miRTarBase - #MIRT177635


—
pre-miRNA Information
pre-miRNA hsa-mir-548aq   
Genomic Coordinates chr3: 185767847 - 185767904
Description Homo sapiens miR-548aq stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-548aq-5p
Sequence 1| GAAAGUAAUUGCUGUUUUUGCC |22
Evidence Not_experimental
Experiments
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 7 3 - 185767898 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs148741643 4 dbSNP
rs373424261 5 dbSNP
rs954388082 9 dbSNP
rs1008952958 10 dbSNP
rs1443286362 15 dbSNP
rs778852684 17 dbSNP
rs1042518237 21 dbSNP
rs1299293460 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol UBE2D1   
Synonyms E2(17)KB1, SFT, UBC4/5, UBCH5, UBCH5A
Description ubiquitin conjugating enzyme E2 D1
Transcript NM_003338   
Expression
Putative miRNA Targets on UBE2D1
3'UTR of UBE2D1
(miRNA target sites are highlighted)		 
>UBE2D1|NM_003338|3'UTR
   1 AAATCAAAAACATTTTCATATATACCAGAGTACTGTAAAATCTAGGTTTTTTTCAACATTAGCAGTAAATTGAGCACTGT
  81 TTACTGTTTCATTGTACCATGAAACCATTTGATTTTTACCCATTTTAAATGTGTTTCTGAAGCAAGACAAAACAAACTTC
 161 CAAAAATACCCTTAAGACTGTGATGAGAGCATTTATCATTTTGTATGCATTGAGAAAGACATTTATTATGGTTTTTAAGA
 241 TACTTGGACATCTGCATCTTCAGCTTACAAGATCTACAATGCAGCTGAAAAGCAACCAAATTATTTTTTGCTGAAACTAG
 321 ATGTTTTTACATGAGAAATACTGTATGTGTTGTCTAAGATGTCAGTTTTATAAATCTGTATTCAGATTTCATTCTTTGTT
 401 AGCTCACTTTATAATTTGTATTTTTTTACTGTATAGACTAAATATATTCTATTTACATGTATGTCAACTCATTACTTTTT
 481 TCCTGTGAACAGTATTGAAAAACCCCAACGGCTGATAATTAAGTGAATTAACTGTGTCTCCCTTGTCTTAGGATATTCTG
 561 TAGATTGATTGCAGATTTCTTAAATCTGAAATGATCTTTACACTGTAATTCTCAGCATACTGATTATGGAGAAACACTTG
 641 TTTTGATTTTGTTATACTTGACTTAACTTTATTGCAATGTGAATTAATTGCACTGCTAAGTAGGAAGATGTGTAACTTTT
 721 ATTTGTTGCTATTCACATTTGAATTTTTTCCTGTATAGGCAATATTATATTGACACCTTTTACAGATCTTACTGTAGCTT
 801 TTTCCATATAAATAAAATGCTTTTTCTACTATTTGTCTTGATTACTTAAAAAAATAAAAATATAAGTAAGGATCAAAACT
 881 CTAAAATTTTGCATGAAAATTACATCCAAATTGTGAAAATCAGATCTATTTTGTTTGCCATTAGTCACCATTAGTTATAT
 961 AAATTTTATTGTTTTAGGTTAGTATCTCTTTACTAAATTGTCAGTCTATAAGATAATATATGTTGATCCCTTGCTGTAGA
1041 GGAGAATTTAGAGTAATTTGGGGTTTGTCTTGGATTATATCTAAATGGATTATTTGTTAAAAGTACTGAAATGAGTATAA
1121 GGCAGTATCACCCATCCAAAAGAAAGGTCTTTATAGACCTGCACAGTCACTAGATTAATTCATTAAAATGCCCCCACCCT
1201 GATGTAATTGACATTACATTTCTTAACATTTTAAAATCTAGAATTTCTAAAATGGAATTTAATGCCATCACAATTTGAAA
1281 AACTTTTTTTTTTTTTTTACTATAGAAGTTACAAAGGAAGTTCTAAAATTATGCCTCCCTCTGTTTTTATAAGTTGCCAT
1361 CGAAAAGTGATTTAAATAAGCAGGTTATCTTTATAGATTTTAAAGAAAACTAGAAAGTTTTAATGTTTTAACTTGGGGAA
1441 AAATACATCTCTTTAATGTTTAGCATGCTTGTCAACCTTGAGTGAGTGTCATTTTTAAGAACAGTTGTAGCCCTTCTGAT
1521 TATTGCAGTAGCTGTAGAAGTATGTAAGAATATGTGATGGGTGTAGTCATTAGCAAAGCATTTAAATCACTTGAGTATTT
1601 TGTCATGGTTCATTATTATTAAAGCACAAAATAACCTATTGTTAGAAAATATGTGTTTTTATAAATGAATGTAAAATAAT
1681 TAAATGAATTGTGAAATGGATGTTTAAGAAAATATAGGCTTAAAAAGTAAATCTATAAAATGATGTCTTAAAACAGCCAT
1761 ATCATGAAAAATTCTACTTAGCTATATTATTATAAGCTACATTTGCCCTGAATTTGAACACTCAACATCACTAGATTTAA
1841 ATATTTAGTATATTTTGATAGTAAAGGGTTTTGTTTCTTGAATATCTTCACTTTAAACAAAAAAAAAAAACAACTTTCAT
