miRTarBase - #MIRT185107


—
pre-miRNA Information
pre-miRNA hsa-mir-511   
Genomic Coordinates chr10: 17845107 - 17845193
Description Homo sapiens miR-511 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-511-3p
Sequence 54| AAUGUGUAGCAAAAGACAGA |73
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30502461 14 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs548691953 3 dbSNP
rs1322530388 4 dbSNP
rs1313209508 11 dbSNP
rs1223031412 19 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol LYPLAL1   
Synonyms Q96AV0
Description lysophospholipase like 1
Transcript NM_138794   
Expression
Putative miRNA Targets on LYPLAL1
3'UTR of LYPLAL1
(miRNA target sites are highlighted)		 
>LYPLAL1|NM_138794|3'UTR
   1 ATGAATCAAGAGTGATTTGTTAATGTAAGTGTAATGTCTTTGTGAAAAGTGATTTTTACTGCCAAATTATAATGATAATT
  81 AAAATATTAAGAAATAACACTTTCCTGACTTTTTTATTATTAAAATGCTTATCACTGTAGACAGTAGCTAATCTTATTAA
 161 TGAAAAACAATAGACAAACATCTGTGCATAATTTTTCAGACACAATTCTGTAAATATTTGGAAACCTTTTAAGTATTTAA
 241 ACTTTTAAATTTTTGAAATAAAGTATTCTAAACTAATATAAATAAGGACAATGAAAAAACATGAAAGGACTTAGCATAAT
 321 GTTATTTTATCTTTTCTACAACTTTGTTTAAATTACCTTTCCAAAGATATTTGTGTTTATGTAATTTTCCACGGAATAAC
 401 ATTAATACTCTAGGTTTATAAACCGGTTTCACATTATTTCATTTGATCATCACAAGAGCTTTGTGAAGTAAGCCGAGAAG
 481 TTGTTACTGGTATTTAATAATAGCAATAGAGGAGTTAAAGACTTTCCCACAGCTTGCAGGTCAAGACAAGAAATTCAGGT
 561 CTCCTAATTCTCAGTGGAGCTCTATTTCTGTTAACCCAAATTGCTGCTCTGTTTTAGGTCTCAATTTCATCTGTAAAATG
 641 ATACTAATAGTACTTATCCCATTGGATTTTTGTTGAGATTTAAATAAATAGCCAAAAGCCAATACATAATAAACACTCAA
 721 TAAAGATTAACCATAAGGAGAGTCATGATCTGGTTCCAGGAATACATTGTTAGATGACTGAAAAATTGTATTACTTCAAT
 801 GAAAATACTATAAATAATAACATTTTCATATATTAGTTGGTTCTCATGCATACATAATCTAATTTTATTTGATCCTCACA
 881 ACTGTTTAAGTTTTATTAAATATACATTATCCCTATTTGTATAAATAGAATCATACAATACCTGCCTGCTTTCATTCAAC
 961 AAAATTATCATGAGATTTTTCCATGTTGTGTACATCAATAGTTCATCTATTTTATTGCTCAGTAATATTCCATTGTGTGG
1041 ATGTATCACTATTTGTTTACACATTCACCACTGATATATAAGTTGCTTCCAGTGTGAGGCTGTTTTAAATAAAGCTGCTA
1121 TGAATATTCATGTAAGAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' agACA----GA-AAAC-GAUGUGUAa 5'
            |||    || |||| :||||||| 
Target 5' gaTGTATCACTATTTGTTTACACATt 3'
 1040 - 1065 156.00 -10.50
2 
miRNA  3' agaCAGAA-AA-CGAUGUGUAa 5'
             ||:|| ||   ||:|||| 
Target 5' taaGTTTTATTAAATATACATt 3'
 887 - 908 133.00 -7.00
3 
miRNA  3' agacAGAAAACG-AUGUGUaa 5'
              |||  ||| ||||:|  
Target 5' tggtTCTCATGCATACATAat 3'
 838 - 858 120.00 -6.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN31575368 31 COSMIC
COSN31601593 113 COSMIC
COSN15661562 380 COSMIC
COSN27153221 393 COSMIC
COSN31959500 520 COSMIC
COSN20090460 714 COSMIC
COSN23742194 903 COSMIC
COSN22588480 954 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1457372761 3 dbSNP
