miRTarBase - #MIRT187759


—
pre-miRNA Information
pre-miRNA hsa-mir-3607   
Genomic Coordinates chr5: 86620497 - 86620575
Description Homo sapiens miR-3607 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3607-3p
Sequence 51| ACUGUAAACGCUUUCUGAUG |70
Evidence Experimental
Experiments Illumina
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol ESYT1   
Synonyms FAM62A, MBC2
Description extended synaptotagmin 1
Transcript NM_001184796   
Other Transcripts NM_015292   
Expression
Putative miRNA Targets on ESYT1
3'UTR of ESYT1
(miRNA target sites are highlighted)		 
>ESYT1|NM_001184796|3'UTR
   1 GAGCTGGCGAGTCCCAGCCTGACTGCTCTGTCTTCCTGCCTTCGTCTCGCTCCATCACCGCCTCAATGTGATGAGCCTAA
  81 AGCTAGGGTCCAAGGGCAGAGCCTGTGCCCTTCAGCCCTTTCACCTAACAGGCCCATATTCGGGCCTTTGCCTGACCAAA
 161 GAGAAGAACCGTATGTTCCCTTTACTGCACGGCCTTTATCCTTCTGGGCCCCTGGGGCGGGGACCTGAGCTGGCTGTTTC
 241 CTGCTTTGCCTGCACATTGTTCTCCCTTCCTCCCAACTCCTCAGGGCCTTCTGTATCTGTGCCTGGCCAGTGGCAGCACT
 321 AGCAGTGGTATTAGCTTATGCCAAATACAGCTTTGGAAGGATCTTTTTTTCTTTAACTAGATGGTCACCTTCTTCCCTAC
 401 CACACATGGGTGGGAAGGTGGACAGGCTAACCTCTCCAGCTGTGAGCCTCTTAGACTACTGCATGTAGCAAATGTTCAGC
 481 AGCTCAGGCCCCCATGTCCAGTTCTGTCCCCACTGTCCTCAACCCTGTCCTGAAAATTCTACTGCTTTGATGGCTGGGGC
 561 CAGTCTCTTGTCACTTTGGAAACTGAGGACGCGTGGATTCTACTCAAGCCTCCAAGTAGTGGCATATCAGTCTTGGAGCT
 641 CCTAGCTGGTGATACGGAGAGGGCTTTGGAGGACTTGGGACAGCAGGGCCAATTTTTTTGCCCAAGTGCCTAGGCTGCTA
 721 ACTCACTGACTAGAACTTAATCTGGTACTTTACAGTTTTGCACCAACTCTGCCAAGCCACTGGATCTTACATTAAACATC
 801 ATACTCAAACCAGCAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' guAGUCUUUCGCAAAUGUCa 5'
            || |: | | ||||||| 
Target 5' aaTCTGGTA-C-TTTACAGt 3'
 739 - 756 144.00 -9.00
2 
miRNA  3' guaGUCUUUCGC-AAAUGUCa 5'
             |:||:|| | |||: || 
Target 5' ataCGGAGAGGGCTTTGGAGg 3'
 652 - 672 113.00 -13.30
3 
miRNA  3' guaGUCUUUCGCAAAU-GUCa 5'
             :|| || :||| | ||| 
Target 5' atgTAGCAAATGTTCAGCAGc 3'
 463 - 483 97.00 -6.00
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30188098 44 COSMIC
COSN31539164 49 COSMIC
COSN30469120 60 COSMIC
COSN28860465 61 COSMIC
COSN30153578 65 COSMIC
COSN30508622 68 COSMIC
COSN31553341 143 COSMIC
COSN30506564 152 COSMIC
COSN30127449 171 COSMIC
COSN9564497 183 COSMIC
COSN31594445 191 COSMIC
COSN31553910 192 COSMIC
COSN25583165 345 COSMIC
COSN31530197 372 COSMIC
COSN31595185 411 COSMIC
COSN31540103 431 COSMIC
COSN53200 436 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs780839039 5 dbSNP
rs1417198298 9 dbSNP
rs200267352 10 dbSNP
rs1340252227 13 dbSNP
rs769258880 17 dbSNP
rs750237155 18 dbSNP
rs763204469 26 dbSNP
rs774613823 28 dbSNP
rs1463435308 29 dbSNP
rs748492711 33 dbSNP
rs766577401 37 dbSNP
rs371052067 39 dbSNP
rs751677986 40 dbSNP
rs755053123 41 dbSNP
rs781423986 43 dbSNP
rs201324782 44 dbSNP
rs760880430 45 dbSNP
rs1443572451 47 dbSNP
rs367615669 49 dbSNP
rs759509043 50 dbSNP
rs1167530287 53 dbSNP
rs1346426369 58 dbSNP
rs867314675 60 dbSNP
rs564262924 61 dbSNP
rs1195180595 63 dbSNP
rs528285287 67 dbSNP
