miRTarBase - #MIRT190653


—
pre-miRNA Information
pre-miRNA hsa-mir-2355   
Genomic Coordinates chr2: 207109987 - 207110073
Description Homo sapiens miR-2355 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-2355-5p
Sequence 11| AUCCCCAGAUACAAUGGACAA |31
Evidence Experimental
Experiments SOLiD
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 1 2 - 207110063 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1268296297 4 dbSNP
rs1361046879 5 dbSNP
rs1219551997 6 dbSNP
rs1295756820 12 dbSNP
rs1345273529 15 dbSNP
rs977145706 15 dbSNP
rs1209629984 20 dbSNP
rs759940260 21 dbSNP
Putative Targets

miRNA Expression profile
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PABPN1   
Synonyms OPMD, PAB2, PABII, PABP-2, PABP2
Description poly(A) binding protein nuclear 1
Transcript NM_004643   
Expression
Putative miRNA Targets on PABPN1
3'UTR of PABPN1
(miRNA target sites are highlighted)		 
>PABPN1|NM_004643|3'UTR
   1 AAAAAGTGTGTATTAGGAGGAGAGAGAGGAAAAAAAGAGGAAAGAAGGAAAAAAAAAAGAATTAAAAAAAAAAAAAAGAA
  81 AAACAGAAGATGACCTTGATGGAAAAAAAATATTTTTTAAAAAAAAGATATACTGTGGAAGGGGGGAGAATCCCATAACT
 161 AACTGCTGAGGAGGGACCTGCTTTGGGGAGTAGGGGAAGGCCCAGGGAGTGGGGCAGGGGGCTGCTTATTCACTCTGGGG
 241 ATTCGCCATGGACACGTCTCAACTGCGCAAGCTGCTGCCCATGTTTCCCTGCCCCACTTCACCCCCTTGGGGGCTGCTCA
 321 AGGGTAGGTGGGCGTGGGTGGTAGGAGGTTTTTTTTTTTACCCAGGGCTCTGGAAGGACACCAAACTGTTCTGCTTGTTA
 401 CCTTCCCTCCGTCTTCTCCTCGCCTTTCACAGTCCCCTCCTGCCTGCTCCTGTCCAGCCAGGTCTACCACCCACCCCACC
 481 CCTCTTCTCCGGCTCCCTGCCCCTCCAGATTGCCTGGTGATCTATTTTGTTTCCTTTTGTGTTTCTTTTTCTGTTTTGAG
 561 TGTCTTTCTTTGCAGGTTTCTGTAGCCGGAAGATCTCCGTTCCGCTCCCAGCGGCTCCAGTGTAAATTCCCCTTCCCCCT
 641 GGGGAAATGCACTACCTTGTTTTGGGGGGTTTAGGGGTGTTTTTGTTTTTCAGTTGTTTTGTTTTTTTGTTTTTTTTTTT
 721 TTTCCTTTGCCTTTTTTCCCTTTTATTTGGAGGGAATGGGAGGAAGTGGGAACAGGGAGGTGGGAGGTGGATTTTGTTTA
 801 TTTTTTTAGCTCATTTCCAGGGGTGGGAATTTTTTTTTAATATGTGTCATGAATAAAGTTGTTTTTGAAAATAAAAATTG
 881 TTTGGCCTTTTGGGTGTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' aaCAGGUAACAUAGACCCCUa 5'
            | ::|||   |||||||| 
Target 5' ctGCTTATTCACTCTGGGGAt 3'
 222 - 242 155.00 -17.00
2 
miRNA  3' aacaGGUAACAUAGACCCCUa 5'
              || ||    ||||||| 
Target 5' attcCCCTTCCCCCTGGGGAa 3'
 626 - 646 145.00 -12.56
3 
miRNA  3' aaCAGGUAACAUAGACCCCUa 5'
            | ||  ||  |:|||||| 
Target 5' ggGACC--TG-CTTTGGGGAg 3'
 173 - 190 130.00 -11.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM1685706 6 COSMIC
COSM8209215 6 COSMIC
COSN15667009 38 COSMIC
COSN18738429 60 COSMIC
COSN28209498 64 COSMIC
COSN32061408 78 COSMIC
COSN1165935 79 COSMIC
COSN30613278 111 COSMIC
COSN30695539 111 COSMIC
COSN13578623 119 COSMIC
COSN30496551 120 COSMIC
COSN26574568 144 COSMIC
COSN31594631 147 COSMIC
COSN31547666 149 COSMIC
COSN31531048 165 COSMIC
COSN26575308 196 COSMIC
COSN1165936 284 COSMIC
COSN31533667 292 COSMIC
COSN1640427 316 COSMIC
