pre-miRNA Information | |
---|---|
pre-miRNA | hsa-mir-548am |
Genomic Coordinates | chrX: 16627012 - 16627085 |
Description | Homo sapiens miR-548am stem-loop |
Comment | None |
RNA Secondary Structure |
Mature miRNA Information | |||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Mature miRNA | hsa-miR-548am-5p | ||||||||||||||||||||||||||||
Sequence | 10| AAAAGUAAUUGCGGUUUUUGCC |31 | ||||||||||||||||||||||||||||
Evidence | Not_experimental | ||||||||||||||||||||||||||||
Experiments | |||||||||||||||||||||||||||||
Editing Events in miRNAs |
|
||||||||||||||||||||||||||||
SNPs in miRNA |
|
||||||||||||||||||||||||||||
Putative Targets |
miRNA Expression profile | |
---|---|
Human miRNA Tissue Atlas | |
miRNAs in Extracellular Vesicles |
|
Circulating MicroRNA Expression Profiling |
Gene Information | |||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Gene Symbol | UBE2D1 | ||||||||||||||||||||
Synonyms | E2(17)KB1, SFT, UBC4/5, UBCH5, UBCH5A | ||||||||||||||||||||
Description | ubiquitin conjugating enzyme E2 D1 | ||||||||||||||||||||
Transcript | NM_003338 | ||||||||||||||||||||
Expression | |||||||||||||||||||||
Putative miRNA Targets on UBE2D1 | |||||||||||||||||||||
3'UTR of UBE2D1 (miRNA target sites are highlighted) |
>UBE2D1|NM_003338|3'UTR 1 AAATCAAAAACATTTTCATATATACCAGAGTACTGTAAAATCTAGGTTTTTTTCAACATTAGCAGTAAATTGAGCACTGT 81 TTACTGTTTCATTGTACCATGAAACCATTTGATTTTTACCCATTTTAAATGTGTTTCTGAAGCAAGACAAAACAAACTTC 161 CAAAAATACCCTTAAGACTGTGATGAGAGCATTTATCATTTTGTATGCATTGAGAAAGACATTTATTATGGTTTTTAAGA 241 TACTTGGACATCTGCATCTTCAGCTTACAAGATCTACAATGCAGCTGAAAAGCAACCAAATTATTTTTTGCTGAAACTAG 321 ATGTTTTTACATGAGAAATACTGTATGTGTTGTCTAAGATGTCAGTTTTATAAATCTGTATTCAGATTTCATTCTTTGTT 401 AGCTCACTTTATAATTTGTATTTTTTTACTGTATAGACTAAATATATTCTATTTACATGTATGTCAACTCATTACTTTTT 481 TCCTGTGAACAGTATTGAAAAACCCCAACGGCTGATAATTAAGTGAATTAACTGTGTCTCCCTTGTCTTAGGATATTCTG 561 TAGATTGATTGCAGATTTCTTAAATCTGAAATGATCTTTACACTGTAATTCTCAGCATACTGATTATGGAGAAACACTTG 641 TTTTGATTTTGTTATACTTGACTTAACTTTATTGCAATGTGAATTAATTGCACTGCTAAGTAGGAAGATGTGTAACTTTT 721 ATTTGTTGCTATTCACATTTGAATTTTTTCCTGTATAGGCAATATTATATTGACACCTTTTACAGATCTTACTGTAGCTT 801 TTTCCATATAAATAAAATGCTTTTTCTACTATTTGTCTTGATTACTTAAAAAAATAAAAATATAAGTAAGGATCAAAACT 881 CTAAAATTTTGCATGAAAATTACATCCAAATTGTGAAAATCAGATCTATTTTGTTTGCCATTAGTCACCATTAGTTATAT 961 AAATTTTATTGTTTTAGGTTAGTATCTCTTTACTAAATTGTCAGTCTATAAGATAATATATGTTGATCCCTTGCTGTAGA 1041 GGAGAATTTAGAGTAATTTGGGGTTTGTCTTGGATTATATCTAAATGGATTATTTGTTAAAAGTACTGAAATGAGTATAA 1121 GGCAGTATCACCCATCCAAAAGAAAGGTCTTTATAGACCTGCACAGTCACTAGATTAATTCATTAAAATGCCCCCACCCT 1201 GATGTAATTGACATTACATTTCTTAACATTTTAAAATCTAGAATTTCTAAAATGGAATTTAATGCCATCACAATTTGAAA 1281 AACTTTTTTTTTTTTTTTACTATAGAAGTTACAAAGGAAGTTCTAAAATTATGCCTCCCTCTGTTTTTATAAGTTGCCAT 1361 