rs1276772643 68 dbSNP
rs1002549396 74 dbSNP
rs1187004470 83 dbSNP
rs1480829767 86 dbSNP
rs539541210 93 dbSNP
rs1486824642 94 dbSNP
rs1195026303 97 dbSNP
rs1208129308 101 dbSNP
rs1347345102 104 dbSNP
rs1033572462 111 dbSNP
rs1236846460 123 dbSNP
rs879095151 131 dbSNP
rs540079044 134 dbSNP
rs1304065887 139 dbSNP
rs888119018 141 dbSNP
rs1383232054 142 dbSNP
rs1443822973 143 dbSNP
rs11544851 145 dbSNP
rs772537120 146 dbSNP
rs767092643 149 dbSNP
rs1446644053 158 dbSNP
rs1375580302 162 dbSNP
rs1384040337 162 dbSNP
rs1015334821 168 dbSNP
rs1442308575 171 dbSNP
rs374229598 172 dbSNP
rs546719552 177 dbSNP
rs1430174690 179 dbSNP
rs1375296647 186 dbSNP
rs905163474 189 dbSNP
rs1297994853 192 dbSNP
rs561625653 198 dbSNP
rs768096010 207 dbSNP
rs529183248 208 dbSNP
rs548142316 209 dbSNP
rs976976881 218 dbSNP
rs138834347 219 dbSNP
rs111761171 220 dbSNP
rs895762014 223 dbSNP
rs1243947785 225 dbSNP
rs773538386 240 dbSNP
rs530987623 243 dbSNP
rs1311188651 244 dbSNP
rs954216324 246 dbSNP
rs1020508282 250 dbSNP
rs1355504410 253 dbSNP
rs986131553 254 dbSNP
rs747548864 257 dbSNP
rs904363791 283 dbSNP
rs1407561613 292 dbSNP
rs752250189 298 dbSNP
rs1369574529 303 dbSNP
rs9634276 309 dbSNP
rs1018065139 335 dbSNP
rs1463330190 337 dbSNP
rs1249431033 347 dbSNP
rs963701612 353 dbSNP
rs1163965865 357 dbSNP
rs1418619476 364 dbSNP
rs540400610 364 dbSNP
rs1203897472 367 dbSNP
rs976445671 369 dbSNP
rs1250072393 374 dbSNP
rs1196656355 382 dbSNP
rs1481809199 396 dbSNP
rs142730049 397 dbSNP
rs1029899740 401 dbSNP
rs951583912 418 dbSNP
rs1336137122 422 dbSNP
rs988809776 426 dbSNP
rs147382760 437 dbSNP
rs1264423485 438 dbSNP
rs1226044974 448 dbSNP
rs983065841 452 dbSNP
rs1334730530 453 dbSNP
rs910003912 455 dbSNP
rs1392825911 463 dbSNP
rs1388275496 472 dbSNP
rs1429650548 478 dbSNP
rs1461855145 491 dbSNP
rs962913519 495 dbSNP
rs1170420436 510 dbSNP
rs1156933718 514 dbSNP
rs28546848 516 dbSNP
rs568756005 518 dbSNP
rs1471199936 522 dbSNP
rs1182760306 525 dbSNP
rs866104385 528 dbSNP
rs906372151 539 dbSNP
rs937825143 550 dbSNP
rs1177404042 555 dbSNP
rs1054966699 556 dbSNP
rs1275594468 562 dbSNP
rs1450459832 567 dbSNP
rs888358448 571 dbSNP
rs371024109 576 dbSNP
rs1240699580 584 dbSNP
rs566710782 584 dbSNP
rs1056368247 590 dbSNP
rs188400539 591 dbSNP
rs1441357166 592 dbSNP
rs575136322 593 dbSNP
rs1381561370 594 dbSNP
rs1293427136 604 dbSNP
rs1313723038 623 dbSNP
rs1223906218 625 dbSNP
rs1400083197 630 dbSNP
rs1041641095 635 dbSNP
rs904354268 649 dbSNP
rs1262046745 652 dbSNP
rs1455488392 654 dbSNP
rs191089594 656 dbSNP
rs1000068915 657 dbSNP
rs1255341028 659 dbSNP
rs114006098 661 dbSNP
rs1029388269 663 dbSNP
rs1284294199 677 dbSNP
rs1206396292 687 dbSNP
rs572630097 688 dbSNP
rs1007020549 693 dbSNP
rs954363844 693 dbSNP
rs14483 695 dbSNP
rs957602380 696 dbSNP
rs997951784 697 dbSNP
rs1485281977 698 dbSNP
rs58663297 699 dbSNP
rs561366705 704 dbSNP
rs913253657 707 dbSNP
rs142500100 718 dbSNP
rs1373771643 726 dbSNP
rs1173224320 729 dbSNP
rs1435618079 732 dbSNP
rs981941511 735 dbSNP