rs1471445883 4 dbSNP
rs375499871 6 dbSNP
rs746487651 7 dbSNP
rs1037791096 8 dbSNP
rs770592621 10 dbSNP
rs776306471 11 dbSNP
rs759185943 15 dbSNP
rs1477646324 17 dbSNP
rs1489384940 17 dbSNP
rs769069105 30 dbSNP
rs897647056 31 dbSNP
rs1299522590 34 dbSNP
rs1165910687 36 dbSNP
rs1318812543 39 dbSNP
rs1229155432 41 dbSNP
rs774721615 43 dbSNP
rs1327033398 45 dbSNP
rs993312122 52 dbSNP
rs1230458389 75 dbSNP
rs1327412490 99 dbSNP
rs993590444 105 dbSNP
rs1208857246 110 dbSNP
rs1405936397 110 dbSNP
rs1242008522 111 dbSNP
rs1459653258 114 dbSNP
rs531376399 118 dbSNP
rs547861220 132 dbSNP
rs1189191912 134 dbSNP
rs1239573293 136 dbSNP
rs759587794 137 dbSNP
rs1345269539 138 dbSNP
rs906426049 142 dbSNP
rs1455267105 144 dbSNP
rs1410779209 158 dbSNP
rs1158473845 163 dbSNP
rs1002135736 166 dbSNP
rs1434711997 168 dbSNP
rs887720627 171 dbSNP
rs1006035054 172 dbSNP
rs1033552573 179 dbSNP
rs958772030 184 dbSNP
rs1033326683 186 dbSNP
rs539274563 192 dbSNP
rs1405459773 193 dbSNP
rs1234354865 200 dbSNP
rs1314280895 204 dbSNP
rs1299728816 206 dbSNP
rs1219146655 208 dbSNP
rs191570404 226 dbSNP
rs533856824 227 dbSNP
rs1340833336 230 dbSNP
rs989220313 232 dbSNP
rs1432300906 233 dbSNP
rs1336954302 234 dbSNP
rs1387393639 234 dbSNP
rs1020667167 236 dbSNP
rs558626165 243 dbSNP
rs1331066293 248 dbSNP
rs1175164084 252 dbSNP
rs7552305 253 dbSNP
rs1428987650 259 dbSNP
rs1228939721 261 dbSNP
rs1391951909 271 dbSNP
rs1190544368 275 dbSNP
rs572067465 276 dbSNP
rs977853642 287 dbSNP
rs1484394931 300 dbSNP
rs1254576165 302 dbSNP
rs547249245 303 dbSNP
rs1209862949 311 dbSNP
rs1201804162 316 dbSNP
rs966863387 317 dbSNP
rs977591226 318 dbSNP
rs1226905906 330 dbSNP
rs1363787962 335 dbSNP
rs570315953 342 dbSNP
rs923444504 343 dbSNP
rs1315221165 365 dbSNP
rs1397402410 368 dbSNP
rs954947656 384 dbSNP
rs986372551 385 dbSNP
rs910551868 393 dbSNP
rs114923651 394 dbSNP
rs1462332361 401 dbSNP
rs1372273410 408 dbSNP
rs1166612052 409 dbSNP
rs1429107598 411 dbSNP
rs1389621391 415 dbSNP
rs990268407 426 dbSNP
rs559049493 438 dbSNP
rs1037674530 439 dbSNP
rs919310288 442 dbSNP
rs1250094890 460 dbSNP
rs1473825098 461 dbSNP
rs929400457 470 dbSNP
rs1046201322 475 dbSNP
rs1428680491 476 dbSNP
rs1265455080 480 dbSNP
rs1464662504 488 dbSNP
rs140243321 491 dbSNP
rs1040078231 501 dbSNP
rs901616113 502 dbSNP
rs1174515655 505 dbSNP
rs928976196 507 dbSNP
rs1409645080 517 dbSNP
rs1409079451 521 dbSNP
rs1305887909 523 dbSNP
rs35345463 523 dbSNP
rs1002119403 526 dbSNP
rs1055080471 527 dbSNP
rs1047874118 530 dbSNP
rs1366844067 539 dbSNP
rs538268272 541 dbSNP
rs775917494 544 dbSNP
rs1006587755 548 dbSNP
rs1180484813 555 dbSNP
rs1482976135 561 dbSNP
rs1021056447 563 dbSNP