1921 TTGTGTGGCATTTATTTTTGGAAGTGTCTTCTTTTTTTTCTTTATTAAAGTTTTTGAAACTTGCCTAAAAAAAAAAAAAA
2001 AAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ccgUUUUUGUCG--UUAAUGAAAg 5'
             ||||:|| |  |||||:||| 
Target 5' ctgAAAAGCAACCAAATTATTTTt 3'
 285 - 308 157.00 -8.10
2 
miRNA  3' ccGUUUUUGUCGU----UAAUGAAAg 5'
            || : |:: ||    |||||||| 
Target 5' taCATGTATGTCAACTCATTACTTTt 3'
 454 - 479 150.00 -5.30
3 
miRNA  3' ccguuuuUGUCGUUAAUGAAAg 5'
                 :::||| |||:||| 
Target 5' catttgtGTGGCATTTATTTTt 3'
 1918 - 1939 139.00 -6.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30148137 6 COSMIC
COSN30482904 18 COSMIC
COSN30473062 27 COSMIC
COSN18734512 54 COSMIC
COSN30158978 61 COSMIC
COSN30137840 79 COSMIC
COSN30161735 102 COSMIC
COSN29925254 112 COSMIC
COSN30619140 168 COSMIC
COSN31542384 215 COSMIC
COSN31543481 217 COSMIC
COSN1120694 230 COSMIC
COSN31485571 509 COSMIC
COSN31542482 539 COSMIC
COSN31611188 620 COSMIC
COSN31559444 675 COSMIC
COSN31523650 688 COSMIC
COSN10070430 735 COSMIC
COSN31515167 747 COSMIC
COSN31536122 838 COSMIC
COSN30176751 847 COSMIC
COSN1495520 963 COSMIC
COSN21965444 1165 COSMIC
COSN20107120 1299 COSMIC
COSN8640353 1634 COSMIC
COSN20337202 1900 COSMIC
COSN20107122 1911 COSMIC
COSN20107123 1911 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1172497835 1 dbSNP
rs1400739658 6 dbSNP
rs772710774 11 dbSNP
rs1248687123 12 dbSNP
rs747144551 19 dbSNP
rs1298909644 31 dbSNP
rs1360093204 40 dbSNP
rs1398394318 42 dbSNP
rs1463698779 47 dbSNP
rs760115767 47 dbSNP
rs768809006 47 dbSNP
rs1333119309 48 dbSNP
rs1304669896 50 dbSNP
rs1390087118 54 dbSNP
rs148198083 59 dbSNP
rs991139764 60 dbSNP
rs916929934 69 dbSNP
rs370282908 77 dbSNP
rs1388199726 78 dbSNP
rs1046997984 79 dbSNP
rs1323827130 85 dbSNP
rs1404500847 87 dbSNP
rs886937662 97 dbSNP
rs1169466531 98 dbSNP
rs1318527652 103 dbSNP
rs1449978742 104 dbSNP
rs1389538741 107 dbSNP
rs867972508 108 dbSNP
rs1187997901 121 dbSNP
rs1447738264 130 dbSNP
rs1248613181 148 dbSNP
rs1222614605 170 dbSNP
rs373252086 174 dbSNP
rs1288144850 183 dbSNP
rs1207811779 190 dbSNP
rs1038615232 203 dbSNP
rs548865564 207 dbSNP
rs1369137501 217 dbSNP
rs1275038368 223 dbSNP
rs917111499 230 dbSNP
rs949490770 232 dbSNP
rs1357542126 244 dbSNP
rs1430238583 255 dbSNP
rs1383392583 269 dbSNP
rs996679140 273 dbSNP
rs1447679553 275 dbSNP
rs1028975228 280 dbSNP
rs7084674 283 dbSNP
rs1286050272 300 dbSNP
rs902497707 303 dbSNP
rs1000832215 305 dbSNP
rs181991802 332 dbSNP
rs1274494437 334 dbSNP
rs900765643 337 dbSNP
rs996870476 339 dbSNP
rs186600585 346 dbSNP
rs1030490628 350 dbSNP
rs1285150757 351 dbSNP
rs1289836991 362 dbSNP
rs879052303 374 dbSNP
rs955072496 375 dbSNP
rs549342894 379 dbSNP
rs1004619287 381 dbSNP
rs769251670 395 dbSNP
rs1467492538 421 dbSNP
rs781358018 428 dbSNP
rs1359731948 429 dbSNP
rs968036005 438 dbSNP
rs1413982804 441 dbSNP
rs768529681 448 dbSNP
rs1462142135 452 dbSNP