rs1166542073 739 dbSNP
rs1475342852 742 dbSNP
rs1243208826 747 dbSNP
rs1428814151 759 dbSNP
rs1468455267 764 dbSNP
rs1440171230 766 dbSNP
rs927359241 769 dbSNP
rs937879487 773 dbSNP
rs80289666 774 dbSNP
rs1054874558 777 dbSNP
rs544181806 784 dbSNP
rs1213777824 797 dbSNP
rs1339910039 803 dbSNP
rs909830423 804 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 23344.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' guagucuuucgcAAAUGUCa 5'
                      ||||||| 
Target 5' ---------uacUUUACAGu 3'
 		1 - 11
Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
CLIP-seq Support 1 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000394048.5 | 3UTR | UACUUUACAGUUUUGCACCAACUCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRC -0.355 0 -0.319 0 68 Click to see details
BRCA -0.311 0 -0.279 0.01 84 Click to see details
STAD -0.478 0 -0.498 0 30 Click to see details
ESCA -0.731 0.01 -0.636 0.02 11 Click to see details
PRAD -0.245 0.04 -0.252 0.04 50 Click to see details
THCA 0.21 0.06 0.095 0.24 59 Click to see details
LIHC -0.19 0.1 -0.240 0.05 49 Click to see details
HNSC -0.182 0.13 -0.212 0.09 41 Click to see details
CESC -0.91 0.14 -0.500 0.33 3 Click to see details
LUAD -0.337 0.14 -0.378 0.11 12 Click to see details
PCPG 0.886 0.15 0.500 0.33 3 Click to see details
PAAD -0.659 0.17 -0.200 0.4 4 Click to see details
KICH -0.197 0.17 -0.210 0.16 25 Click to see details
KIRP -0.156 0.2 -0.102 0.29 32 Click to see details
BLCA 0.175 0.25 0.140 0.3 17 Click to see details
UCEC -0.142 0.28 -0.168 0.25 19 Click to see details
CHOL -0.077 0.42 -0.200 0.3 9 Click to see details
LUSC 0.004 0.49 -0.005 0.49 38 Click to see details
LUSC 0.004 0.49 -0.005 0.49 38 Click to see details
93 hsa-miR-3607-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT057680 LCOR ligand dependent nuclear receptor corepressor 2 2
MIRT058092 EIF4G2 eukaryotic translation initiation factor 4 gamma 2 2 4
MIRT063624 FBXO28 F-box protein 28 2 2
MIRT071884 BTF3L4 basic transcription factor 3 like 4 2 2
MIRT079440 FOXK2 forkhead box K2 2 4
MIRT080491 BCL10 B-cell CLL/lymphoma 10 2 2
MIRT081214 MIDN midnolin 2 10
MIRT082786 ZNF264 zinc finger protein 264 2 2
MIRT082862 ZNF543 zinc finger protein 543 2 4
MIRT099112 FOXC1 forkhead box C1 2 4
MIRT099343 QKI QKI, KH domain containing RNA binding 2 2
MIRT100913 CD2AP CD2 associated protein 2 2
MIRT104030 USP42 ubiquitin specific peptidase 42 2 6
MIRT130023 QSER1 glutamine and serine rich 1 2 2
MIRT142614 IL21R interleukin 21 receptor 2 2
MIRT143477 CHD9 chromodomain helicase DNA binding protein 9 2 2
MIRT187759 ESYT1 extended synaptotagmin 1 2 2
MIRT200250 EVI5 ecotropic viral integration site 5 2 2
MIRT212867 N4BP2 NEDD4 binding protein 2 2 2
MIRT219622 GIGYF1 GRB10 interacting GYF protein 1 2 8
MIRT220244 FAM3C family with sequence similarity 3 member C 2 6
MIRT222069 PURB purine rich element binding protein B 2 2
MIRT243478 TRIM71 tripartite motif containing 71 2 2