rs1211056461 566 dbSNP
rs1353613845 567 dbSNP
rs1264389671 574 dbSNP
rs966454150 578 dbSNP
rs894955980 581 dbSNP
rs1330792223 587 dbSNP
rs1282624199 589 dbSNP
rs554690082 593 dbSNP
rs1409023586 596 dbSNP
rs1245438559 600 dbSNP
rs1331562802 604 dbSNP
rs1030482582 607 dbSNP
rs1024382525 609 dbSNP
rs971911401 612 dbSNP
rs1325375250 616 dbSNP
rs1256108146 619 dbSNP
rs954916156 622 dbSNP
rs574853202 630 dbSNP
rs1472479914 645 dbSNP
rs1272851136 655 dbSNP
rs977444852 657 dbSNP
rs1032121755 660 dbSNP
rs957400323 663 dbSNP
rs990324352 676 dbSNP
rs748163587 681 dbSNP
rs910824849 685 dbSNP
rs540934849 689 dbSNP
rs1345416222 691 dbSNP
rs202111790 694 dbSNP
rs1230957150 707 dbSNP
rs765516089 709 dbSNP
rs750716115 710 dbSNP
rs973405888 712 dbSNP
rs1047385076 714 dbSNP
rs560717365 714 dbSNP
rs577559002 717 dbSNP
rs1403347367 719 dbSNP
rs941722689 720 dbSNP
rs554688456 723 dbSNP
rs1430220768 732 dbSNP
rs1046956230 734 dbSNP
rs927810962 739 dbSNP
rs546407339 743 dbSNP
rs937792122 749 dbSNP
rs1388437727 754 dbSNP
rs1388469978 759 dbSNP
rs537617894 762 dbSNP
rs1054966013 765 dbSNP
rs1055019493 781 dbSNP
rs895091746 798 dbSNP
rs1301288907 800 dbSNP
rs1013406671 811 dbSNP
rs1280402683 818 dbSNP
rs562636860 829 dbSNP
rs780235462 831 dbSNP
rs531283211 836 dbSNP
rs907275608 841 dbSNP
rs755445983 844 dbSNP
rs1031757993 851 dbSNP
rs182165783 855 dbSNP
rs1341305611 860 dbSNP
rs1430211501 860 dbSNP
rs1336517139 885 dbSNP
rs1344730688 885 dbSNP
rs1229660351 888 dbSNP
rs1375276423 888 dbSNP
rs561545487 894 dbSNP
rs1011547510 901 dbSNP
rs867234842 902 dbSNP
rs1185442961 903 dbSNP
rs1472882897 905 dbSNP
rs902202922 907 dbSNP
rs549867020 911 dbSNP
rs1275131742 912 dbSNP
rs1055642 916 dbSNP
rs1268137371 926 dbSNP
rs1464544085 935 dbSNP
rs1340035947 936 dbSNP
rs1186883341 937 dbSNP
rs976218895 940 dbSNP
rs1357264583 943 dbSNP
rs1392298158 949 dbSNP
rs1446142354 950 dbSNP
rs1029861739 955 dbSNP
rs1309082901 960 dbSNP
rs1412157141 962 dbSNP
rs1369248252 963 dbSNP
rs1450358072 967 dbSNP
rs1163748357 969 dbSNP
rs953807082 971 dbSNP
rs1459319569 978 dbSNP
rs748458801 988 dbSNP
rs1474713467 989 dbSNP
rs770171680 991 dbSNP
rs1383604424 997 dbSNP
rs963568223 999 dbSNP
rs1251024308 1002 dbSNP
rs1322105492 1007 dbSNP
rs150347670 1025 dbSNP
rs974093501 1029 dbSNP
rs1292200568 1038 dbSNP
rs1026310813 1045 dbSNP
rs138145041 1048 dbSNP
rs982140920 1052 dbSNP
rs1289302438 1057 dbSNP
rs949315250 1062 dbSNP
rs1298083606 1064 dbSNP
rs570405335 1068 dbSNP
rs532995891 1079 dbSNP
rs1321075165 1087 dbSNP
rs777370555 1088 dbSNP
rs748986135 1093 dbSNP
rs1471477760 1096 dbSNP
rs1407035832 1097 dbSNP
rs1328536822 1099 dbSNP
rs770345743 1122 dbSNP