rs1473102968 455 dbSNP
rs1251510098 457 dbSNP
rs1185916765 476 dbSNP
rs963010995 488 dbSNP
rs1238620766 492 dbSNP
rs1208731293 506 dbSNP
rs1366241768 508 dbSNP
rs748542614 510 dbSNP
rs776317459 511 dbSNP
rs1158840580 513 dbSNP
rs1409697594 538 dbSNP
rs1294527384 546 dbSNP
rs756232271 554 dbSNP
rs747913926 570 dbSNP
rs1397635175 572 dbSNP
rs927158352 576 dbSNP
rs958649725 594 dbSNP
rs916898620 595 dbSNP
rs1447329723 596 dbSNP
rs993189572 597 dbSNP
rs1158112214 599 dbSNP
rs776473103 604 dbSNP
rs1161518410 605 dbSNP
rs1457949001 614 dbSNP
rs570943534 619 dbSNP
rs1157365267 621 dbSNP
rs917077449 623 dbSNP
rs769348561 628 dbSNP
rs1181811876 637 dbSNP
rs530982718 645 dbSNP
rs1042423090 656 dbSNP
rs549865293 656 dbSNP
rs924033725 659 dbSNP
rs1208860763 668 dbSNP
rs936633833 678 dbSNP
rs1447372306 694 dbSNP
rs1240698190 698 dbSNP
rs1280429404 701 dbSNP
rs568099665 718 dbSNP
rs900535094 720 dbSNP
rs1322629544 721 dbSNP
rs996429391 737 dbSNP
rs565641656 745 dbSNP
rs775049500 750 dbSNP
rs932067969 763 dbSNP
rs1287346168 765 dbSNP
rs1005475875 768 dbSNP
rs890458131 770 dbSNP
rs61873956 777 dbSNP
rs1014648004 798 dbSNP
rs1181862167 810 dbSNP
rs1234300414 811 dbSNP
rs1188571292 820 dbSNP
rs1448364056 829 dbSNP
rs1245768184 830 dbSNP
rs898918286 833 dbSNP
rs1211302116 847 dbSNP
rs759243334 848 dbSNP
rs1471418097 855 dbSNP
rs903404603 862 dbSNP
rs1298246260 863 dbSNP
rs80063617 863 dbSNP
rs1034011287 870 dbSNP
rs555220192 879 dbSNP
rs576784633 882 dbSNP
rs768029444 892 dbSNP
rs1293649590 904 dbSNP
rs1170809272 914 dbSNP
rs147327223 924 dbSNP
rs1368632829 929 dbSNP
rs1293289352 950 dbSNP
rs1414019903 956 dbSNP
rs1423136046 972 dbSNP
rs1372888247 974 dbSNP
rs1024050297 975 dbSNP
rs191916374 976 dbSNP
rs977226415 982 dbSNP
rs982381237 985 dbSNP
rs925827314 991 dbSNP
rs377110500 998 dbSNP
rs1266319230 999 dbSNP
rs1196931924 1004 dbSNP
rs936750046 1005 dbSNP
rs547114974 1009 dbSNP
rs1204385705 1017 dbSNP
rs974420639 1018 dbSNP
rs1249664138 1028 dbSNP
rs1346557960 1045 dbSNP
rs1235583575 1057 dbSNP
rs182795262 1061 dbSNP
rs1300863880 1062 dbSNP
rs932511152 1077 dbSNP
rs1352750251 1081 dbSNP
rs1309065984 1085 dbSNP
rs1050917923 1086 dbSNP
rs1395044763 1089 dbSNP
rs911943817 1103 dbSNP
rs541068599 1105 dbSNP
rs1466105229 1113 dbSNP
rs921936462 1122 dbSNP
rs141070107 1124 dbSNP
rs1376653943 1125 dbSNP
rs944785447 1126 dbSNP
rs760481343 1133 dbSNP
rs1473425617 1137 dbSNP
rs1196834251 1139 dbSNP
rs1276193464 1143 dbSNP
rs931994951 1154 dbSNP
rs1252231643 1161 dbSNP
rs1051994966 1162 dbSNP
rs1481747910 1167 dbSNP
rs1258259095 1171 dbSNP
rs1202192358 1172 dbSNP
rs1345834018 1179 dbSNP
rs1255589037 1180 dbSNP
rs890711554 1193 dbSNP
rs903205216 1195 dbSNP
rs1481334160 1197 dbSNP
rs929009872 1199 dbSNP
rs373540346 1209 dbSNP
rs1000437565 1211 dbSNP
rs1055147950 1213 dbSNP
rs1036532430 1214 dbSNP
rs1377052486 1226 dbSNP
rs1051667658 1230 dbSNP
rs894642954 1246 dbSNP
rs1169539210 1254 dbSNP