CGAAAAGTGATTTAAATAAGCAGGTTATCTTTATAGATTTTAAAGAAAACTAGAAAGTTTTAATGTTTTAACTTGGGGAA 1441 AAATACATCTCTTTAATGTTTAGCATGCTTGTCAACCTTGAGTGAGTGTCATTTTTAAGAACAGTTGTAGCCCTTCTGAT 1521 TATTGCAGTAGCTGTAGAAGTATGTAAGAATATGTGATGGGTGTAGTCATTAGCAAAGCATTTAAATCACTTGAGTATTT 1601 TGTCATGGTTCATTATTATTAAAGCACAAAATAACCTATTGTTAGAAAATATGTGTTTTTATAAATGAATGTAAAATAAT 1681 TAAATGAATTGTGAAATGGATGTTTAAGAAAATATAGGCTTAAAAAGTAAATCTATAAAATGATGTCTTAAAACAGCCAT 1761 ATCATGAAAAATTCTACTTAGCTATATTATTATAAGCTACATTTGCCCTGAATTTGAACACTCAACATCACTAGATTTAA 1841 ATATTTAGTATATTTTGATAGTAAAGGGTTTTGTTTCTTGAATATCTTCACTTTAAACAAAAAAAAAAAACAACTTTCAT 1921 TTGTGTGGCATTTATTTTTGGAAGTGTCTTCTTTTTTTTCTTTATTAAAGTTTTTGAAACTTGCCTAAAAAAAAAAAAAA 2001 AAAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
DRVs in gene 3'UTRs | |||||||||||||||||||||
SNPs in gene 3'UTRs |
Experimental Support 1 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
Experimental Support 2 for Functional miRNA-Target Interaction | |||||||
---|---|---|---|---|---|---|---|
miRNA:Target | ---- | ||||||
Validation Method |
|
||||||
Conditions | HEK293 | ||||||
Disease | 7321.0 | ||||||
Location of target site | 3'UTR | ||||||
Tools used in this research | TargetScan , miRTarCLIP , Piranha | ||||||
Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
||||||
miRNA-target interactions (Provided by authors) |
|
||||||
Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
Experimental Support 3 for Functional miRNA-Target Interaction | |
---|---|
miRNA:Target | ---- |
Validation Method |
|
Conditions | MCF7 |
Location of target site | 3'UTR |
Tools used in this research | TargetScan , miRTarCLIP , Piranha |
Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated
... - Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology. |
Article |
- Farazi TA; Ten Hoeve JJ; Brown M; et al. - Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
|
CLIP-seq Support 1 for dataset GSM545216 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / miR-124 transfection |
Location of target site | ENST00000373910.4 | 3UTR | UCAACUCAUUACUUUUUUCCUGUGAAC |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 20371350 / GSE21578 |
CLIP-seq Viewer | Link |
CLIP-seq Support 2 for dataset GSM714644 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | HEK293 / completeT1, repA |
Location of target site | ENST00000373910.4 | 3UTR | UCAACUCAUUACUUUUUUCCUGUGAACAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 21572407 / GSE28865 |
CLIP-seq Viewer | Link |
CLIP-seq Support 3 for dataset SRR1045082 | |
---|---|
Method / RBP | PAR-CLIP / AGO2 |
Cell line / Condition | MCF7 / Untreated |
Location of target site | ENST00000373910.4 | 3UTR | UCAACUCAUUACUUUUUUCCUGUGAACAG |
Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
Article / Accession Series | PMID: 24398324 / SRX388831 |