rs549690244 1128 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' agacaGA-AAAC-GAUGUGUAa 5'
               || |||| :||||||| 
Target 5' uaucaCUAUUUGUUUACACAUu 3'
 		1 - 22
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000366928.5 | 3UTR | UAUCACUAUUUGUUUACACAUUCACCACUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
239 hsa-miR-511-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT068303 KATNAL1 katanin catalytic subunit A1 like 1 2 2
MIRT072025 SCP2 sterol carrier protein 2 2 2
MIRT073626 IGF1R insulin like growth factor 1 receptor 2 2
MIRT080574 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 2 8
MIRT094167 PCGF3 polycomb group ring finger 3 2 4
MIRT096536 LIFR LIF receptor alpha 2 2
MIRT156224 SLC25A12 solute carrier family 25 member 12 2 2
MIRT177714 ADO 2-aminoethanethiol dioxygenase 2 2
MIRT184922 ZNF268 zinc finger protein 268 2 2
MIRT185107 LYPLAL1 lysophospholipase like 1 2 2
MIRT193093 MAPK6 mitogen-activated protein kinase 6 2 2
MIRT213346 TADA2B transcriptional adaptor 2B 2 2
MIRT225350 SDCBP syndecan binding protein 2 2
MIRT226972 AKAP2 A-kinase anchoring protein 2 2 6
MIRT226977 PALM2-AKAP2 PALM2-AKAP2 readthrough 2 6
MIRT229844 YIPF6 Yip1 domain family member 6 2 2
MIRT230994 PRRG4 proline rich and Gla domain 4 2 2
MIRT270215 ATP2A2 ATPase sarcoplasmic/endoplasmic reticulum Ca2+ transporting 2 2 4
MIRT277060 NDFIP2 Nedd4 family interacting protein 2 2 4
MIRT278336 CFL2 cofilin 2 2 4
MIRT280390 CALM1 calmodulin 1 2 2
MIRT298042 BACH1 BTB domain and CNC homolog 1 2 2
MIRT302449 CLIP4 CAP-Gly domain containing linker protein family member 4 2 2
MIRT311937 HNRNPA0 heterogeneous nuclear ribonucleoprotein A0 2 4
MIRT329263 AIMP1 aminoacyl tRNA synthetase complex interacting multifunctional protein 1 2 2
MIRT359186 F2RL1 F2R like trypsin receptor 1 2 6
MIRT363208 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 2
MIRT371124 YTHDC1 YTH domain containing 1 2 2
MIRT386755 TAOK1 TAO kinase 1 2 2
MIRT395122 BAHD1 bromo adjacent homology domain containing 1 2 2
MIRT396089 MKLN1 muskelin 1 2 2
MIRT443566 EVX2 even-skipped homeobox 2 2 2
MIRT447626 CUL3 cullin 3 2 2
MIRT447680 ZNF264 zinc finger protein 264 2 2
MIRT451053 NT5C1B 5'-nucleotidase, cytosolic IB 2 2
MIRT452048 NT5C1B-RDH14 NT5C1B-RDH14 readthrough 2 2
MIRT459890 KIAA1191 KIAA1191 2 4
MIRT464483 UGCG UDP-glucose ceramide glucosyltransferase 2 2
MIRT465264 TRIM44 tripartite motif containing 44 2 2
MIRT467570 SLITRK4 SLIT and NTRK like family member 4 2 2
MIRT467800 SLC2A14 solute carrier family 2 member 14 2 2
MIRT469543 RASAL2 RAS protein activator like 2 2 2
MIRT469931 PTPRJ protein tyrosine phosphatase, receptor type J 2 4
MIRT474056 LMNB2 lamin B2 2 2