rs1372498255 1256 dbSNP
rs542778950 1265 dbSNP
rs1468422535 1269 dbSNP
rs568615709 1270 dbSNP
rs1370069655 1284 dbSNP
rs1441812031 1284 dbSNP
rs201608334 1284 dbSNP
rs551129912 1284 dbSNP
rs899367504 1285 dbSNP
rs1201917204 1290 dbSNP
rs1466422976 1297 dbSNP
rs199940686 1299 dbSNP
rs77754511 1300 dbSNP
rs1307727787 1303 dbSNP
rs994577206 1304 dbSNP
rs1246123905 1316 dbSNP
rs1388935064 1320 dbSNP
rs1299668011 1322 dbSNP
rs1330843794 1327 dbSNP
rs1228796092 1328 dbSNP
rs560776908 1332 dbSNP
rs1436729055 1344 dbSNP
rs1003937324 1350 dbSNP
rs1319500495 1351 dbSNP
rs1034125591 1362 dbSNP
rs1015241844 1363 dbSNP
rs531486389 1368 dbSNP
rs894111250 1384 dbSNP
rs1014343474 1388 dbSNP
rs549704112 1391 dbSNP
rs1300372660 1393 dbSNP
rs570908630 1395 dbSNP
rs532085335 1399 dbSNP
rs967695541 1411 dbSNP
rs977342288 1435 dbSNP
rs1248821851 1437 dbSNP
rs537519102 1440 dbSNP
rs1292439500 1449 dbSNP
rs1210870733 1450 dbSNP
rs1359343043 1451 dbSNP
rs1290223752 1457 dbSNP
rs962721455 1465 dbSNP
rs1292103287 1467 dbSNP
rs974014312 1476 dbSNP
rs1489246163 1481 dbSNP
rs1332524175 1486 dbSNP
rs957224400 1487 dbSNP
rs989498432 1488 dbSNP
rs1170434130 1489 dbSNP
rs986602514 1489 dbSNP
rs890385460 1500 dbSNP
rs1431658384 1511 dbSNP
rs188463014 1512 dbSNP
rs565636586 1514 dbSNP
rs1186050528 1519 dbSNP
rs912416230 1522 dbSNP
rs756487920 1527 dbSNP
rs1248740107 1528 dbSNP
rs1199944379 1532 dbSNP
rs1156908263 1538 dbSNP
rs1190453905 1541 dbSNP
rs1388237523 1544 dbSNP
rs189686707 1558 dbSNP
rs555181388 1570 dbSNP
rs1207880920 1575 dbSNP
rs1168009030 1577 dbSNP
rs370871492 1593 dbSNP
rs1385887199 1594 dbSNP
rs911936485 1603 dbSNP
rs940917223 1618 dbSNP
rs1459666005 1619 dbSNP
rs1291935378 1620 dbSNP
rs1042220691 1622 dbSNP
rs1343439933 1626 dbSNP
rs570298183 1628 dbSNP
rs1383114182 1635 dbSNP
rs1410333676 1636 dbSNP
rs764123957 1652 dbSNP
rs936040812 1652 dbSNP
rs1054465946 1664 dbSNP
rs899314972 1668 dbSNP
rs1227097617 1669 dbSNP
rs1315169162 1671 dbSNP
rs1013137023 1672 dbSNP
rs1322961315 1677 dbSNP
rs1184862389 1681 dbSNP
rs930819278 1681 dbSNP
rs1242170328 1706 dbSNP
rs1045854186 1707 dbSNP
rs34913574 1709 dbSNP
rs182319673 1716 dbSNP
rs1055513353 1719 dbSNP
rs1443669096 1736 dbSNP
rs1486107369 1738 dbSNP
rs894217849 1741 dbSNP
rs1246164095 1744 dbSNP
rs1221538557 1754 dbSNP
rs370240419 1754 dbSNP
rs1014042216 1759 dbSNP
rs1184082242 1760 dbSNP
rs1228847439 1779 dbSNP
rs764287900 1782 dbSNP
rs1256956466 1785 dbSNP
rs1296396224 1787 dbSNP
rs902885287 1790 dbSNP
rs1163018136 1793 dbSNP
rs559245616 1798 dbSNP
rs1469471383 1809 dbSNP
rs539755912 1811 dbSNP
rs1161747330 1819 dbSNP
rs995546922 1820 dbSNP
rs1028001429 1826 dbSNP
rs1407835878 1827 dbSNP
rs1176022341 1830 dbSNP
rs1484546568 1842 dbSNP
rs1237525550 1866 dbSNP
rs1202545937 1867 dbSNP
rs1459695202 1868 dbSNP
rs1209056434 1883 dbSNP
rs186722228 1883 dbSNP
rs1316144508 1895 dbSNP
rs1161798274 1898 dbSNP
rs11336978 1899 dbSNP
rs1157434611 1899 dbSNP