CLIP-seq Viewer | Link |
MiRNA-Target Expression Profile | |||||||
---|---|---|---|---|---|---|---|
|
MiRNA-Target Expression Profile (TCGA) | |||||||
---|---|---|---|---|---|---|---|
|
184 hsa-miR-548am-5p Target Genes:
Functional analysis:
ID | Target | Description | Validation methods | |||||||||
Strong evidence | Less strong evidence | |||||||||||
MIRT057132 | DDIT4 | DNA damage inducible transcript 4 | 2 | 4 | ||||||||
MIRT063379 | ETNK1 | ethanolamine kinase 1 | 2 | 2 | ||||||||
MIRT072501 | RAB8B | RAB8B, member RAS oncogene family | 2 | 2 | ||||||||
MIRT082193 | ACTN4 | actinin alpha 4 | 2 | 6 | ||||||||
MIRT083043 | PTBP1 | polypyrimidine tract binding protein 1 | 2 | 2 | ||||||||
MIRT085196 | SLC5A3 | solute carrier family 5 member 3 | 2 | 4 | ||||||||
MIRT088913 | FOXN2 | forkhead box N2 | 2 | 4 | ||||||||
MIRT089506 | MTHFD2 | methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase | 2 | 6 | ||||||||
MIRT092047 | ABHD5 | abhydrolase domain containing 5 | 2 | 2 | ||||||||
MIRT094692 | FEM1C | fem-1 homolog C | 2 | 2 | ||||||||
MIRT095403 | UBE2D2 | ubiquitin conjugating enzyme E2 D2 | 2 | 2 | ||||||||
MIRT096509 | BRIX1 | BRX1, biogenesis of ribosomes | 2 | 2 | ||||||||
MIRT101303 | FAM135A | family with sequence similarity 135 member A | 2 | 2 | ||||||||
MIRT103366 | CBX3 | chromobox 3 | 2 | 2 | ||||||||
MIRT103883 | FOXK1 | forkhead box K1 | 2 | 2 | ||||||||
MIRT104343 | CLDN12 | claudin 12 | 2 | 2 | ||||||||
MIRT104508 | PEG10 | paternally expressed 10 | 2 | 6 | ||||||||
MIRT111808 | MPZL1 | myelin protein zero like 1 | 2 | 2 | ||||||||
MIRT177246 | BMI1 | BMI1 proto-oncogene, polycomb ring finger | 2 | 2 | ||||||||
MIRT177281 | COMMD3-BMI1 | COMMD3-BMI1 readthrough | 2 | 2 | ||||||||
MIRT177633 | UBE2D1 | ubiquitin conjugating enzyme E2 D1 | 2 | 6 | ||||||||
MIRT178049 | SAMD8 | sterile alpha motif domain containing 8 | 2 | 2 | ||||||||
MIRT179109 | PAFAH1B2 | platelet activating factor acetylhydrolase 1b catalytic subunit 2 | 2 | 6 | ||||||||
MIRT179594 | CAPZA1 | capping actin protein of muscle Z-line alpha subunit 1 | 2 | 6 | ||||||||
MIRT195307 | LEPROT | leptin receptor overlapping transcript | 2 | 2 | ||||||||
MIRT203152 | BACH1 | BTB domain and CNC homolog 1 | 2 | 2 | ||||||||
MIRT208437 | ZBTB38 | zinc finger and BTB domain containing 38 | 2 | 2 | ||||||||
MIRT214585 | SMAD5 | SMAD family member 5 | 2 | 4 | ||||||||
MIRT216112 | IL6ST | interleukin 6 signal transducer | 2 | 2 | ||||||||
MIRT216363 | CCNB1 | cyclin B1 | 2 | 4 | ||||||||
MIRT220059 | MDFIC | MyoD family inhibitor domain containing | 2 | 2 | ||||||||
MIRT226737 | ANP32B | acidic nuclear phosphoprotein 32 family member B | 2 | 4 | ||||||||
MIRT227706 | TBC1D13 | TBC1 domain family member 13 | 2 | 2 | ||||||||
