCAACATTAGCAGTAAATTGAGCACTGT
  81 TTACTGTTTCATTGTACCATGAAACCATTTGATTTTTACCCATTTTAAATGTGTTTCTGAAGCAAGACAAAACAAACTTC
 161 CAAAAATACCCTTAAGACTGTGATGAGAGCATTTATCATTTTGTATGCATTGAGAAAGACATTTATTATGGTTTTTAAGA
 241 TACTTGGACATCTGCATCTTCAGCTTACAAGATCTACAATGCAGCTGAAAAGCAACCAAATTATTTTTTGCTGAAACTAG
 321 ATGTTTTTACATGAGAAATACTGTATGTGTTGTCTAAGATGTCAGTTTTATAAATCTGTATTCAGATTTCATTCTTTGTT
 401 AGCTCACTTTATAATTTGTATTTTTTTACTGTATAGACTAAATATATTCTATTTACATGTATGTCAACTCATTACTTTTT
 481 TCCTGTGAACAGTATTGAAAAACCCCAACGGCTGATAATTAAGTGAATTAACTGTGTCTCCCTTGTCTTAGGATATTCTG
 561 TAGATTGATTGCAGATTTCTTAAATCTGAAATGATCTTTACACTGTAATTCTCAGCATACTGATTATGGAGAAACACTTG
 641 TTTTGATTTTGTTATACTTGACTTAACTTTATTGCAATGTGAATTAATTGCACTGCTAAGTAGGAAGATGTGTAACTTTT
 721 ATTTGTTGCTATTCACATTTGAATTTTTTCCTGTATAGGCAATATTATATTGACACCTTTTACAGATCTTACTGTAGCTT
 801 TTTCCATATAAATAAAATGCTTTTTCTACTATTTGTCTTGATTACTTAAAAAAATAAAAATATAAGTAAGGATCAAAACT
 881 CTAAAATTTTGCATGAAAATTACATCCAAATTGTGAAAATCAGATCTATTTTGTTTGCCATTAGTCACCATTAGTTATAT
 961 AAATTTTATTGTTTTAGGTTAGTATCTCTTTACTAAATTGTCAGTCTATAAGATAATATATGTTGATCCCTTGCTGTAGA
1041 GGAGAATTTAGAGTAATTTGGGGTTTGTCTTGGATTATATCTAAATGGATTATTTGTTAAAAGTACTGAAATGAGTATAA
1121 GGCAGTATCACCCATCCAAAAGAAAGGTCTTTATAGACCTGCACAGTCACTAGATTAATTCATTAAAATGCCCCCACCCT
1201 GATGTAATTGACATTACATTTCTTAACATTTTAAAATCTAGAATTTCTAAAATGGAATTTAATGCCATCACAATTTGAAA
1281 AACTTTTTTTTTTTTTTTACTATAGAAGTTACAAAGGAAGTTCTAAAATTATGCCTCCCTCTGTTTTTATAAGTTGCCAT
1361 CGAAAAGTGATTTAAATAAGCAGGTTATCTTTATAGATTTTAAAGAAAACTAGAAAGTTTTAATGTTTTAACTTGGGGAA
1441 AAATACATCTCTTTAATGTTTAGCATGCTTGTCAACCTTGAGTGAGTGTCATTTTTAAGAACAGTTGTAGCCCTTCTGAT
1521 TATTGCAGTAGCTGTAGAAGTATGTAAGAATATGTGATGGGTGTAGTCATTAGCAAAGCATTTAAATCACTTGAGTATTT
1601 TGTCATGGTTCATTATTATTAAAGCACAAAATAACCTATTGTTAGAAAATATGTGTTTTTATAAATGAATGTAAAATAAT
1681 TAAATGAATTGTGAAATGGATGTTTAAGAAAATATAGGCTTAAAAAGTAAATCTATAAAATGATGTCTTAAAACAGCCAT
1761 ATCATGAAAAATTCTACTTAGCTATATTATTATAAGCTACATTTGCCCTGAATTTGAACACTCAACATCACTAGATTTAA
1841 ATATTTAGTATATTTTGATAGTAAAGGGTTTTGTTTCTTGAATATCTTCACTTTAAACAAAAAAAAAAAACAACTTTCAT
1921 TTGTGTGGCATTTATTTTTGGAAGTGTCTTCTTTTTTTTCTTTATTAAAGTTTTTGAAACTTGCCTAAAAAAAAAAAAAA
2001 AAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ccucUUCUAACGUC-UCAUUUAa 5'
              || |||  || ||||||| 
Target 5' tttcAACATT--AGCAGTAAATt 3'
 51 - 71 154.00 -5.90
2 
miRNA  3' ccUCUUCUAACGUCUCAUUUAa 5'
            ||:||| | :||||||| | 
Target 5' agAGGAGAATTTAGAGTAATTt 3'
 1038 - 1059 144.00 -16.12
3 
miRNA  3' ccUCUUCUAACGUCUCAUUUAa 5'
            ||||| || || || ||:| 
Target 5' atAGAAG-TTACAAAGGAAGTt 3'
 1302 - 1322 123.00 -6.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30148137 6 COSMIC
COSN30482904 18 COSMIC
COSN30473062 27 COSMIC
COSN18734512 54 COSMIC
COSN30158978 61 COSMIC
COSN30137840 79 COSMIC
COSN30161735 102 COSMIC
COSN29925254 112 COSMIC
COSN30619140 168 COSMIC
COSN31542384 215 COSMIC
COSN31543481 217 COSMIC
COSN1120694 230 COSMIC
COSN31485571 509 COSMIC