rs1315818017 1899 dbSNP
rs1491297020 1899 dbSNP
rs199684702 1899 dbSNP
rs1491445202 1900 dbSNP
rs200229315 1900 dbSNP
rs1415238076 1901 dbSNP
rs1182368430 1902 dbSNP
rs957173448 1903 dbSNP
rs1249448486 1908 dbSNP
rs1435053582 1909 dbSNP
rs1337892777 1910 dbSNP
rs1376548354 1911 dbSNP
rs553113525 1911 dbSNP
rs78097569 1912 dbSNP
rs1290967384 1914 dbSNP
rs558051759 1915 dbSNP
rs924653018 1919 dbSNP
rs1382964345 1924 dbSNP
rs953584542 1926 dbSNP
rs1287478175 1931 dbSNP
rs1459770644 1934 dbSNP
rs1317112227 1942 dbSNP
rs1163529558 1947 dbSNP
rs1229794126 1952 dbSNP
rs990530013 1953 dbSNP
rs1193352547 1957 dbSNP
rs987609512 1958 dbSNP
rs778983834 1961 dbSNP
rs1204233332 1965 dbSNP
rs1257675237 1967 dbSNP
rs1484315511 1971 dbSNP
rs911870448 1972 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 7321.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000373910.4 | 3UTR | UCAACUCAUUACUUUUUUCCUGUGAAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000373910.4 | 3UTR | UCAACUCAUUACUUUUUUCCUGUGAACAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000373910.4 | 3UTR | UCAACUCAUUACUUUUUUCCUGUGAACAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
184 hsa-miR-548aq-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT057134 DDIT4 DNA damage inducible transcript 4 2 4
MIRT063382 ETNK1 ethanolamine kinase 1 2 2
MIRT072505 RAB8B RAB8B, member RAS oncogene family 2 2
MIRT082197 ACTN4 actinin alpha 4 2 6
MIRT083047 PTBP1 polypyrimidine tract binding protein 1 2 2
MIRT085199 SLC5A3 solute carrier family 5 member 3 2 4
MIRT088917 FOXN2 forkhead box N2 2 4
MIRT089509 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 6
MIRT092051 ABHD5 abhydrolase domain containing 5 2 2
MIRT094694 FEM1C fem-1 homolog C 2 2
MIRT095408 UBE2D2 ubiquitin conjugating enzyme E2 D2 2 2
MIRT096514 BRIX1 BRX1, biogenesis of ribosomes 2 2
MIRT101306 FAM135A family with sequence similarity 135 member A 2 2
MIRT103369 CBX3 chromobox 3 2 2
MIRT103887 FOXK1 forkhead box K1 2 2
MIRT104347 CLDN12 claudin 12 2 2
MIRT104511 PEG10 paternally expressed 10 2 6
MIRT111811 MPZL1 myelin protein zero like 1 2 2
MIRT177250 BMI1 BMI1 proto-oncogene, polycomb ring finger 2 2
MIRT177285 COMMD3-BMI1 COMMD3-BMI1 readthrough 2 2
MIRT177635 UBE2D1 ubiquitin conjugating enzyme E2 D1 2 6
MIRT178051 SAMD8 sterile alpha motif domain containing 8 2 2
MIRT179111 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 6
MIRT179598 CAPZA1 capping actin protein of muscle Z-line alpha subunit 1 2 6
MIRT195309 LEPROT leptin receptor overlapping transcript 2 2
MIRT203155 BACH1 BTB domain and CNC homolog 1 2 2
MIRT208439 ZBTB38 zinc finger and BTB domain containing 38 2 2
MIRT214587 SMAD5 SMAD family member 5 2 4
MIRT216114 IL6ST interleukin 6 signal transducer 2 2
MIRT216366 CCNB1 cyclin B1 2 4
MIRT220062 MDFIC MyoD family inhibitor domain containing 2 2
MIRT226739 ANP32B acidic nuclear phosphoprotein 32 family member B 2 4