COSN20111109 360 COSMIC
COSN22327992 422 COSMIC
COSN19363454 540 COSMIC
COSN31485828 555 COSMIC
COSN31609626 589 COSMIC
COSN20111113 723 COSMIC
COSN20111111 724 COSMIC
COSN31522434 738 COSMIC
COSN31482473 808 COSMIC
COSN30543888 842 COSMIC
COSN31546853 852 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs144841285 1 dbSNP
rs1402719809 6 dbSNP
rs1282689230 7 dbSNP
rs747100665 16 dbSNP
rs1168626892 20 dbSNP
rs754022244 20 dbSNP
rs768850285 23 dbSNP
rs1347453573 25 dbSNP
rs1221815445 27 dbSNP
rs762783207 28 dbSNP
rs1318911171 29 dbSNP
rs1196106320 30 dbSNP
rs1274871248 32 dbSNP
rs1435936150 36 dbSNP
rs776757269 38 dbSNP
rs577048276 39 dbSNP
rs766130036 39 dbSNP
rs748378670 42 dbSNP
rs769858590 45 dbSNP
rs774229260 47 dbSNP
rs759255838 48 dbSNP
rs1167790907 49 dbSNP
rs751517593 49 dbSNP
rs752252926 49 dbSNP
rs754929166 49 dbSNP
rs780929696 49 dbSNP
rs1472110999 50 dbSNP
rs1462200253 51 dbSNP
rs371252638 59 dbSNP
rs373625324 59 dbSNP
rs201110573 60 dbSNP
rs202153798 63 dbSNP
rs1273235905 64 dbSNP
rs1456900635 64 dbSNP
rs376203495 64 dbSNP
rs1159524550 65 dbSNP
rs1404641897 73 dbSNP
rs1224063962 75 dbSNP
rs1054460772 79 dbSNP
rs1329497188 81 dbSNP
rs1338575344 85 dbSNP
rs985279040 93 dbSNP
rs1395381336 95 dbSNP
rs926848552 107 dbSNP
rs1295351633 112 dbSNP
rs915112122 113 dbSNP
rs545879467 117 dbSNP
rs1441877511 119 dbSNP
rs200118006 119 dbSNP
rs182814853 120 dbSNP
rs1176438723 132 dbSNP
rs1375341630 142 dbSNP
rs1042314567 143 dbSNP
rs1011358370 145 dbSNP
rs1253148284 148 dbSNP
rs1211101944 149 dbSNP
rs923573734 172 dbSNP
rs78041837 176 dbSNP
rs1216260205 178 dbSNP
rs903020242 181 dbSNP
rs34164276 185 dbSNP
rs939048014 187 dbSNP
rs1306784222 189 dbSNP
rs1239773357 191 dbSNP
rs1282890453 191 dbSNP
rs1321454582 202 dbSNP
rs997316903 205 dbSNP
rs80204954 211 dbSNP
rs1437730287 213 dbSNP
rs386775604 213 dbSNP
rs894880223 215 dbSNP
rs1390675099 217 dbSNP
rs953250540 219 dbSNP
rs530033115 221 dbSNP
rs1289921351 223 dbSNP
rs1203121669 230 dbSNP
rs1422024623 236 dbSNP
rs1234951185 240 dbSNP
rs1470726786 243 dbSNP
rs1007462960 245 dbSNP
rs765008147 246 dbSNP
rs963708603 256 dbSNP
rs1430899452 257 dbSNP
rs1177934473 263 dbSNP
rs1194368896 266 dbSNP
rs759640107 267 dbSNP
rs546789070 268 dbSNP
rs1044538123 272 dbSNP
rs1257932128 272 dbSNP
rs972179183 279 dbSNP
rs919303853 282 dbSNP
rs1330639092 283 dbSNP
rs1296360525 288 dbSNP
rs1355994175 294 dbSNP
rs1339081017 296 dbSNP
rs560367991 297 dbSNP
rs1402494017 299 dbSNP
rs532389197 301 dbSNP
rs926776293 302 dbSNP
rs1410243961 303 dbSNP
rs1464215448 304 dbSNP
rs1302729663 305 dbSNP
rs1170771733 307 dbSNP
rs1054084 313 dbSNP
rs1260867340 314 dbSNP
rs1015862114 316 dbSNP
rs961654587 318 dbSNP
rs1257973096 321 dbSNP
rs1198997689 322 dbSNP
rs998179710 326 dbSNP
rs1343852665 334 dbSNP
rs1030105971 335 dbSNP
rs1316606826 340 dbSNP