MIRT261690 PLEKHA1 pleckstrin homology domain containing A1 2 2
MIRT320184 ITGB8 integrin subunit beta 8 2 2
MIRT441644 CCNB1IP1 cyclin B1 interacting protein 1 2 6
MIRT441965 BACE2 beta-site APP-cleaving enzyme 2 2 2
MIRT442175 TRIM59 tripartite motif containing 59 2 4
MIRT442716 TNKS tankyrase 2 2
MIRT443932 ZNF418 zinc finger protein 418 2 2
MIRT445790 ALG13 ALG13, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT448148 P2RY10 purinergic receptor P2Y10 2 2
MIRT463393 ZDHHC20 zinc finger DHHC-type containing 20 2 2
MIRT463761 YPEL2 yippee like 2 2 2
MIRT477233 ETF1 eukaryotic translation termination factor 1 2 2
MIRT483464 DR1 down-regulator of transcription 1 2 6
MIRT484110 ABCD2 ATP binding cassette subfamily D member 2 2 4
MIRT487297 SLC38A9 solute carrier family 38 member 9 2 2
MIRT501292 RRN3 RRN3 homolog, RNA polymerase I transcription factor 2 4
MIRT501343 RNF44 ring finger protein 44 2 4
MIRT502696 CSNK1G1 casein kinase 1 gamma 1 2 4
MIRT511075 NIPA1 non imprinted in Prader-Willi/Angelman syndrome 1 2 4
MIRT511243 KLHL36 kelch like family member 36 2 6
MIRT531418 PLBD2 phospholipase B domain containing 2 2 2
MIRT536603 IRF2 interferon regulatory factor 2 2 2
MIRT537727 ELAVL2 ELAV like RNA binding protein 2 2 2
MIRT537985 DPP8 dipeptidyl peptidase 8 2 2
MIRT539083 ARNTL aryl hydrocarbon receptor nuclear translocator like 2 4
MIRT547185 PBRM1 polybromo 1 2 2
MIRT547596 LIN28B lin-28 homolog B 2 2
MIRT548188 FOXA1 forkhead box A1 2 2
MIRT555055 PYURF PIGY upstream reading frame 2 2
MIRT557321 HIC2 HIC ZBTB transcriptional repressor 2 2 2
MIRT557979 FAM217B family with sequence similarity 217 member B 2 4
MIRT558439 DDIT4 DNA damage inducible transcript 4 2 3
MIRT558560 CRLF3 cytokine receptor like factor 3 2 4
MIRT562332 FGF2 fibroblast growth factor 2 2 2
MIRT565836 SCML2 Scm polycomb group protein like 2 2 2
MIRT566796 MIER3 MIER family member 3 2 2
MIRT568565 AK4 adenylate kinase 4 2 2
MIRT572483 PRR14L proline rich 14 like 2 2
MIRT572586 HGFAC HGF activator 2 2
MIRT572876 OPHN1 oligophrenin 1 2 2
MIRT573136 ABT1 activator of basal transcription 1 2 2
MIRT573244 ZBTB46 zinc finger and BTB domain containing 46 2 2
MIRT573388 GGA2 golgi associated, gamma adaptin ear containing, ARF binding protein 2 2 2
MIRT574588 N4BP1 NEDD4 binding protein 1 2 2
MIRT575081 Ddit4 DNA-damage-inducible transcript 4 2 3
MIRT609077 SMIM15 small integral membrane protein 15 2 8
MIRT619337 RNF2 ring finger protein 2 2 2
MIRT623058 NRXN1 neurexin 1 2 2
MIRT623307 MARCH4 membrane associated ring-CH-type finger 4 2 2
MIRT623899 FOXN3 forkhead box N3 2 2
MIRT625177 GRIK4 glutamate ionotropic receptor kainate type subunit 4 2 2
MIRT630448 GTPBP8 GTP binding protein 8 (putative) 2 2
MIRT630587 SLC9A8 solute carrier family 9 member A8 2 2
MIRT634451 PAK6 p21 (RAC1) activated kinase 6 2 2
MIRT634727 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT635769 PDCL3 phosducin like 3 2 2
MIRT650924 ST6GALNAC1 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 1 2 2