MIRT227708 TBC1D13 TBC1 domain family member 13 2 2
MIRT230083 SH3BGRL SH3 domain binding glutamate rich protein like 2 2
MIRT248647 HMGN2 high mobility group nucleosomal binding domain 2 2 4
MIRT254803 XRCC6 X-ray repair cross complementing 6 2 6
MIRT264390 YAP1 Yes associated protein 1 2 2
MIRT266985 LRRC55 leucine rich repeat containing 55 2 4
MIRT273960 SPRYD4 SPRY domain containing 4 2 2
MIRT281812 MAP2K1 mitogen-activated protein kinase kinase 1 2 2
MIRT293265 DR1 down-regulator of transcription 1 2 2
MIRT297107 RGPD4 RANBP2-like and GRIP domain containing 4 2 2
MIRT308184 PDE12 phosphodiesterase 12 2 2
MIRT309027 USP53 ubiquitin specific peptidase 53 2 2
MIRT311481 PRRC1 proline rich coiled-coil 1 2 2
MIRT312599 G3BP1 G3BP stress granule assembly factor 1 2 4
MIRT328139 ZNF711 zinc finger protein 711 2 2
MIRT329324 FAM53C family with sequence similarity 53 member C 2 2
MIRT334652 NEK7 NIMA related kinase 7 2 2
MIRT340683 THRAP3 thyroid hormone receptor associated protein 3 2 2
MIRT378867 ITGB8 integrin subunit beta 8 2 2
MIRT395804 SPCS3 signal peptidase complex subunit 3 2 2
MIRT405650 WBP4 WW domain binding protein 4 2 4
MIRT408296 GRPEL2 GrpE like 2, mitochondrial 2 2
MIRT442110 ZNRF2 zinc and ring finger 2 2 8
MIRT442853 GTF2H5 general transcription factor IIH subunit 5 2 2
MIRT443129 VLDLR very low density lipoprotein receptor 2 2
MIRT443160 ZDHHC21 zinc finger DHHC-type containing 21 2 2
MIRT443311 PRPS1L1 phosphoribosyl pyrophosphate synthetase 1-like 1 2 2
MIRT445093 ZNF207 zinc finger protein 207 2 2
MIRT445397 PTCHD1 patched domain containing 1 2 4
MIRT447083 MCC mutated in colorectal cancers 2 2
MIRT447313 ZNF562 zinc finger protein 562 2 2
MIRT447526 MRPS5 mitochondrial ribosomal protein S5 2 2
MIRT449524 TM6SF1 transmembrane 6 superfamily member 1 2 2
MIRT449915 C11orf34 placenta expressed transcript 1 1 2
MIRT450564 SHFM1 SEM1, 26S proteasome complex subunit 2 2
MIRT450732 PVRL3 nectin cell adhesion molecule 3 2 2
MIRT454936 ANKEF1 ankyrin repeat and EF-hand domain containing 1 2 12
MIRT455905 KIF2C kinesin family member 2C 2 2
MIRT463745 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 2 8
MIRT471195 PHB2 prohibitin 2 2 2
MIRT472777 MTMR6 myotubularin related protein 6 2 8
MIRT474470 KLHL11 kelch like family member 11 2 8
MIRT475998 GTPBP2 GTP binding protein 2 2 2
MIRT482290 AGO2 argonaute 2, RISC catalytic component 2 4
MIRT485871 ALG9 ALG9, alpha-1,2-mannosyltransferase 2 2
MIRT486205 ERH ERH, mRNA splicing and mitosis factor 2 4
MIRT488622 FAM3C family with sequence similarity 3 member C 2 6
MIRT489997 DDB1 damage specific DNA binding protein 1 2 2
MIRT493489 IPMK inositol polyphosphate multikinase 2 2
MIRT494293 CEP120 centrosomal protein 120 2 2
MIRT498005 ZBTB20 zinc finger and BTB domain containing 20 2 2
MIRT498486 PTBP2 polypyrimidine tract binding protein 2 2 10
MIRT498572 TMEM30B transmembrane protein 30B 2 2