MIRT474097 LMBR1L limb development membrane protein 1 like 2 2
MIRT475183 INSIG2 insulin induced gene 2 2 6
MIRT484264 FAM177A1 family with sequence similarity 177 member A1 2 2
MIRT487567 LOXL2 lysyl oxidase like 2 2 2
MIRT499080 CBWD1 COBW domain containing 1 2 6
MIRT499126 CBWD5 COBW domain containing 5 2 6
MIRT502093 KPNA5 karyopherin subunit alpha 5 2 8
MIRT503328 SOX5 SRY-box 5 2 6
MIRT503839 NCAM2 neural cell adhesion molecule 2 2 6
MIRT504030 CEP104 centrosomal protein 104 2 4
MIRT504314 LHFPL5 LHFPL tetraspan subfamily member 5 2 8
MIRT504525 BVES blood vessel epicardial substance 2 6
MIRT504680 CYGB cytoglobin 2 4
MIRT504815 DOCK7 dedicator of cytokinesis 7 2 4
MIRT505757 SENP1 SUMO1/sentrin specific peptidase 1 2 8
MIRT506151 PLEKHA3 pleckstrin homology domain containing A3 2 6
MIRT506908 KCNJ3 potassium voltage-gated channel subfamily J member 3 2 6
MIRT508259 CD226 CD226 molecule 2 2
MIRT508307 XRCC3 X-ray repair cross complementing 3 2 4
MIRT508784 CDKL1 cyclin dependent kinase like 1 2 6
MIRT508897 C4orf29 abhydrolase domain containing 18 2 6
MIRT508967 TECRL trans-2,3-enoyl-CoA reductase like 2 4
MIRT508973 MLLT3 MLLT3, super elongation complex subunit 2 6
MIRT509149 TSC22D3 TSC22 domain family member 3 2 4
MIRT509188 TSPAN2 tetraspanin 2 2 4
MIRT509212 BRCC3 BRCA1/BRCA2-containing complex subunit 3 2 4
MIRT509214 SEC23IP SEC23 interacting protein 2 6
MIRT509237 PDE10A phosphodiesterase 10A 2 6
MIRT509248 OTX1 orthodenticle homeobox 1 2 6
MIRT509469 TRIM2 tripartite motif containing 2 2 4
MIRT509754 EFCAB11 EF-hand calcium binding domain 11 2 4
MIRT509805 CHAF1B chromatin assembly factor 1 subunit B 2 4
MIRT509938 USP25 ubiquitin specific peptidase 25 2 4
MIRT509954 ITGA1 integrin subunit alpha 1 2 6
MIRT509965 KANSL1L KAT8 regulatory NSL complex subunit 1 like 2 4
MIRT509988 GTF2H1 general transcription factor IIH subunit 1 2 4
MIRT510036 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 2 6
MIRT510164 STARD8 StAR related lipid transfer domain containing 8 2 4
MIRT510199 CYP4F11 cytochrome P450 family 4 subfamily F member 11 2 9
MIRT510249 ATP5S ATP synthase, H+ transporting, mitochondrial Fo complex subunit s (factor B) 2 6
MIRT510502 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 2 2
MIRT510906 PURA purine rich element binding protein A 2 4
MIRT511051 NRF1 nuclear respiratory factor 1 2 4
MIRT511273 KLHL23 kelch like family member 23 2 4
MIRT511368 IL6ST interleukin 6 signal transducer 2 4
MIRT511521 HMGB2 high mobility group box 2 2 4
MIRT512004 DUSP7 dual specificity phosphatase 7 2 4
MIRT512080 CSRNP3 cysteine and serine rich nuclear protein 3 2 8
MIRT514234 EPOR erythropoietin receptor 2 4