COSN31542482 539 COSMIC
COSN31611188 620 COSMIC
COSN31559444 675 COSMIC
COSN31523650 688 COSMIC
COSN10070430 735 COSMIC
COSN31515167 747 COSMIC
COSN31536122 838 COSMIC
COSN30176751 847 COSMIC
COSN1495520 963 COSMIC
COSN21965444 1165 COSMIC
COSN20107120 1299 COSMIC
COSN8640353 1634 COSMIC
COSN20337202 1900 COSMIC
COSN20107122 1911 COSMIC
COSN20107123 1911 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1172497835 1 dbSNP
rs1400739658 6 dbSNP
rs772710774 11 dbSNP
rs1248687123 12 dbSNP
rs747144551 19 dbSNP
rs1298909644 31 dbSNP
rs1360093204 40 dbSNP
rs1398394318 42 dbSNP
rs1463698779 47 dbSNP
rs760115767 47 dbSNP
rs768809006 47 dbSNP
rs1333119309 48 dbSNP
rs1304669896 50 dbSNP
rs1390087118 54 dbSNP
rs148198083 59 dbSNP
rs991139764 60 dbSNP
rs916929934 69 dbSNP
rs370282908 77 dbSNP
rs1388199726 78 dbSNP
rs1046997984 79 dbSNP
rs1323827130 85 dbSNP
rs1404500847 87 dbSNP
rs886937662 97 dbSNP
rs1169466531 98 dbSNP
rs1318527652 103 dbSNP
rs1449978742 104 dbSNP
rs1389538741 107 dbSNP
rs867972508 108 dbSNP
rs1187997901 121 dbSNP
rs1447738264 130 dbSNP
rs1248613181 148 dbSNP
rs1222614605 170 dbSNP
rs373252086 174 dbSNP
rs1288144850 183 dbSNP
rs1207811779 190 dbSNP
rs1038615232 203 dbSNP
rs548865564 207 dbSNP
rs1369137501 217 dbSNP
rs1275038368 223 dbSNP
rs917111499 230 dbSNP
rs949490770 232 dbSNP
rs1357542126 244 dbSNP
rs1430238583 255 dbSNP
rs1383392583 269 dbSNP
rs996679140 273 dbSNP
rs1447679553 275 dbSNP
rs1028975228 280 dbSNP
rs7084674 283 dbSNP
rs1286050272 300 dbSNP
rs902497707 303 dbSNP
rs1000832215 305 dbSNP
rs181991802 332 dbSNP
rs1274494437 334 dbSNP
rs900765643 337 dbSNP
rs996870476 339 dbSNP
rs186600585 346 dbSNP
rs1030490628 350 dbSNP
rs1285150757 351 dbSNP
rs1289836991 362 dbSNP
rs879052303 374 dbSNP
rs955072496 375 dbSNP
rs549342894 379 dbSNP
rs1004619287 381 dbSNP
rs769251670 395 dbSNP
rs1467492538 421 dbSNP
rs781358018 428 dbSNP
rs1359731948 429 dbSNP
rs968036005 438 dbSNP
rs1413982804 441 dbSNP
rs768529681 448 dbSNP
rs1462142135 452 dbSNP
rs1473102968 455 dbSNP
rs1251510098 457 dbSNP
rs1185916765 476 dbSNP
rs963010995 488 dbSNP
rs1238620766 492 dbSNP
rs1208731293 506 dbSNP
rs1366241768 508 dbSNP
rs748542614 510 dbSNP
rs776317459 511 dbSNP
rs1158840580 513 dbSNP
rs1409697594 538 dbSNP
rs1294527384 546 dbSNP
rs756232271 554 dbSNP
rs747913926 570 dbSNP
rs1397635175 572 dbSNP
rs927158352 576 dbSNP
rs958649725 594 dbSNP
rs916898620 595 dbSNP
rs1447329723 596 dbSNP
rs993189572 597 dbSNP
rs1158112214 599 dbSNP
rs776473103 604 dbSNP
rs1161518410 605 dbSNP
rs1457949001 614 dbSNP
rs570943534 619 dbSNP
rs1157365267 621 dbSNP
rs917077449 623 dbSNP
rs769348561 628 dbSNP
rs1181811876 637 dbSNP
rs530982718 645 dbSNP
rs1042423090 656 dbSNP
rs549865293 656 dbSNP
rs924033725 659 dbSNP
rs1208860763 668 dbSNP
rs936633833 678 dbSNP
rs1447372306 694 dbSNP
rs1240698190 698 dbSNP
rs1280429404 701 dbSNP
rs568099665 718 dbSNP
rs900535094 720 dbSNP
