miRTarBase - #MIRT186262


—
pre-miRNA Information
pre-miRNA hsa-mir-125b-2   
Genomic Coordinates chr21: 16590237 - 16590325
Synonyms MIRN125B2, MIR125B2
Description Homo sapiens miR-125b-2 stem-loop
Comment This miRNA sequence is predicted based on homology to a verified miRNA from mouse .
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-125b-2-3p
Sequence 54| UCACAAGUCAGGCUCUUGGGAC |75
Evidence Experimental
Experiments Cloned
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 3 21 + 16590292 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs575583557 6 dbSNP
rs1331783293 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol TCEB3
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 6924.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' caggguucucggacUGAACACu 5'
                        ||||||| 
Target 5' ----------aaaaACUUGUGc 3'
 		1 - 12
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000418390.2 | 3UTR | AAAAACUUGUGCAAUUUUUUUUCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE19783 ER- ER- breast cancer -0.329 1.5e-3 -0.317 2.2e-3 79 Click to see details
GSE19536 Breast cancer -0.279 2.5e-3 -0.272 3.1e-3 100 Click to see details
GSE28544 Breast cancer 0.444 1.5e-2 0.449 1.4e-2 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.409 2.1e-2 -0.422 1.8e-2 25 Click to see details
GSE19350 CNS germ cell tumors -0.508 4.6e-2 -0.519 4.2e-2 12 Click to see details
GSE42095 Differentiated embryonic stem cells -0.353 4.9e-2 -0.389 3.3e-2 23 Click to see details
GSE21687 Ependynoma primary tumors -0.185 7.2e-2 -0.165 9.6e-2 64 Click to see details
GSE28260 Renal cortex and medulla 0.415 7.9e-2 0.401 8.7e-2 13 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.937 1.1e-1 1.000 5.0e-1 3 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.258 1.4e-1 0.114 3.2e-1 20 Click to see details
GSE17498 Multiple myeloma 0.153 1.7e-1 0.275 4.3e-2 40 Click to see details
GSE26953 Aortic valvular endothelial cells -0.183 2.0e-1 -0.114 3.0e-1 24 Click to see details
GSE38226 Liver fibrosis 0.176 2.2e-1 -0.044 4.2e-1 21 Click to see details
GSE32688 Pancreatic cancer -0.116 2.6e-1 -0.093 3.1e-1 32 Click to see details
GSE19783 ER+ ER+ breast cancer -0.091 3.5e-1 -0.113 3.2e-1 20 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.056 4.0e-1 0.224 1.4e-1 25 Click to see details
GSE21032 Prostate cancer -0.017 4.4e-1 -0.059 3.0e-1 83 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
THCA 0.327 0.01 0.325 0.01 59 Click to see details
PRAD 0.291 0.02 0.264 0.03 50 Click to see details
PAAD -0.947 0.03 -1.000 0.5 4 Click to see details
LIHC 0.247 0.04 0.203 0.08 49 Click to see details
PCPG 0.983 0.06 1.000 0.5 3 Click to see details
STAD -0.277 0.06 -0.184 0.16 32 Click to see details
LUSC -0.238 0.08 -0.203 0.11 38 Click to see details
BRCA -0.157 0.08 -0.177 0.05 84 Click to see details
KIRC -0.151 0.11 -0.151 0.11 68 Click to see details
UCEC 0.291 0.11 0.081 0.37 19 Click to see details
CESC 0.906 0.14 1.000 0.5 3 Click to see details
KICH 0.224 0.14 0.165 0.22 25 Click to see details
COAD 0.401 0.16 0.548 0.08 8 Click to see details
KIRP -0.15 0.21 -0.160 0.19 32 Click to see details
CHOL -0.29 0.22 0.000 0.5 9 Click to see details
ESCA 0.252 0.23 0.318 0.17 11 Click to see details
LUAD -0.213 0.25 -0.308 0.17 12 Click to see details
HNSC 0.028 0.43 0.091 0.28 42 Click to see details
BLCA -0.007 0.49 -0.195 0.22 18 Click to see details
BLCA -0.007 0.49 -0.195 0.22 18 Click to see details
BLCA -0.007 0.49 -0.195 0.22 18 Click to see details
91 hsa-miR-125b-2-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT038624 HN1L Jupiter microtubule associated homolog 2 1 1
MIRT038625 KDELC2 KDEL motif containing 2 1 1
MIRT038626 ABHD15 abhydrolase domain containing 15 1 1
MIRT038627 PPP1R12C protein phosphatase 1 regulatory subunit 12C 1 1
MIRT038628 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 1 1
MIRT038629 ASH2L ASH2 like histone lysine methyltransferase complex subunit 1 1
MIRT038630 USP22 ubiquitin specific peptidase 22 1 1
MIRT038631 CSTB cystatin B 1 1
