miRTarBase - #MIRT178618


—
pre-miRNA Information
pre-miRNA hsa-mir-921   
Genomic Coordinates chr1: 166154743 - 166154798
Synonyms MIRN921, hsa-mir-921, MIR921
Description Homo sapiens miR-921 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-921
Sequence 2| CUAGUGAGGGACAGAACCAGGAUUC |26
Evidence Experimental
Experiments Cloned
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN31549221 11 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1464259216 3 dbSNP
rs768428855 8 dbSNP
rs746970999 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol HIAT1
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' cuUAGGACCAAGACAGGGAGUgauc 5'
            | |:|||      | ||||    
Target 5' uaAACUUGG----AACACUCA---- 3'
 		6 - 22
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000370152.3 | 3UTR | CUUUUUAAACUUGGAACACUCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19536 Breast cancer -0.318 6.3e-4 -0.411 1.1e-5 100 Click to see details
GSE28544 Breast cancer -0.618 6.4e-4 -0.582 1.4e-3 24 Click to see details
GSE42095 Differentiated embryonic stem cells -0.628 6.7e-4 -0.636 5.5e-4 23 Click to see details
GSE28260 Renal cortex and medulla 0.747 1.7e-3 0.819 3.1e-4 13 Click to see details
GSE38226 Liver fibrosis 0.523 7.5e-3 0.462 1.7e-2 21 Click to see details
GSE19783 ER- ER- breast cancer -0.257 1.1e-2 -0.343 9.9e-4 79 Click to see details
GSE19783 ER+ ER+ breast cancer -0.497 1.3e-2 -0.598 2.7e-3 20 Click to see details
GSE19350 CNS germ cell tumors -0.37 1.2e-1 -0.406 9.5e-2 12 Click to see details
GSE21687 Ependynoma primary tumors 0.149 1.2e-1 0.008 4.7e-1 64 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.115 2.9e-1 0.012 4.8e-1 25 Click to see details
GSE26953 Aortic valvular endothelial cells -0.043 4.2e-1 0.043 4.2e-1 24 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.032 4.5e-1 -0.433 2.8e-2 20 Click to see details
GSE32688 Pancreatic cancer 0.022 4.5e-1 0.077 3.4e-1 32 Click to see details
GSE32688 Pancreatic cancer 0.022 4.5e-1 0.077 3.4e-1 32 Click to see details
GSE32688 Pancreatic cancer 0.022 4.5e-1 0.077 3.4e-1 32 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
63 hsa-miR-921 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT054764 ANGPTL1 angiopoietin like 1 3 1
MIRT066171 PIP4K2C phosphatidylinositol-5-phosphate 4-kinase type 2 gamma 2 2
MIRT069409 ZFYVE21 zinc finger FYVE-type containing 21 2 8
MIRT102284 DNAJB9 DnaJ heat shock protein family (Hsp40) member B9 2 4
MIRT107595 DNAJA1 DnaJ heat shock protein family (Hsp40) member A1 2 6
MIRT178618 HIAT1 major facilitator superfamily domain containing 14A 2 2
MIRT182407 TIPRL TOR signaling pathway regulator 2 4
MIRT186552 ZBTB18 zinc finger and BTB domain containing 18 2 2
MIRT273662 HOXC8 homeobox C8 2 2
MIRT283191 C16ORF52 chromosome 16 open reading frame 52 2 2
MIRT284890 NFAT5 nuclear factor of activated T-cells 5 2 2
MIRT347670 LSM14A LSM14A, mRNA processing body assembly factor 2 2
MIRT400222 SLC35F6 solute carrier family 35 member F6 2 2
MIRT403517 ASPH aspartate beta-hydroxylase 2 2
MIRT442251 DCTN5 dynactin subunit 5 2 2
MIRT443023 SDR39U1 short chain dehydrogenase/reductase family 39U member 1 2 2
MIRT443097 RNF20 ring finger protein 20 2 2
MIRT444560 TRA2B transformer 2 beta homolog 2 2
MIRT445696 PRKG1 protein kinase, cGMP-dependent, type I 2 2
MIRT454084 TMEM209 transmembrane protein 209 2 2
MIRT455463 LYPLA2 lysophospholipase II 2 2
MIRT456653 TIFA TRAF interacting protein with forkhead associated domain 2 2
MIRT458147 LYRM4 LYR motif containing 4 2 6
MIRT467073 SRRD SRR1 domain containing 2 4
MIRT467245 SPPL2A signal peptide peptidase like 2A 2 2
MIRT468246 SFXN4 sideroflexin 4 2 2