rs1278066697 341 dbSNP
rs1415812377 343 dbSNP
rs1342673279 349 dbSNP
rs1400969671 349 dbSNP
rs35455483 349 dbSNP
rs397852863 349 dbSNP
rs398024557 349 dbSNP
rs149299976 350 dbSNP
rs954102336 351 dbSNP
rs985583132 360 dbSNP
rs1421430721 361 dbSNP
rs1275512304 364 dbSNP
rs1338891502 367 dbSNP
rs1473073244 372 dbSNP
rs1213269335 378 dbSNP
rs1275724222 385 dbSNP
rs915043434 388 dbSNP
rs1442063868 392 dbSNP
rs564060814 396 dbSNP
rs552245849 398 dbSNP
rs1267268613 401 dbSNP
rs1200623637 410 dbSNP
rs1257467414 411 dbSNP
rs150958673 411 dbSNP
rs749257506 412 dbSNP
rs1359076664 413 dbSNP
rs769676403 416 dbSNP
rs1377683083 420 dbSNP
rs537806866 422 dbSNP
rs939291606 423 dbSNP
rs1166049632 424 dbSNP
rs1448493166 428 dbSNP
rs1397562874 435 dbSNP
rs1421597357 436 dbSNP
rs1405949972 437 dbSNP
rs755065610 451 dbSNP
rs77613634 454 dbSNP
rs947002959 458 dbSNP
rs1472313369 461 dbSNP
rs947766256 464 dbSNP
rs1162665002 467 dbSNP
rs1363560730 469 dbSNP
rs1237719777 470 dbSNP
rs1222316209 473 dbSNP
rs1453850196 478 dbSNP
rs1288295724 479 dbSNP
rs547890319 481 dbSNP
rs1041476215 482 dbSNP
rs14947 489 dbSNP
rs568385003 491 dbSNP
rs1311888376 492 dbSNP
rs1241944110 498 dbSNP
rs997366735 504 dbSNP
rs191663420 509 dbSNP
rs554081795 512 dbSNP
rs1005738831 515 dbSNP
rs1007516060 521 dbSNP
rs1016557968 524 dbSNP
rs866598554 525 dbSNP
rs577016839 526 dbSNP
rs1245935405 530 dbSNP
rs539694546 530 dbSNP
rs897393406 533 dbSNP
rs556576341 534 dbSNP
rs1191872680 542 dbSNP
rs1479027073 551 dbSNP
rs796225168 557 dbSNP
rs1362112572 561 dbSNP
rs998879063 567 dbSNP
rs1488896368 588 dbSNP
rs752333454 589 dbSNP
rs1214819358 590 dbSNP
rs1351067701 594 dbSNP
rs1283057584 596 dbSNP
rs993879193 600 dbSNP
rs1267652620 604 dbSNP
rs1404315349 608 dbSNP
rs757993574 613 dbSNP
rs970810205 614 dbSNP
rs1397858559 618 dbSNP
rs1360172169 622 dbSNP
rs1177108893 634 dbSNP
rs1249392178 638 dbSNP
rs982149610 640 dbSNP
rs1423224649 641 dbSNP
rs1172064611 642 dbSNP
rs1182977192 650 dbSNP
rs1006951059 651 dbSNP
rs1191978754 656 dbSNP
rs926828792 658 dbSNP
rs959528978 659 dbSNP
rs1238376962 661 dbSNP
rs1164006854 664 dbSNP
rs867458356 666 dbSNP
rs1399222881 668 dbSNP
rs968146958 670 dbSNP
rs977937592 671 dbSNP
rs915443991 679 dbSNP
rs576470434 682 dbSNP
rs1279975209 693 dbSNP
rs1031284571 697 dbSNP
rs1216690859 697 dbSNP
rs1320330653 697 dbSNP
rs773621711 698 dbSNP
rs1450543621 701 dbSNP
rs1357575838 702 dbSNP
rs960653009 702 dbSNP
rs992485914 702 dbSNP
rs1344898560 705 dbSNP
rs947086091 706 dbSNP
rs1452528674 708 dbSNP
rs916211954 709 dbSNP
rs1202522042 710 dbSNP
rs1259403513 710 dbSNP
rs1457857994 710 dbSNP
rs1477766385 710 dbSNP
rs201653941 710 dbSNP
rs398024558 710 dbSNP
rs58264930 710 dbSNP
rs71119016 710 dbSNP
rs74574876 710 dbSNP
rs749193731 710 dbSNP
rs773166413 710 dbSNP
rs774179209 710 dbSNP
rs796121388 710 dbSNP