MIRT038632 SYT2 synaptotagmin 2 1 1
MIRT038633 NDUFS7 NADH:ubiquinone oxidoreductase core subunit S7 1 1
MIRT038634 MTA2 metastasis associated 1 family member 2 1 1
MIRT053086 IGF1R insulin like growth factor 1 receptor 3 1
MIRT055788 PLEKHA1 pleckstrin homology domain containing A1 2 12
MIRT061248 AMOTL1 angiomotin like 1 2 10
MIRT061649 BTG2 BTG anti-proliferation factor 2 2 6
MIRT079046 TNRC6C trinucleotide repeat containing 6C 2 4
MIRT084583 BCL2L11 BCL2 like 11 2 8
MIRT093523 GALNT7 polypeptide N-acetylgalactosaminyltransferase 7 2 2
MIRT097383 LHFPL2 LHFPL tetraspan subfamily member 2 2 4
MIRT098030 SOBP sine oculis binding protein homolog 2 2
MIRT186262 TCEB3 elongin A 2 2
MIRT187284 DAZAP2 DAZ associated protein 2 2 10
MIRT361113 LRRC1 leucine rich repeat containing 1 2 2
MIRT443585 FAM84B family with sequence similarity 84 member B 2 2
MIRT452249 TRAM1 translocation associated membrane protein 1 2 2
MIRT476289 GMFB glia maturation factor beta 2 8
MIRT483871 MRPL12 mitochondrial ribosomal protein L12 2 2
MIRT484250 ANK1 ankyrin 1 2 2
MIRT499251 VAV3 vav guanine nucleotide exchange factor 3 2 4
MIRT502270 HNRNPA1 heterogeneous nuclear ribonucleoprotein A1 2 4
MIRT504652 RPL9 ribosomal protein L9 2 6
MIRT505210 UBN2 ubinuclein 2 2 6
MIRT512690 POP1 POP1 homolog, ribonuclease P/MRP subunit 2 2
MIRT517341 ZNF529 zinc finger protein 529 2 4
MIRT518946 LSG1 large 60S subunit nuclear export GTPase 1 2 2
MIRT520866 SUGT1 SGT1 homolog, MIS12 kinetochore complex assembly cochaperone 2 2
MIRT521236 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT528324 GIGYF2 GRB10 interacting GYF protein 2 2 2
MIRT533297 USP46 ubiquitin specific peptidase 46 2 2
MIRT541024 WEE1 WEE1 G2 checkpoint kinase 2 4
MIRT544034 ERRFI1 ERBB receptor feedback inhibitor 1 2 2
MIRT547037 POGZ pogo transposable element derived with ZNF domain 2 2
MIRT556102 MOAP1 modulator of apoptosis 1 2 2
MIRT558320 DR1 down-regulator of transcription 1 2 2
MIRT558520 CSRNP3 cysteine and serine rich nuclear protein 3 2 2
MIRT566230 PTMA prothymosin, alpha 2 4
MIRT568437 ARPP19 cAMP regulated phosphoprotein 19 2 2
MIRT570584 OTUD7B OTU deubiquitinase 7B 2 2
MIRT571384 JKAMP JNK1/MAPK8-associated membrane protein 2 2
MIRT572798 SIGLEC14 sialic acid binding Ig like lectin 14 2 2
MIRT573864 C9orf78 chromosome 9 open reading frame 78 2 2
MIRT609930 SLC38A1 solute carrier family 38 member 1 2 4
MIRT610437 CSMD2 CUB and Sushi multiple domains 2 2 2
MIRT614407 MURC caveolae associated protein 4 2 2
MIRT618625 GREB1 growth regulation by estrogen in breast cancer 1 2 2
MIRT620605 SAP30 Sin3A associated protein 30 2 2
MIRT635313 FAM179A TOG array regulator of axonemal microtubules 2 2 2
MIRT635918 GLTSCR2 NOP53 ribosome biogenesis factor 2 2
MIRT638507 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 2
MIRT640597 TM9SF4 transmembrane 9 superfamily member 4 2 2
MIRT644066 IQCE IQ motif containing E 2 2
MIRT648287 TRAPPC2L trafficking protein particle complex 2 like 2 2
MIRT653089 SSR3 signal sequence receptor subunit 3 2 2
MIRT654651 PTAFR platelet activating factor receptor 2 2
MIRT658084 FOXR2 forkhead box R2 2 2
MIRT665306 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT665974 SYTL4 synaptotagmin like 4 2 2
MIRT674905 RASSF9 Ras association domain family member 9 2 2
MIRT680085 THAP1 THAP domain containing 1 2 2
MIRT681487 DIP2A disco interacting protein 2 homolog A 2 2
MIRT691243 DFNB59 pejvakin 2 2
MIRT692361 AGTRAP angiotensin II receptor associated protein 2 2
MIRT693034 MB21D1 Mab-21 domain containing 1 2 2
MIRT694478 LRTOMT leucine rich transmembrane and O-methyltransferase domain containing 2 2
MIRT696069 ZNF264 zinc finger protein 264 2 2
MIRT696579 TTC21B tetratricopeptide repeat domain 21B 2 2
MIRT696759 MTFMT mitochondrial methionyl-tRNA formyltransferase 2 2
MIRT697306 ZNF652 zinc finger protein 652 2 2
MIRT698736 STX12 syntaxin 12 2 2
MIRT701055 PARP2 poly(ADP-ribose) polymerase 2 2 2
MIRT701197 OTUD3 OTU deubiquitinase 3 2 2
MIRT701334 NSD1 nuclear receptor binding SET domain protein 1 2 2