MIRT230079 | SH3BGRL | SH3 domain binding glutamate rich protein like | 2 | 2 | ||||||||
MIRT248644 | HMGN2 | high mobility group nucleosomal binding domain 2 | 2 | 4 | ||||||||
MIRT254799 | XRCC6 | X-ray repair cross complementing 6 | 2 | 6 | ||||||||
MIRT264388 | YAP1 | Yes associated protein 1 | 2 | 2 | ||||||||
MIRT266982 | LRRC55 | leucine rich repeat containing 55 | 2 | 4 | ||||||||
MIRT273957 | SPRYD4 | SPRY domain containing 4 | 2 | 2 | ||||||||
MIRT281809 | MAP2K1 | mitogen-activated protein kinase kinase 1 | 2 | 2 | ||||||||
MIRT293262 | DR1 | down-regulator of transcription 1 | 2 | 2 | ||||||||
MIRT297105 | RGPD4 | RANBP2-like and GRIP domain containing 4 | 2 | 2 | ||||||||
MIRT308178 | PDE12 | phosphodiesterase 12 | 2 | 2 | ||||||||
MIRT309022 | USP53 | ubiquitin specific peptidase 53 | 2 | 2 | ||||||||
MIRT311477 | PRRC1 | proline rich coiled-coil 1 | 2 | 2 | ||||||||
MIRT312595 | G3BP1 | G3BP stress granule assembly factor 1 | 2 | 4 | ||||||||
MIRT328137 | ZNF711 | zinc finger protein 711 | 2 | 2 | ||||||||
MIRT329321 | FAM53C | family with sequence similarity 53 member C | 2 | 2 | ||||||||
MIRT334649 | NEK7 | NIMA related kinase 7 | 2 | 2 | ||||||||
MIRT340680 | THRAP3 | thyroid hormone receptor associated protein 3 | 2 | 2 | ||||||||
MIRT378865 | ITGB8 | integrin subunit beta 8 | 2 | 2 | ||||||||
MIRT395798 | SPCS3 | signal peptidase complex subunit 3 | 2 | 2 | ||||||||
MIRT405648 | WBP4 | WW domain binding protein 4 | 2 | 4 | ||||||||
MIRT408294 | GRPEL2 | GrpE like 2, mitochondrial | 2 | 2 | ||||||||
MIRT442112 | ZNRF2 | zinc and ring finger 2 | 2 | 8 | ||||||||
MIRT442855 | GTF2H5 | general transcription factor IIH subunit 5 | 2 | 2 | ||||||||
MIRT443131 | VLDLR | very low density lipoprotein receptor | 2 | 2 | ||||||||
MIRT443162 | ZDHHC21 | zinc finger DHHC-type containing 21 | 2 | 2 | ||||||||
MIRT443313 | PRPS1L1 | phosphoribosyl pyrophosphate synthetase 1-like 1 | 2 | 2 | ||||||||
MIRT445095 | ZNF207 | zinc finger protein 207 | 2 | 2 | ||||||||
MIRT445399 | PTCHD1 | patched domain containing 1 | 2 | 4 | ||||||||
MIRT447085 | MCC | mutated in colorectal cancers | 2 | 2 | ||||||||
MIRT447315 | ZNF562 | zinc finger protein 562 | 2 | 2 | ||||||||
MIRT447528 | MRPS5 | mitochondrial ribosomal protein S5 | 2 | 2 | ||||||||
MIRT449526 | TM6SF1 | transmembrane 6 superfamily member 1 | 2 | 2 | ||||||||
MIRT449917 | C11orf34 | placenta expressed transcript 1 | 1 | 2 | ||||||||
MIRT450566 | SHFM1 | SEM1, 26S proteasome complex subunit | 2 | 2 | ||||||||
MIRT450734 | PVRL3 | nectin cell adhesion molecule 3 | 2 | 2 | ||||||||
MIRT454938 | ANKEF1 | ankyrin repeat and EF-hand domain containing 1 | 2 | 12 | ||||||||
MIRT455907 | KIF2C | kinesin family member 2C | 2 | 2 | ||||||||
MIRT463747 | YWHAE | tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon | 2 | 8 | ||||||||