MIRT515327 SLC35E3 solute carrier family 35 member E3 2 4
MIRT515409 WDR72 WD repeat domain 72 2 8
MIRT515973 C9orf156 tRNA methyltransferase O 2 4
MIRT516015 NLGN3 neuroligin 3 2 4
MIRT516271 DBT dihydrolipoamide branched chain transacylase E2 2 10
MIRT516495 GLRX2 glutaredoxin 2 2 4
MIRT517272 ANG angiogenin 2 4
MIRT517511 KCNK12 potassium two pore domain channel subfamily K member 12 2 4
MIRT517555 VENTX VENT homeobox 2 4
MIRT519511 RBM22 RNA binding motif protein 22 2 4
MIRT520350 UBN2 ubinuclein 2 2 2
MIRT520687 TMED7 transmembrane p24 trafficking protein 7 2 4
MIRT520960 SRGAP2 SLIT-ROBO Rho GTPase activating protein 2 2 2
MIRT521759 PPIL1 peptidylprolyl isomerase like 1 2 6
MIRT522036 PAPSS2 3'-phosphoadenosine 5'-phosphosulfate synthase 2 2 4
MIRT522127 NELL2 neural EGFL like 2 2 4
MIRT522624 MAP7D1 MAP7 domain containing 1 2 4
MIRT522761 LDLR low density lipoprotein receptor 2 6
MIRT522924 KAT6A lysine acetyltransferase 6A 2 6
MIRT523391 GRIN2B glutamate ionotropic receptor NMDA type subunit 2B 2 4
MIRT523851 ETV6 ETS variant 6 2 2
MIRT523890 EPHA5 EPH receptor A5 2 4
MIRT523945 E2F8 E2F transcription factor 8 2 4
MIRT524222 DCUN1D3 defective in cullin neddylation 1 domain containing 3 2 2
MIRT524410 CNTNAP5 contactin associated protein like 5 2 4
MIRT524568 CALML4 calmodulin like 4 2 4
MIRT524611 ENTHD1 ENTH domain containing 1 2 2
MIRT524907 AMMECR1 Alport syndrome, mental retardation, midface hypoplasia and elliptocytosis chromosomal region gene 1 2 4
MIRT525019 ABHD13 abhydrolase domain containing 13 2 6
MIRT525211 C19orf12 chromosome 19 open reading frame 12 2 2
MIRT528253 BMS1 BMS1, ribosome biogenesis factor 2 2
MIRT528294 ZNF76 zinc finger protein 76 2 2
MIRT531898 INVS inversin 2 4
MIRT535962 MOGAT1 monoacylglycerol O-acyltransferase 1 2 2
MIRT540823 SSPN sarcospan 2 4
MIRT541836 CDON cell adhesion associated, oncogene regulated 2 4
MIRT541914 BMPR1A bone morphogenetic protein receptor type 1A 2 4
MIRT542156 KIAA2018 upstream transcription factor family member 3 2 6
MIRT542175 SERTM1 serine rich and transmembrane domain containing 1 2 6
MIRT542217 IRS1 insulin receptor substrate 1 2 4
MIRT542225 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 6
MIRT543654 PLEKHM3 pleckstrin homology domain containing M3 2 2
MIRT544097 EDA2R ectodysplasin A2 receptor 2 2
MIRT544533 SPPL3 signal peptide peptidase like 3 2 2
MIRT544954 TUB tubby bipartite transcription factor 2 4
MIRT545027 PLP1 proteolipid protein 1 2 2
MIRT546524 SERTAD3 SERTA domain containing 3 2 2
MIRT547242 OSBPL9 oxysterol binding protein like 9 2 4
MIRT548198 FNIP1 folliculin interacting protein 1 2 2
MIRT548272 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT549480 ACBD5 acyl-CoA binding domain containing 5 2 2