rs1322629544 721 dbSNP
rs996429391 737 dbSNP
rs565641656 745 dbSNP
rs775049500 750 dbSNP
rs932067969 763 dbSNP
rs1287346168 765 dbSNP
rs1005475875 768 dbSNP
rs890458131 770 dbSNP
rs61873956 777 dbSNP
rs1014648004 798 dbSNP
rs1181862167 810 dbSNP
rs1234300414 811 dbSNP
rs1188571292 820 dbSNP
rs1448364056 829 dbSNP
rs1245768184 830 dbSNP
rs898918286 833 dbSNP
rs1211302116 847 dbSNP
rs759243334 848 dbSNP
rs1471418097 855 dbSNP
rs903404603 862 dbSNP
rs1298246260 863 dbSNP
rs80063617 863 dbSNP
rs1034011287 870 dbSNP
rs555220192 879 dbSNP
rs576784633 882 dbSNP
rs768029444 892 dbSNP
rs1293649590 904 dbSNP
rs1170809272 914 dbSNP
rs147327223 924 dbSNP
rs1368632829 929 dbSNP
rs1293289352 950 dbSNP
rs1414019903 956 dbSNP
rs1423136046 972 dbSNP
rs1372888247 974 dbSNP
rs1024050297 975 dbSNP
rs191916374 976 dbSNP
rs977226415 982 dbSNP
rs982381237 985 dbSNP
rs925827314 991 dbSNP
rs377110500 998 dbSNP
rs1266319230 999 dbSNP
rs1196931924 1004 dbSNP
rs936750046 1005 dbSNP
rs547114974 1009 dbSNP
rs1204385705 1017 dbSNP
rs974420639 1018 dbSNP
rs1249664138 1028 dbSNP
rs1346557960 1045 dbSNP
rs1235583575 1057 dbSNP
rs182795262 1061 dbSNP
rs1300863880 1062 dbSNP
rs932511152 1077 dbSNP
rs1352750251 1081 dbSNP
rs1309065984 1085 dbSNP
rs1050917923 1086 dbSNP
rs1395044763 1089 dbSNP
rs911943817 1103 dbSNP
rs541068599 1105 dbSNP
rs1466105229 1113 dbSNP
rs921936462 1122 dbSNP
rs141070107 1124 dbSNP
rs1376653943 1125 dbSNP
rs944785447 1126 dbSNP
rs760481343 1133 dbSNP
rs1473425617 1137 dbSNP
rs1196834251 1139 dbSNP
rs1276193464 1143 dbSNP
rs931994951 1154 dbSNP
rs1252231643 1161 dbSNP
rs1051994966 1162 dbSNP
rs1481747910 1167 dbSNP
rs1258259095 1171 dbSNP
rs1202192358 1172 dbSNP
rs1345834018 1179 dbSNP
rs1255589037 1180 dbSNP
rs890711554 1193 dbSNP
rs903205216 1195 dbSNP
rs1481334160 1197 dbSNP
rs929009872 1199 dbSNP
rs373540346 1209 dbSNP
rs1000437565 1211 dbSNP
rs1055147950 1213 dbSNP
rs1036532430 1214 dbSNP
rs1377052486 1226 dbSNP
rs1051667658 1230 dbSNP
rs894642954 1246 dbSNP
rs1169539210 1254 dbSNP
rs1372498255 1256 dbSNP
rs542778950 1265 dbSNP
rs1468422535 1269 dbSNP
rs568615709 1270 dbSNP
rs1370069655 1284 dbSNP
rs1441812031 1284 dbSNP
rs201608334 1284 dbSNP
rs551129912 1284 dbSNP
rs899367504 1285 dbSNP
rs1201917204 1290 dbSNP
rs1466422976 1297 dbSNP
rs199940686 1299 dbSNP
rs77754511 1300 dbSNP
rs1307727787 1303 dbSNP
rs994577206 1304 dbSNP
rs1246123905 1316 dbSNP
rs1388935064 1320 dbSNP
rs1299668011 1322 dbSNP
rs1330843794 1327 dbSNP
rs1228796092 1328 dbSNP
rs560776908 1332 dbSNP
rs1436729055 1344 dbSNP
rs1003937324 1350 dbSNP
rs1319500495 1351 dbSNP
rs1034125591 1362 dbSNP
rs1015241844 1363 dbSNP
rs531486389 1368 dbSNP
rs894111250 1384 dbSNP
rs1014343474 1388 dbSNP
rs549704112 1391 dbSNP
rs1300372660 1393 dbSNP
rs570908630 1395 dbSNP
rs532085335 1399 dbSNP
rs967695541 1411 dbSNP
rs977342288 1435 dbSNP
rs1248821851 1437 dbSNP
rs537519102 1440 dbSNP