MIRT668975 CLSTN2 calsyntenin 2 2 2
MIRT669612 AEBP2 AE binding protein 2 2 2
MIRT686746 STX16 syntaxin 16 2 2
MIRT687932 HMGN1 high mobility group nucleosome binding domain 1 2 2
MIRT691875 GXYLT2 glucoside xylosyltransferase 2 2 2
MIRT698432 TM4SF1 transmembrane 4 L six family member 1 2 2
MIRT698572 TFDP2 transcription factor Dp-2 2 2
MIRT704500 CPEB4 cytoplasmic polyadenylation element binding protein 4 2 2
MIRT704907 CCDC71L coiled-coil domain containing 71 like 2 2
MIRT713810 XRCC2 X-ray repair cross complementing 2 2 2
MIRT718300 MOGAT1 monoacylglycerol O-acyltransferase 1 2 2
MIRT719022 SHROOM3 shroom family member 3 2 2
MIRT723766 MPLKIP M-phase specific PLK1 interacting protein 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-3607 Imatinib 5291 NSC743414 approved resistant High Chronic Myelogenous Leukemia tissue
hsa-miR-3607 Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (SKOV3)
hsa-miR-3607 Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-3607 Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-3607 Plx-4720 24180719 NSC757438 resistant High Thyroid Cancer cell line (8505c, BCPAP)
hsa-mir-3607 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-mir-3607 Cisplatin 5460033 NSC119875 approved sensitive cell line (CP20)
hsa-mir-3607 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-3607-3p Paclitaxel 36314 NSC125973 approved resistant High Prostate Cancer cell line (DU-145, PC-3)
hsa-miR-3607-3p Imatinib 5291 NSC743414 approved resistant High Chronic Myelogenous Leukemia tissue
hsa-miR-3607-3p Anthracycline 30323 NSC82151 approved resistant High Breast Cancer tissue
hsa-miR-3607-3p Cyclophosphamide 2907 NSC26271 approved resistant High Breast Cancer tissue
hsa-miR-3607-3p Fluorouracil 3385 NSC19893 approved resistant High Breast Cancer tissue
hsa-miR-3607-3p Taxol 36314 NSC125973 approved resistant High Breast Cancer tissue
hsa-miR-3607-3p Methotrexate 126941 NSC740 approved resistant High Breast Cancer tissue
hsa-miR-3607-3p Temozolomide 5394 NSC362856 approved resistant cell line (U251)
hsa-miR-3607-3p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-3607-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-3607-3p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-3607-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)
hsa-miR-3607-3p Platinum 23939 resistant tissue
hsa-miR-3607-3p Platinum 23939 resistant tissue (non-small cell lung cancer)
hsa-miR-3607-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3607-3p Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-3607-3p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-3607-3p Bortezomib 387447 NSC681239 approved sensitive tissue (multiple myeloma)
hsa-miR-3607-3p Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-3607-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (Panc1-GR1)
hsa-miR-3607-3p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)

Error report submission