MIRT471197 | PHB2 | prohibitin 2 | 2 | 2 | ||||||||
MIRT472779 | MTMR6 | myotubularin related protein 6 | 2 | 8 | ||||||||
MIRT474472 | KLHL11 | kelch like family member 11 | 2 | 8 | ||||||||
MIRT476000 | GTPBP2 | GTP binding protein 2 | 2 | 2 | ||||||||
MIRT482291 | AGO2 | argonaute 2, RISC catalytic component | 2 | 4 | ||||||||
MIRT485873 | ALG9 | ALG9, alpha-1,2-mannosyltransferase | 2 | 2 | ||||||||
MIRT486207 | ERH | ERH, mRNA splicing and mitosis factor | 2 | 4 | ||||||||
MIRT488624 | FAM3C | family with sequence similarity 3 member C | 2 | 6 | ||||||||
MIRT489999 | DDB1 | damage specific DNA binding protein 1 | 2 | 2 | ||||||||
MIRT493491 | IPMK | inositol polyphosphate multikinase | 2 | 2 | ||||||||
MIRT494295 | CEP120 | centrosomal protein 120 | 2 | 2 | ||||||||
MIRT498007 | ZBTB20 | zinc finger and BTB domain containing 20 | 2 | 2 | ||||||||
MIRT498488 | PTBP2 | polypyrimidine tract binding protein 2 | 2 | 10 | ||||||||
MIRT498575 | TMEM30B | transmembrane protein 30B | 2 | 2 | ||||||||
MIRT499882 | SVOP | SV2 related protein | 2 | 10 | ||||||||
MIRT500235 | INHBA | inhibin beta A subunit | 2 | 10 | ||||||||
MIRT500709 | TRIM37 | tripartite motif containing 37 | 2 | 2 | ||||||||
MIRT501003 | SPPL2A | signal peptide peptidase like 2A | 2 | 4 | ||||||||
MIRT501038 | SMG1 | SMG1, nonsense mediated mRNA decay associated PI3K related kinase | 2 | 6 | ||||||||
MIRT502751 | CLIP1 | CAP-Gly domain containing linker protein 1 | 2 | 8 | ||||||||
MIRT502813 | CELSR3 | cadherin EGF LAG seven-pass G-type receptor 3 | 2 | 6 | ||||||||
MIRT502903 | CDK4 | cyclin dependent kinase 4 | 2 | 8 | ||||||||
MIRT503498 | ZNF154 | zinc finger protein 154 | 2 | 6 | ||||||||
MIRT503732 | GRM5 | glutamate metabotropic receptor 5 | 2 | 2 | ||||||||
MIRT505152 | YOD1 | YOD1 deubiquitinase | 2 | 2 | ||||||||
MIRT505817 | RSBN1 | round spermatid basic protein 1 | 2 | 8 | ||||||||
MIRT505856 | POLR1B | RNA polymerase I subunit B | 2 | 4 | ||||||||
MIRT509299 | NPM3 | nucleophosmin/nucleoplasmin 3 | 2 | 6 | ||||||||
MIRT516844 | CYP20A1 | cytochrome P450 family 20 subfamily A member 1 | 2 | 2 | ||||||||
MIRT520534 | TRA2B | transformer 2 beta homolog | 2 | 2 | ||||||||
MIRT520738 | TM9SF3 | transmembrane 9 superfamily member 3 | 2 | 6 | ||||||||
MIRT525418 | SHISA9 | shisa family member 9 | 2 | 4 | ||||||||
MIRT525882 | ARL13B | ADP ribosylation factor like GTPase 13B | 2 | 2 | ||||||||
MIRT526028 | RBM4B | RNA binding motif protein 4B | 2 | 2 | ||||||||
MIRT526099 | TMEM41B | transmembrane protein 41B | 2 | 2 | ||||||||
MIRT527946 | FRY | FRY microtubule binding protein | 2 | 2 | ||||||||
MIRT528833 | RAB32 | RAB32, member RAS oncogene family | 2 | 2 | ||||||||
MIRT531077 | SLC9A4 | solute carrier family 9 member A4 | 2 | 4 | ||||||||