MIRT549498 ABI2 abl interactor 2 2 2
MIRT550325 SMAD9 SMAD family member 9 2 2
MIRT550563 CYP4V2 cytochrome P450 family 4 subfamily V member 2 2 6
MIRT550642 AR androgen receptor 2 2
MIRT550945 CTSE cathepsin E 2 4
MIRT550961 POT1 protection of telomeres 1 2 2
MIRT551178 ATP7A ATPase copper transporting alpha 2 2
MIRT551416 LRRC31 leucine rich repeat containing 31 2 2
MIRT551507 ADH1B alcohol dehydrogenase 1B (class I), beta polypeptide 2 2
MIRT551517 MMADHC methylmalonic aciduria and homocystinuria, cblD type 2 2
MIRT551550 TMEM133 transmembrane protein 133 2 2
MIRT551757 TRIM42 tripartite motif containing 42 2 2
MIRT551872 TMEM47 transmembrane protein 47 2 2
MIRT551882 EPHA1 EPH receptor A1 2 2
MIRT551917 IGLON5 IgLON family member 5 2 2
MIRT552377 ZNF562 zinc finger protein 562 2 2
MIRT552543 ZHX3 zinc fingers and homeoboxes 3 2 2
MIRT553419 TRAF5 TNF receptor associated factor 5 2 2
MIRT554080 SNX4 sorting nexin 4 2 4
MIRT554588 RRAGC Ras related GTP binding C 2 2
MIRT554887 RCC2 regulator of chromosome condensation 2 2 2
MIRT555568 PLCB1 phospholipase C beta 1 2 2
MIRT555819 PCDH11Y protocadherin 11 Y-linked 2 4
MIRT555969 NR3C1 nuclear receptor subfamily 3 group C member 1 2 2
MIRT556028 MXD1 MAX dimerization protein 1 2 2
MIRT556206 MBNL2 muscleblind like splicing regulator 2 2 2
MIRT556251 MARCH3 membrane associated ring-CH-type finger 3 2 2
MIRT557265 HMGN3 high mobility group nucleosomal binding domain 3 2 2
MIRT557334 HHIP hedgehog interacting protein 2 2
MIRT557427 GXYLT2 glucoside xylosyltransferase 2 2 4
MIRT557537 GPBP1L1 GC-rich promoter binding protein 1 like 1 2 2
MIRT557797 FREM2 FRAS1 related extracellular matrix protein 2 2 2
MIRT557805 FOXP1 forkhead box P1 2 2
MIRT558569 CRIM1 cysteine rich transmembrane BMP regulator 1 2 2
MIRT558734 CHORDC1 cysteine and histidine rich domain containing 1 2 2
MIRT558878 CCSER2 coiled-coil serine rich protein 2 2 2
MIRT558933 CBX1 chromobox 1 2 2
MIRT559133 BTG3 BTG anti-proliferation factor 3 2 4
MIRT559168 BRWD3 bromodomain and WD repeat domain containing 3 2 4
MIRT559618 AMER1 APC membrane recruitment protein 1 2 2
MIRT561627 SERBP1 SERPINE1 mRNA binding protein 1 2 2
MIRT561971 LRRC59 leucine rich repeat containing 59 2 2
MIRT563049 ZNF138 zinc finger protein 138 2 2
MIRT563432 TRIM13 tripartite motif containing 13 2 4
MIRT563540 RBM41 RNA binding motif protein 41 2 2
MIRT564647 ZNF544 zinc finger protein 544 2 2
MIRT567674 EIF5 eukaryotic translation initiation factor 5 2 2
MIRT567755 DLC1 DLC1 Rho GTPase activating protein 2 2
MIRT568267 BICD2 BICD cargo adaptor 2 2 2
MIRT569160 SIGMAR1 sigma non-opioid intracellular receptor 1 2 2