MIRT499880 SVOP SV2 related protein 2 10
MIRT500233 INHBA inhibin beta A subunit 2 10
MIRT500707 TRIM37 tripartite motif containing 37 2 2
MIRT501001 SPPL2A signal peptide peptidase like 2A 2 4
MIRT501036 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 2 6
MIRT502749 CLIP1 CAP-Gly domain containing linker protein 1 2 8
MIRT502811 CELSR3 cadherin EGF LAG seven-pass G-type receptor 3 2 6
MIRT502900 CDK4 cyclin dependent kinase 4 2 8
MIRT503496 ZNF154 zinc finger protein 154 2 6
MIRT503730 GRM5 glutamate metabotropic receptor 5 2 2
MIRT505150 YOD1 YOD1 deubiquitinase 2 2
MIRT505815 RSBN1 round spermatid basic protein 1 2 8
MIRT505854 POLR1B RNA polymerase I subunit B 2 4
MIRT509297 NPM3 nucleophosmin/nucleoplasmin 3 2 6
MIRT516842 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT520532 TRA2B transformer 2 beta homolog 2 2
MIRT520736 TM9SF3 transmembrane 9 superfamily member 3 2 6
MIRT525416 SHISA9 shisa family member 9 2 4
MIRT525880 ARL13B ADP ribosylation factor like GTPase 13B 2 2
MIRT526026 RBM4B RNA binding motif protein 4B 2 2
MIRT526097 TMEM41B transmembrane protein 41B 2 2
MIRT527944 FRY FRY microtubule binding protein 2 2
MIRT528831 RAB32 RAB32, member RAS oncogene family 2 2
MIRT531075 SLC9A4 solute carrier family 9 member A4 2 4
MIRT535508 PANX1 pannexin 1 2 2
MIRT536695 IKZF5 IKAROS family zinc finger 5 2 2
MIRT536848 HMBOX1 homeobox containing 1 2 2
MIRT537215 GDE1 glycerophosphodiester phosphodiesterase 1 2 4
MIRT537847 EFNA5 ephrin A5 2 2
MIRT538358 CSE1L chromosome segregation 1 like 2 4
MIRT541255 GPC4 glypican 4 2 2
MIRT543248 PEX7 peroxisomal biogenesis factor 7 2 2
MIRT543463 PARP15 poly(ADP-ribose) polymerase family member 15 2 2
MIRT543724 XKR9 XK related 9 2 2
MIRT543920 ESYT1 extended synaptotagmin 1 2 2
MIRT544012 KLRC3 killer cell lectin like receptor C3 2 2
MIRT544083 METTL8 methyltransferase like 8 2 2
MIRT544200 ANGPTL3 angiopoietin like 3 2 2
MIRT544821 ACSM2B acyl-CoA synthetase medium chain family member 2B 2 2
MIRT545059 PRELID1 PRELI domain containing 1 2 2
MIRT545227 HIST1H2BD histone cluster 1 H2B family member d 2 2
MIRT545302 SPC25 SPC25, NDC80 kinetochore complex component 2 2
MIRT545563 GIMAP4 GTPase, IMAP family member 4 2 2
MIRT546510 SIK1 salt inducible kinase 1 2 2
MIRT546927 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 2
MIRT547688 KPNA1 karyopherin subunit alpha 1 2 4
MIRT547781 KATNAL1 katanin catalytic subunit A1 like 1 2 2
MIRT548700 CRNKL1 crooked neck pre-mRNA splicing factor 1 2 2
MIRT548914 CHEK2 checkpoint kinase 2 2 4
MIRT549970 RPL7L1 ribosomal protein L7 like 1 2 4
MIRT550502 TMEM241 transmembrane protein 241 2 2
MIRT551062 MKLN1 muskelin 1 2 2
MIRT552824 XIAP X-linked inhibitor of apoptosis 2 4
MIRT553158 UBE2H ubiquitin conjugating enzyme E2 H 2 2
MIRT553843 SYNCRIP synaptotagmin binding cytoplasmic RNA interacting protein 2 2
MIRT554271 SIX4 SIX homeobox 4 2 2
MIRT555794 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 2 2