MIRT535510 | PANX1 | pannexin 1 | 2 | 2 | ||||||||
MIRT536697 | IKZF5 | IKAROS family zinc finger 5 | 2 | 2 | ||||||||
MIRT536850 | HMBOX1 | homeobox containing 1 | 2 | 2 | ||||||||
MIRT537217 | GDE1 | glycerophosphodiester phosphodiesterase 1 | 2 | 4 | ||||||||
MIRT537849 | EFNA5 | ephrin A5 | 2 | 2 | ||||||||
MIRT538360 | CSE1L | chromosome segregation 1 like | 2 | 4 | ||||||||
MIRT541257 | GPC4 | glypican 4 | 2 | 2 | ||||||||
MIRT543250 | PEX7 | peroxisomal biogenesis factor 7 | 2 | 2 | ||||||||
MIRT543465 | PARP15 | poly(ADP-ribose) polymerase family member 15 | 2 | 2 | ||||||||
MIRT543726 | XKR9 | XK related 9 | 2 | 2 | ||||||||
MIRT543922 | ESYT1 | extended synaptotagmin 1 | 2 | 2 | ||||||||
MIRT544014 | KLRC3 | killer cell lectin like receptor C3 | 2 | 2 | ||||||||
MIRT544085 | METTL8 | methyltransferase like 8 | 2 | 2 | ||||||||
MIRT544202 | ANGPTL3 | angiopoietin like 3 | 2 | 2 | ||||||||
MIRT544823 | ACSM2B | acyl-CoA synthetase medium chain family member 2B | 2 | 2 | ||||||||
MIRT545061 | PRELID1 | PRELI domain containing 1 | 2 | 2 | ||||||||
MIRT545229 | HIST1H2BD | histone cluster 1 H2B family member d | 2 | 2 | ||||||||
MIRT545304 | SPC25 | SPC25, NDC80 kinetochore complex component | 2 | 2 | ||||||||
MIRT545565 | GIMAP4 | GTPase, IMAP family member 4 | 2 | 2 | ||||||||
MIRT546512 | SIK1 | salt inducible kinase 1 | 2 | 2 | ||||||||
MIRT546929 | PTP4A1 | protein tyrosine phosphatase type IVA, member 1 | 2 | 2 | ||||||||
MIRT547690 | KPNA1 | karyopherin subunit alpha 1 | 2 | 4 | ||||||||
MIRT547783 | KATNAL1 | katanin catalytic subunit A1 like 1 | 2 | 2 | ||||||||
MIRT548702 | CRNKL1 | crooked neck pre-mRNA splicing factor 1 | 2 | 2 | ||||||||
MIRT548916 | CHEK2 | checkpoint kinase 2 | 2 | 4 | ||||||||
MIRT549972 | RPL7L1 | ribosomal protein L7 like 1 | 2 | 4 | ||||||||
MIRT550504 | TMEM241 | transmembrane protein 241 | 2 | 2 | ||||||||
MIRT551064 | MKLN1 | muskelin 1 | 2 | 2 | ||||||||
MIRT552826 | XIAP | X-linked inhibitor of apoptosis | 2 | 4 | ||||||||
MIRT553160 | UBE2H | ubiquitin conjugating enzyme E2 H | 2 | 2 | ||||||||
MIRT553845 | SYNCRIP | synaptotagmin binding cytoplasmic RNA interacting protein | 2 | 2 | ||||||||
MIRT554273 | SIX4 | SIX homeobox 4 | 2 | 2 | ||||||||
MIRT555796 | PCMTD1 | protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 | 2 | 2 | ||||||||
MIRT556333 | MAP2K4 | mitogen-activated protein kinase kinase 4 | 2 | 2 | ||||||||
MIRT556514 | LIPA | lipase A, lysosomal acid type | 2 | 2 | ||||||||
MIRT556708 | KLHL28 | kelch like family member 28 | 2 | 2 | ||||||||
MIRT556767 | KLF7 | Kruppel like factor 7 | 2 | 2 | ||||||||
MIRT557005 | HPRT1 | hypoxanthine phosphoribosyltransferase 1 | 2 | 2 | ||||||||
MIRT557161 | HOXA13 | homeobox A13 | 2 | 2 | ||||||||