MIRT569179 DMD dystrophin 2 2
MIRT569427 DCAF8 DDB1 and CUL4 associated factor 8 2 2
MIRT569853 RGS5 regulator of G protein signaling 5 2 2
MIRT570554 PLAG1 PLAG1 zinc finger 2 2
MIRT571233 SYT9 synaptotagmin 9 2 2
MIRT572276 KCNJ6 potassium voltage-gated channel subfamily J member 6 2 2
MIRT572539 ZFHX2 zinc finger homeobox 2 2 2
MIRT574271 ZNF350 zinc finger protein 350 2 2
MIRT574428 SMC1A structural maintenance of chromosomes 1A 2 2
MIRT574671 HNRNPDL heterogeneous nuclear ribonucleoprotein D like 2 2
MIRT576699 Hps3 HPS3, biogenesis of lysosomal organelles complex 2 subunit 1 2 2
MIRT607889 SATB1 SATB homeobox 1 2 2
MIRT608846 FGF14 fibroblast growth factor 14 2 6
MIRT608854 SPATA6 spermatogenesis associated 6 2 2
MIRT608879 CNTF ciliary neurotrophic factor 2 6
MIRT608899 ZNF860 zinc finger protein 860 2 2
MIRT608948 C12orf60 chromosome 12 open reading frame 60 2 2
MIRT609029 CDH6 cadherin 6 2 2
MIRT609063 LPP LIM domain containing preferred translocation partner in lipoma 2 4
MIRT612277 ZNF280B zinc finger protein 280B 2 2
MIRT612520 SEPT7 septin 7 2 2
MIRT617202 GREM1 gremlin 1, DAN family BMP antagonist 2 2
MIRT618700 KIF13A kinesin family member 13A 2 2
MIRT619141 AFF2 AF4/FMR2 family member 2 2 2
MIRT621071 RAB11FIP3 RAB11 family interacting protein 3 2 6
MIRT627811 PTCHD1 patched domain containing 1 2 4
MIRT641782 ZBTB20 zinc finger and BTB domain containing 20 2 2
MIRT657645 GPRC5A G protein-coupled receptor class C group 5 member A 2 2
MIRT669313 C16orf72 chromosome 16 open reading frame 72 2 2
MIRT674602 PHKA1 phosphorylase kinase regulatory subunit alpha 1 2 2
MIRT684064 CPPED1 calcineurin like phosphoesterase domain containing 1 2 2
MIRT685149 TACR3 tachykinin receptor 3 2 2
MIRT693446 PIK3CG phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit gamma 2 2
MIRT693808 WDR3 WD repeat domain 3 2 2
MIRT703845 ETV3 ETS variant 3 2 2
MIRT707100 ZNF850 zinc finger protein 850 2 2
MIRT707375 SVIP small VCP interacting protein 2 2
MIRT707467 ROCK2 Rho associated coiled-coil containing protein kinase 2 2 2
MIRT707514 PPP1R16B protein phosphatase 1 regulatory subunit 16B 2 2
MIRT707542 ADAMTS9 ADAM metallopeptidase with thrombospondin type 1 motif 9 2 2
MIRT707560 CLVS2 clavesin 2 2 2
MIRT708113 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 2
MIRT708217 ADD2 adducin 2 2 2
MIRT710678 MX2 MX dynamin like GTPase 2 2 2
MIRT755898 ZFPM2-AS1 ZFPM2 antisense RNA 1 3 1
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-511-3p Doxorubicin 31703 NSC123127 approved resistant High Anaplastic Thyroid Cancer tissue
hsa-miR-511-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)

Error report submission