rs878927408 710 dbSNP
rs200356031 711 dbSNP
rs1385353446 714 dbSNP
rs947738683 715 dbSNP
rs984484698 716 dbSNP
rs1349467992 717 dbSNP
rs908949379 718 dbSNP
rs940466748 719 dbSNP
rs1037195027 720 dbSNP
rs1491258347 723 dbSNP
rs1422398609 724 dbSNP
rs1491131952 724 dbSNP
rs879250269 724 dbSNP
rs1464969454 725 dbSNP
rs1202886307 726 dbSNP
rs1241236811 729 dbSNP
rs1425281251 730 dbSNP
rs1187967161 731 dbSNP
rs1239537150 732 dbSNP
rs1439908465 732 dbSNP
rs1363048598 738 dbSNP
rs897354921 738 dbSNP
rs1468791725 739 dbSNP
rs1161721071 740 dbSNP
rs1044475807 746 dbSNP
rs1223535118 747 dbSNP
rs1319744078 757 dbSNP
rs542174392 767 dbSNP
rs934221690 769 dbSNP
rs1051359042 773 dbSNP
rs1379388304 775 dbSNP
rs924253321 781 dbSNP
rs1307179167 782 dbSNP
rs1368957346 801 dbSNP
rs747411810 801 dbSNP
rs1006875924 802 dbSNP
rs933084019 803 dbSNP
rs1365408245 811 dbSNP
rs777368091 813 dbSNP
rs1159626030 818 dbSNP
rs1419936775 820 dbSNP
rs1335269355 823 dbSNP
rs183808166 824 dbSNP
rs1417958792 829 dbSNP
rs1000055543 830 dbSNP
rs1192900347 830 dbSNP
rs903929029 830 dbSNP
rs1306733886 837 dbSNP
rs1267993285 838 dbSNP
rs1030791837 839 dbSNP
rs1216982283 844 dbSNP
rs960828831 862 dbSNP
rs907338904 868 dbSNP
rs1238568958 873 dbSNP
rs1312902138 875 dbSNP
rs771408031 878 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM4903825
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / PID14_NS
Location of target site NM_004643 | 3UTR | AACUGCUGAGGAGGGACCUGCUUUGGGGAGUAGGGGAAGGCCCAGGGAGUGGGGCAGGGGGCUGCUUAUUCACUCUGGGGAUUCGCCAUGGACACGU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161237
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM4903833
Method / RBP HITS-CLIP / AGO
Cell line / Condition Dermal fibroblasts / CTL_TD_21_a
Location of target site NM_004643 | 3UTR | AGGGGGGAGAAUCCCAUAACUAACUGCUGAGGAGGGACCUGCUUUGGGGAGUAGGGGAAGGCCCAGGGAGUGGGGCAGGGGGCUGCUUAUUCACUCUGGGGAUUCGCCAUGGACAC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Accession Series GSE161239
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000397276.2 | 3UTR | UAAAUUCCCCUUCCCCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRC 0.309 0.01 0.254 0.02 68 Click to see details
STAD 0.326 0.03 0.167 0.18 32 Click to see details
KIRP 0.314 0.04 0.362 0.02 32 Click to see details
UCEC -0.401 0.04 -0.419 0.04 19 Click to see details
PRAD -0.194 0.09 -0.201 0.08 50 Click to see details
THCA 0.131 0.16 0.099 0.23 59 Click to see details
HNSC -0.151 0.17 -0.205 0.1 42 Click to see details
CESC 0.85 0.18 0.500 0.33 3 Click to see details
LUAD 0.228 0.24 0.161 0.31 12 Click to see details
KICH -0.116 0.29 -0.041 0.42 25 Click to see details
ESCA 0.155 0.32 0.164 0.31 11 Click to see details
BLCA 0.094 0.36 0.065 0.4 18 Click to see details
BRCA -0.026 0.41 -0.034 0.38 84 Click to see details
LIHC -0.031 0.42 -0.029 0.42 49 Click to see details