rs1292439500 1449 dbSNP
rs1210870733 1450 dbSNP
rs1359343043 1451 dbSNP
rs1290223752 1457 dbSNP
rs962721455 1465 dbSNP
rs1292103287 1467 dbSNP
rs974014312 1476 dbSNP
rs1489246163 1481 dbSNP
rs1332524175 1486 dbSNP
rs957224400 1487 dbSNP
rs989498432 1488 dbSNP
rs1170434130 1489 dbSNP
rs986602514 1489 dbSNP
rs890385460 1500 dbSNP
rs1431658384 1511 dbSNP
rs188463014 1512 dbSNP
rs565636586 1514 dbSNP
rs1186050528 1519 dbSNP
rs912416230 1522 dbSNP
rs756487920 1527 dbSNP
rs1248740107 1528 dbSNP
rs1199944379 1532 dbSNP
rs1156908263 1538 dbSNP
rs1190453905 1541 dbSNP
rs1388237523 1544 dbSNP
rs189686707 1558 dbSNP
rs555181388 1570 dbSNP
rs1207880920 1575 dbSNP
rs1168009030 1577 dbSNP
rs370871492 1593 dbSNP
rs1385887199 1594 dbSNP
rs911936485 1603 dbSNP
rs940917223 1618 dbSNP
rs1459666005 1619 dbSNP
rs1291935378 1620 dbSNP
rs1042220691 1622 dbSNP
rs1343439933 1626 dbSNP
rs570298183 1628 dbSNP
rs1383114182 1635 dbSNP
rs1410333676 1636 dbSNP
rs764123957 1652 dbSNP
rs936040812 1652 dbSNP
rs1054465946 1664 dbSNP
rs899314972 1668 dbSNP
rs1227097617 1669 dbSNP
rs1315169162 1671 dbSNP
rs1013137023 1672 dbSNP
rs1322961315 1677 dbSNP
rs1184862389 1681 dbSNP
rs930819278 1681 dbSNP
rs1242170328 1706 dbSNP
rs1045854186 1707 dbSNP
rs34913574 1709 dbSNP
rs182319673 1716 dbSNP
rs1055513353 1719 dbSNP
rs1443669096 1736 dbSNP
rs1486107369 1738 dbSNP
rs894217849 1741 dbSNP
rs1246164095 1744 dbSNP
rs1221538557 1754 dbSNP
rs370240419 1754 dbSNP
rs1014042216 1759 dbSNP
rs1184082242 1760 dbSNP
rs1228847439 1779 dbSNP
rs764287900 1782 dbSNP
rs1256956466 1785 dbSNP
rs1296396224 1787 dbSNP
rs902885287 1790 dbSNP
rs1163018136 1793 dbSNP
rs559245616 1798 dbSNP
rs1469471383 1809 dbSNP
rs539755912 1811 dbSNP
rs1161747330 1819 dbSNP
rs995546922 1820 dbSNP
rs1028001429 1826 dbSNP
rs1407835878 1827 dbSNP
rs1176022341 1830 dbSNP
rs1484546568 1842 dbSNP
rs1237525550 1866 dbSNP
rs1202545937 1867 dbSNP
rs1459695202 1868 dbSNP
rs1209056434 1883 dbSNP
rs186722228 1883 dbSNP
rs1316144508 1895 dbSNP
rs1161798274 1898 dbSNP
rs11336978 1899 dbSNP
rs1157434611 1899 dbSNP
rs1315818017 1899 dbSNP
rs1491297020 1899 dbSNP
rs199684702 1899 dbSNP
rs1491445202 1900 dbSNP
rs200229315 1900 dbSNP
rs1415238076 1901 dbSNP
rs1182368430 1902 dbSNP
rs957173448 1903 dbSNP
rs1249448486 1908 dbSNP
rs1435053582 1909 dbSNP
rs1337892777 1910 dbSNP
rs1376548354 1911 dbSNP
rs553113525 1911 dbSNP
rs78097569 1912 dbSNP
rs1290967384 1914 dbSNP
rs558051759 1915 dbSNP
rs924653018 1919 dbSNP
rs1382964345 1924 dbSNP
rs953584542 1926 dbSNP
rs1287478175 1931 dbSNP
rs1459770644 1934 dbSNP
rs1317112227 1942 dbSNP
rs1163529558 1947 dbSNP
rs1229794126 1952 dbSNP
rs990530013 1953 dbSNP
rs1193352547 1957 dbSNP
rs987609512 1958 dbSNP
rs778983834 1961 dbSNP
rs1204233332 1965 dbSNP
rs1257675237 1967 dbSNP
rs1484315511 1971 dbSNP
rs911870448 1972 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 7321.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ccucUUCUAACGUC-UCAUUUAa 5'