MIRT471589 PAQR5 progestin and adipoQ receptor family member 5 2 19
MIRT476639 G2E3 G2/M-phase specific E3 ubiquitin protein ligase 2 2
MIRT482433 ADM adrenomedullin 2 10
MIRT486848 PERP PERP, TP53 apoptosis effector 2 6
MIRT489656 SHMT1 serine hydroxymethyltransferase 1 2 2
MIRT493441 KANSL1 KAT8 regulatory NSL complex subunit 1 2 6
MIRT493841 FOXN3 forkhead box N3 2 4
MIRT501378 RBFOX2 RNA binding protein, fox-1 homolog 2 2 10
MIRT509679 ATAD5 ATPase family, AAA domain containing 5 2 4
MIRT510280 MED28 mediator complex subunit 28 2 2
MIRT512221 ATXN3 ataxin 3 2 6
MIRT514030 BNIP2 BCL2 interacting protein 2 2 2
MIRT521375 RDX radixin 2 4
MIRT521444 RAD51 RAD51 recombinase 2 2
MIRT526055 CBR1 carbonyl reductase 1 2 2
MIRT528658 FUNDC2 FUN14 domain containing 2 2 2
MIRT529975 TNFAIP8L1 TNF alpha induced protein 8 like 1 2 2
MIRT544098 IPMK inositol polyphosphate multikinase 2 2
MIRT545579 SNRPA1 small nuclear ribonucleoprotein polypeptide A' 2 2
MIRT547424 MED4 mediator complex subunit 4 2 2
MIRT548955 CD2AP CD2 associated protein 2 2
MIRT549537 NDUFA6 NADH:ubiquinone oxidoreductase subunit A6 2 4
MIRT552550 ZFP36L2 ZFP36 ring finger protein like 2 2 4
MIRT554640 ROBO1 roundabout guidance receptor 1 2 2
MIRT564904 YTHDF1 YTH N6-methyladenosine RNA binding protein 1 2 2
MIRT565578 SLC6A8 solute carrier family 6 member 8 2 2
MIRT568312 BAG4 BCL2 associated athanogene 4 2 2
MIRT617891 PTCHD3 patched domain containing 3 2 2
MIRT621892 TAF13 TATA-box binding protein associated factor 13 2 2
MIRT642850 RNF135 ring finger protein 135 2 2
MIRT665395 WEE1 WEE1 G2 checkpoint kinase 2 2
MIRT697879 UBE2B ubiquitin conjugating enzyme E2 B 2 2
MIRT698492 THOC2 THO complex 2 2 2
MIRT701227 OCRL OCRL, inositol polyphosphate-5-phosphatase 2 2
MIRT701872 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT707045 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT715216 NPVF neuropeptide VF precursor 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-921 Progesterone approved 5994 Microarray Breast cancer 22330642 2012 up-regulated
miR-921 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-921 Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-921 Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-921 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (PANC-1)
hsa-miR-921 Gemcitabine 60750 NSC613327 approved resistant High Pancreatic Cancer cell line (AsPC-1)
hsa-mir-921 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-921 Androstenedione+Anastrozole resistant cell line (MCF-7)
hsa-mir-921 Cisplatin 5460033 NSC119875 approved sensitive cell line (KYSE)
hsa-mir-921 Fluorouracil 3385 NSC19893 approved sensitive cell line (OE19)
hsa-miR-921 Temozolomide 5394 NSC362856 approved sensitive cell line (U251)
hsa-miR-921 Doxorubicin 31703 NSC123127 approved resistant cell line (HS578T)
hsa-miR-921 Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-921 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-miR-921 Ethanol+Tamoxifen resistant cell line (LY2)
hsa-miR-921 Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-921 Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-921 Pegylated interferon alpha+Ribavirin sensitive tissue (chronic hepatitis C)
hsa-miR-921 Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-921 Paclitaxel 36314 NSC125973 approved sensitive cell line (PC3PR20)
hsa-miR-921 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-921 Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-921 Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR1)
hsa-miR-921 Gemcitabine 60750 NSC613327 approved resistant cell line (Panc1-GR4)

Error report submission