PCPG -0.254 0.42 -0.500 0.33 3 Click to see details
LUSC -0.03 0.43 0.002 0.5 38 Click to see details
PAAD -0.082 0.46 -0.400 0.3 4 Click to see details
CHOL 0.024 0.48 0.000 0.5 9 Click to see details
CHOL 0.024 0.48 0.000 0.5 9 Click to see details
164 hsa-miR-2355-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT190653 PABPN1 poly(A) binding protein nuclear 1 2 2
MIRT286477 TAOK1 TAO kinase 1 2 4
MIRT318993 GIGYF1 GRB10 interacting GYF protein 1 2 2
MIRT345622 DCAF7 DDB1 and CUL4 associated factor 7 2 4
MIRT442513 SYT7 synaptotagmin 7 2 4
MIRT444247 CTNND1 catenin delta 1 2 2
MIRT444780 ECE1 endothelin converting enzyme 1 2 2
MIRT456525 TMEM63A transmembrane protein 63A 2 2
MIRT468960 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 2
MIRT469834 R3HDM4 R3H domain containing 4 2 2
MIRT470027 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 2
MIRT471167 PHB2 prohibitin 2 2 2
MIRT475819 HDGF heparin binding growth factor 2 4
MIRT479389 CDKN1B cyclin dependent kinase inhibitor 1B 2 6
MIRT481747 APH1A aph-1 homolog A, gamma-secretase subunit 2 2
MIRT485220 PRICKLE1 prickle planar cell polarity protein 1 2 2
MIRT487259 CCNF cyclin F 2 2
MIRT489971 MCC mutated in colorectal cancers 2 4
MIRT491399 C1D C1D nuclear receptor corepressor 2 2
MIRT494959 CCDC144A coiled-coil domain containing 144A 2 4
MIRT494979 PPP5D1 PPP5 tetratricopeptide repeat domain containing 1 2 2
MIRT495225 CHST14 carbohydrate sulfotransferase 14 2 2
MIRT496550 TBX15 T-box 15 2 2
MIRT501612 PISD phosphatidylserine decarboxylase 2 2
MIRT509393 TRIM24 tripartite motif containing 24 2 2
MIRT519616 ZNF788 zinc finger family member 788 2 4
MIRT519738 ZNF394 zinc finger protein 394 2 4
MIRT521230 SAR1A secretion associated Ras related GTPase 1A 2 4
MIRT521801 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT526233 C2orf15 chromosome 2 open reading frame 15 2 2
MIRT526932 CMSS1 cms1 ribosomal small subunit homolog (yeast) 2 2
MIRT529189 ACBD7 acyl-CoA binding domain containing 7 2 2
MIRT529329 ZNF649 zinc finger protein 649 2 2
MIRT529698 MRPL30 mitochondrial ribosomal protein L30 2 2
MIRT529921 TOP1MT DNA topoisomerase I mitochondrial 2 2
MIRT530032 SMC1A structural maintenance of chromosomes 1A 2 2
MIRT530898 C9orf3 chromosome 9 open reading frame 3 2 2
MIRT531621 TM4SF5 transmembrane 4 L six family member 5 2 4
MIRT533132 XIAP X-linked inhibitor of apoptosis 2 2
MIRT533210 WAPAL WAPL cohesin release factor 2 2
MIRT534058 ST6GALNAC3 ST6 N-acetylgalactosaminide alpha-2,6-sialyltransferase 3 2 2
MIRT535487 PARVB parvin beta 2 2
MIRT536749 HOXD9 homeobox D9 2 2
MIRT551456 CARKD NAD(P)HX dehydratase 2 2
MIRT551858 ASB6 ankyrin repeat and SOCS box containing 6 2 2
MIRT552095 FAM8A1 family with sequence similarity 8 member A1 2 2
MIRT552332 ZNF704 zinc finger protein 704 2 2