MIRT557502 | GPR27 | G protein-coupled receptor 27 | 2 | 4 | ||||||||
MIRT558117 | ENPP5 | ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) | 2 | 2 | ||||||||
MIRT559359 | ATP5G3 | ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) | 2 | 2 | ||||||||
MIRT560350 | ZWINT | ZW10 interacting kinetochore protein | 2 | 2 | ||||||||
MIRT561314 | ZBTB43 | zinc finger and BTB domain containing 43 | 2 | 2 | ||||||||
MIRT561898 | MSANTD4 | Myb/SANT DNA binding domain containing 4 with coiled-coils | 2 | 2 | ||||||||
MIRT561942 | MFSD9 | major facilitator superfamily domain containing 9 | 2 | 2 | ||||||||
MIRT562950 | TNIP2 | TNFAIP3 interacting protein 2 | 2 | 2 | ||||||||
MIRT563306 | BBS10 | Bardet-Biedl syndrome 10 | 2 | 2 | ||||||||
MIRT563420 | KIF3A | kinesin family member 3A | 2 | 2 | ||||||||
MIRT563577 | KIAA1586 | KIAA1586 | 2 | 2 | ||||||||
MIRT565891 | NHS | NHS actin remodeling regulator | 2 | 2 | ||||||||
MIRT566096 | RCC2 | regulator of chromosome condensation 2 | 2 | 2 | ||||||||
MIRT566411 | PLAGL2 | PLAG1 like zinc finger 2 | 2 | 2 | ||||||||
MIRT567274 | HSP90AA1 | heat shock protein 90 alpha family class A member 1 | 2 | 2 | ||||||||
MIRT571483 | CCDC80 | coiled-coil domain containing 80 | 2 | 2 | ||||||||
MIRT572954 | VDAC2 | voltage dependent anion channel 2 | 2 | 2 | ||||||||
MIRT573643 | ZNF724P | zinc finger protein 724 | 2 | 2 | ||||||||
MIRT573732 | KHSRP | KH-type splicing regulatory protein | 2 | 2 | ||||||||
MIRT609103 | SMIM15 | small integral membrane protein 15 | 2 | 6 | ||||||||
MIRT617951 | EBNA1BP2 | EBNA1 binding protein 2 | 2 | 2 | ||||||||
MIRT618394 | PRKG2 | protein kinase, cGMP-dependent, type II | 2 | 2 | ||||||||
MIRT619642 | PLEKHG7 | pleckstrin homology and RhoGEF domain containing G7 | 2 | 2 | ||||||||
MIRT623470 | KDM5A | lysine demethylase 5A | 2 | 2 | ||||||||
MIRT629160 | CTCFL | CCCTC-binding factor like | 2 | 2 | ||||||||
MIRT638536 | LYRM2 | LYR motif containing 2 | 2 | 2 | ||||||||
MIRT649498 | CLDN16 | claudin 16 | 2 | 2 | ||||||||
MIRT683163 | MTHFD1 | methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 | 2 | 2 | ||||||||
MIRT691675 | SLC43A3 | solute carrier family 43 member 3 | 2 | 2 | ||||||||
MIRT693216 | MKI67 | marker of proliferation Ki-67 | 2 | 2 | ||||||||
MIRT695349 | AQP3 | aquaporin 3 (Gill blood group) | 2 | 2 | ||||||||
MIRT701038 | PCGF5 | polycomb group ring finger 5 | 2 | 2 | ||||||||
MIRT708768 | RYBP | RING1 and YY1 binding protein | 2 | 2 | ||||||||
MIRT717573 | ZBTB37 | zinc finger and BTB domain containing 37 | 2 | 2 | ||||||||
MIRT719301 | SETD7 | SET domain containing lysine methyltransferase 7 | 2 | 2 | ||||||||
MIRT725187 | SDAD1 | SDA1 domain containing 1 | 2 | 2 |
miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|