              || |||  || ||||||| 
Target 5' uuucAACAUU--AGCAGUAAAUu 3'
 		5 - 25
Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM4903834
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_b
Location of target site NM_001204880 | 3UTR | AAAUCUAGGUUUUUUUCAACAUUAGCAGUAAAUUGAGCACUGUUUACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000373910.4 | 3UTR | UUUUUUUCAACAUUAGCAGUAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000373910.4 | 3UTR | UUUUUUUCAACAUUAGCAGUAAAUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
88 hsa-miR-4699-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT056239 RAB18 RAB18, member RAS oncogene family 2 2
MIRT080536 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 2 2
MIRT095600 NR3C1 nuclear receptor subfamily 3 group C member 1 2 2
MIRT128911 KMT2A lysine methyltransferase 2A 2 2
MIRT161904 FXR1 FMR1 autosomal homolog 1 2 4
MIRT177614 UBE2D1 ubiquitin conjugating enzyme E2 D1 2 4
MIRT231364 EDEM3 ER degradation enhancing alpha-mannosidase like protein 3 2 6
MIRT285164 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT307337 SEC22C SEC22 homolog C, vesicle trafficking protein 2 2
MIRT317083 DEK DEK proto-oncogene 2 2
MIRT347692 LSM14A LSM14A, mRNA processing body assembly factor 2 2
MIRT358438 STC2 stanniocalcin 2 2 2
MIRT362592 PURB purine rich element binding protein B 2 4
MIRT441441 HAVCR1 hepatitis A virus cellular receptor 1 2 2
MIRT445264 LOH12CR2 loss of heterozygosity, 12, chromosomal region 2 (non-protein coding) 2 4
MIRT447097 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 2 2
MIRT449013 ANKRD17 ankyrin repeat domain 17 2 2
MIRT450358 SETD9 SET domain containing 9 2 2
MIRT454976 MYC MYC proto-oncogene, bHLH transcription factor 2 2
MIRT461922 NECAB3 N-terminal EF-hand calcium binding protein 3 2 2
MIRT465191 TRPS1 transcriptional repressor GATA binding 1 2 2
MIRT467685 SLC38A2 solute carrier family 38 member 2 2 4
MIRT468003 SKI SKI proto-oncogene 2 2
MIRT473127 MLLT10 MLLT10, histone lysine methyltransferase DOT1L cofactor 2 2
MIRT476370 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT477067 FAM208B family with sequence similarity 208 member B 2 4
MIRT479950 CBX4 chromobox 4 2 4
MIRT481092 B3GNT2 UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2 2 2
MIRT481932 ANKRD11 ankyrin repeat domain 11 2 12
MIRT482239 AHCY adenosylhomocysteinase 2 2
MIRT485804 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT492026 TWF1 twinfilin actin binding protein 1 2 2
MIRT494389 CALM3 calmodulin 3 2 2
MIRT504115 GPR158 G protein-coupled receptor 158 2 2
MIRT506346 NUP54 nucleoporin 54 2 4
MIRT510081 PPWD1 peptidylprolyl isomerase domain and WD repeat containing 1 2 4
MIRT521019 SLC8A1 solute carrier family 8 member A1 2 2
MIRT524709 BTBD3 BTB domain containing 3 2 2
MIRT524989 AGO2 argonaute 2, RISC catalytic component 2 6