MIRT556331 MAP2K4 mitogen-activated protein kinase kinase 4 2 2
MIRT556512 LIPA lipase A, lysosomal acid type 2 2
MIRT556706 KLHL28 kelch like family member 28 2 2
MIRT556765 KLF7 Kruppel like factor 7 2 2
MIRT557003 HPRT1 hypoxanthine phosphoribosyltransferase 1 2 2
MIRT557159 HOXA13 homeobox A13 2 2
MIRT557500 GPR27 G protein-coupled receptor 27 2 4
MIRT558115 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 2 2
MIRT559357 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT560348 ZWINT ZW10 interacting kinetochore protein 2 2
MIRT561312 ZBTB43 zinc finger and BTB domain containing 43 2 2
MIRT561896 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT561940 MFSD9 major facilitator superfamily domain containing 9 2 2
MIRT562948 TNIP2 TNFAIP3 interacting protein 2 2 2
MIRT563304 BBS10 Bardet-Biedl syndrome 10 2 2
MIRT563418 KIF3A kinesin family member 3A 2 2
MIRT563575 KIAA1586 KIAA1586 2 2
MIRT565888 NHS NHS actin remodeling regulator 2 2
MIRT566094 RCC2 regulator of chromosome condensation 2 2 2
MIRT566409 PLAGL2 PLAG1 like zinc finger 2 2 2
MIRT567272 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 2
MIRT571481 CCDC80 coiled-coil domain containing 80 2 2
MIRT572952 VDAC2 voltage dependent anion channel 2 2 2
MIRT573641 ZNF724P zinc finger protein 724 2 2
MIRT573730 KHSRP KH-type splicing regulatory protein 2 2
MIRT609101 SMIM15 small integral membrane protein 15 2 6
MIRT617949 EBNA1BP2 EBNA1 binding protein 2 2 2
MIRT618392 PRKG2 protein kinase, cGMP-dependent, type II 2 2
MIRT619640 PLEKHG7 pleckstrin homology and RhoGEF domain containing G7 2 2
MIRT623468 KDM5A lysine demethylase 5A 2 2
MIRT629158 CTCFL CCCTC-binding factor like 2 2
MIRT638534 LYRM2 LYR motif containing 2 2 2
MIRT649496 CLDN16 claudin 16 2 2
MIRT683161 MTHFD1 methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 2 2
MIRT691673 SLC43A3 solute carrier family 43 member 3 2 2
MIRT693214 MKI67 marker of proliferation Ki-67 2 2
MIRT695347 AQP3 aquaporin 3 (Gill blood group) 2 2
MIRT701036 PCGF5 polycomb group ring finger 5 2 2
MIRT708766 RYBP RING1 and YY1 binding protein 2 2
MIRT717571 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT719299 SETD7 SET domain containing lysine methyltransferase 7 2 2
MIRT725185 SDAD1 SDA1 domain containing 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-548aq Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-548aq-5p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer tissue
hsa-miR-548aq-5p Erlotinib 176870 NSC718781 approved sensitive High Non-Small Cell Lung Cancer tissue
hsa-miR-548aq-5p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-548aq-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-548aq-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-548aq-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-548aq-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)

Error report submission