MIRT703617 FBXO45 F-box protein 45 2 2
MIRT708893 ZNF780A zinc finger protein 780A 2 2
MIRT711621 DGKH diacylglycerol kinase eta 2 2
MIRT713744 TMEM81 transmembrane protein 81 2 2
MIRT715060 TMTC1 transmembrane and tetratricopeptide repeat containing 1 2 2
MIRT719711 CD101 CD101 molecule 2 2
MIRT720293 DLGAP3 DLG associated protein 3 2 2
MIRT722605 CCDC152 coiled-coil domain containing 152 2 2
MIRT724565 ACSBG1 acyl-CoA synthetase bubblegum family member 1 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-125b-2 Ascorbate approved 54670067 Microarray Metastatic melanoma cell lines 25202679 2014 up-regualted
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-125b-2 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-125b-2 Methotrexate 126941 NSC740 approved resistant High Colorectal Adenocarcinoma cell line (HT-29)
hsa-mir-125b-2 Imatinib 5291 NSC743414 approved resistant High Chronic Myelogenous Leukemia tissue
hsa-mir-125b-2 Doxorubicin 31703 NSC123127 approved sensitive Low Hepatocellular Carcinoma cell line (Huh-7, HLE, HuH1)
hsa-mir-125b-2 Dabrafenib 44462760 NSC764134 approved resistant High Melanoma cell line (A375)
hsa-mir-125b-2 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-125b-2 Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-mir-125b-2 Topotecan 60699 NSC609699 approved resistant cell line (W1)
hsa-mir-125b-2 Vincristine 5978 approved resistant cell line (W1)
hsa-mir-125b-2 Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-mir-125b-2 Tamoxifen 2733525 NSC180973 approved resistant tissue (ER-positive breast cancer)
hsa-mir-125b-2 Tamoxifen 2733525 NSC180973 approved sensitive cell line (MCF7)
hsa-mir-125b-2 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-125b-2-3p Platinum 23939 resistant High Ovarian Cancer tissue
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer tissue
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (BGC823)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (SGC-7901)
hsa-miR-125b-2-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-125b-2-3p Dabrafenib 44462760 NSC764134 approved sensitive High Melanoma cell line (A375, IGR37, 501Mel)
hsa-miR-125b-2-3p Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer tissue
hsa-miR-125b-2-3p Fluorouracil 3385 NSC19893 approved resistant High Gastric Cancer tissue
hsa-miR-125b-2-3p Cyclophosphamide + Doxorubicin + Vincristine + Prednisone + Rituximab resistant High Diffuse Large B-Cell Lymphoma cell line (SU-DHL-2)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant High Gastric Cancer cell line (SGC-7901, BGC-823)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant High Lung Adenocarcinoma cell line (A549)
hsa-miR-125b-2-3p Oxaliplatin 6857599 NSC266046 approved sensitive Low Colorectal Cancer cell line (HCT8, HCT-116)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780)
hsa-miR-125b-2-3p Antiepileptic Drug sensitive High Pediatric Epilepsy tissue
hsa-miR-125b-2-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (451Lu)
hsa-miR-125b-2-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-miR-125b-2-3p 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-miR-125b-2-3p Ethanol+Tamoxifen resistant cell line (LY2)
hsa-miR-125b-2-3p Methotrexate 126941 NSC740 approved resistant cell line (HT29)
hsa-miR-125b-2-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-125b-2-3p Oxaliplatin 6857599 NSC266046 approved resistant cell line (IGROV-1)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant cell line (IGROV-1)
hsa-miR-125b-2-3p Paclitaxel 36314 NSC125973 approved resistant cell line (PC3PR70)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-125b-2-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-125b-2-3p Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)
hsa-miR-125b-2-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A2780)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant cell line (SGC-7901)
hsa-miR-125b-2-3p Cisplatin 5460033 NSC119875 approved resistant cell line (BGC-823)

Error report submission