MIRT525003 ACVR1B activin A receptor type 1B 2 2
MIRT528064 OLAH oleoyl-ACP hydrolase 2 2
MIRT528865 C1orf147 chromosome 1 open reading frame 147 2 2
MIRT532182 DOCK7 dedicator of cytokinesis 7 2 2
MIRT533592 TOB1 transducer of ERBB2, 1 2 6
MIRT538835 C16orf70 chromosome 16 open reading frame 70 2 2
MIRT539488 ACVR1C activin A receptor type 1C 2 2
MIRT539542 ABCD2 ATP binding cassette subfamily D member 2 2 2
MIRT542123 VENTX VENT homeobox 2 2
MIRT542993 ELOVL5 ELOVL fatty acid elongase 5 2 2
MIRT543067 ATXN7L3B ataxin 7 like 3B 2 2
MIRT543370 CYB5B cytochrome b5 type B 2 2
MIRT545080 TSEN34 tRNA splicing endonuclease subunit 34 2 2
MIRT545258 TRIM36 tripartite motif containing 36 2 4
MIRT549144 BRIX1 BRX1, biogenesis of ribosomes 2 2
MIRT549403 AKAP1 A-kinase anchoring protein 1 2 2
MIRT552143 MRPL34 mitochondrial ribosomal protein L34 2 2
MIRT554781 RHEBP1 RHEB pseudogene 1 2 4
MIRT555991 NFYB nuclear transcription factor Y subunit beta 2 2
MIRT556425 LONRF3 LON peptidase N-terminal domain and ring finger 3 2 2
MIRT558325 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 4
MIRT561357 YWHAH tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta 2 2
MIRT562240 HMGB1 high mobility group box 1 2 2
MIRT562269 GOLT1B golgi transport 1B 2 2
MIRT564020 FAM103A1 family with sequence similarity 103 member A1 2 2
MIRT564832 ZBTB16 zinc finger and BTB domain containing 16 2 2
MIRT565350 TMED2 transmembrane p24 trafficking protein 2 2 2
MIRT565678 SET SET nuclear proto-oncogene 2 2
MIRT576547 Txlna taxilin alpha 2 2
MIRT609358 ZNF664 zinc finger protein 664 2 2
MIRT610646 CTGF connective tissue growth factor 2 2
MIRT624681 ARAP2 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 2 2
MIRT637118 AGTPBP1 ATP/GTP binding protein 1 2 2
MIRT639955 PRRC2B proline rich coiled-coil 2B 2 2
MIRT644051 WWC2 WW and C2 domain containing 2 2 2
MIRT650463 SLC35B1 solute carrier family 35 member B1 2 2
MIRT651094 ZNF516 zinc finger protein 516 2 2
MIRT655268 PER2 period circadian clock 2 2 2
MIRT657450 HEYL hes related family bHLH transcription factor with YRPW motif-like 2 2
MIRT692248 POLR3F RNA polymerase III subunit F 2 2
MIRT695239 PBK PDZ binding kinase 2 2
MIRT696024 NDUFS3 NADH:ubiquinone oxidoreductase core subunit S3 2 2
MIRT698486 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT700581 PRSS22 protease, serine 22 2 2
MIRT704540 CNEP1R1 CTD nuclear envelope phosphatase 1 regulatory subunit 1 2 2
MIRT704723 CEP135 centrosomal protein 135 2 2
MIRT705194 BTG1 BTG anti-proliferation factor 1 2 2
MIRT710286 CSNK1G3 casein kinase 1 gamma 3 2 2
MIRT719623 TUBGCP3 tubulin gamma complex associated protein 3 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4699 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-miR-4699-3p Docetaxel+Cisplatin+5-Fluorouracil resistant tissue (hypopharyngeal squamous cell carcinoma)

Error report submission