MIRT552549 ZFP36L2 ZFP36 ring finger protein like 2 2 2
MIRT561505 SRSF2 serine and arginine rich splicing factor 2 2 2
MIRT562702 ZNF415 zinc finger protein 415 2 2
MIRT563052 ZNF138 zinc finger protein 138 2 2
MIRT564592 ZNF791 zinc finger protein 791 2 2
MIRT566422 PIGA phosphatidylinositol glycan anchor biosynthesis class A 2 2
MIRT570176 RCBTB1 RCC1 and BTB domain containing protein 1 2 2
MIRT570866 ZNF525 zinc finger protein 525 2 2
MIRT570875 ZFP1 ZFP1 zinc finger protein 2 2
MIRT571517 ZNF625 zinc finger protein 625 2 2
MIRT572551 DKK3 dickkopf WNT signaling pathway inhibitor 3 2 2
MIRT610894 HINFP histone H4 transcription factor 2 2
MIRT611037 PTGES prostaglandin E synthase 2 2
MIRT611479 HSPA4 heat shock protein family A (Hsp70) member 4 2 4
MIRT612419 SP1 Sp1 transcription factor 2 2
MIRT614478 FRMPD3 FERM and PDZ domain containing 3 2 2
MIRT616318 CACNA1A calcium voltage-gated channel subunit alpha1 A 2 2
MIRT616929 ZNF638 zinc finger protein 638 2 2
MIRT618131 GABARAPL3 GABA type A receptor associated protein like 3 pseudogene 2 2
MIRT618452 ZFP30 ZFP30 zinc finger protein 2 4
MIRT620671 BBS5 Bardet-Biedl syndrome 5 2 2
MIRT620713 ASB16 ankyrin repeat and SOCS box containing 16 2 2
MIRT621126 EMC7 ER membrane protein complex subunit 7 2 4
MIRT621443 TOMM22 translocase of outer mitochondrial membrane 22 2 2
MIRT623491 KCTD11 potassium channel tetramerization domain containing 11 2 2
MIRT623783 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT623918 FNBP1L formin binding protein 1 like 2 2
MIRT625723 CXorf38 chromosome X open reading frame 38 2 2
MIRT625778 GCNT1 glucosaminyl (N-acetyl) transferase 1, core 2 2 2
MIRT626940 TTR transthyretin 2 2
MIRT627357 TSC22D2 TSC22 domain family member 2 2 2
MIRT632078 ALDH1A2 aldehyde dehydrogenase 1 family member A2 2 2
MIRT633361 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT639793 MVK mevalonate kinase 2 2
MIRT643761 NAGK N-acetylglucosamine kinase 2 2
MIRT644358 NDUFAF6 NADH:ubiquinone oxidoreductase complex assembly factor 6 2 2
MIRT645558 ZMYM1 zinc finger MYM-type containing 1 2 2
MIRT646588 ANKRD36 ankyrin repeat domain 36 2 2
MIRT646631 SLC25A46 solute carrier family 25 member 46 2 2
MIRT648066 HSPA6 heat shock protein family A (Hsp70) member 6 2 2
MIRT648142 SUCLG2 succinate-CoA ligase GDP-forming beta subunit 2 2
MIRT648416 MYOZ3 myozenin 3 2 2
MIRT649218 AMMECR1L AMMECR1 like 2 2
MIRT649772 MRPS27 mitochondrial ribosomal protein S27 2 4
MIRT650510 UFM1 ubiquitin fold modifier 1 2 2
MIRT651007 ZNF740 zinc finger protein 740 2 2
MIRT651524 WNT2B Wnt family member 2B 2 2
MIRT652014 TTYH3 tweety family member 3 2 2
MIRT652513 TMEM109 transmembrane protein 109 2 2
MIRT652686 THUMPD3 THUMP domain containing 3 2 2
MIRT652772 TENM3 teneurin transmembrane protein 3 2 2
MIRT653160 SPRY4 sprouty RTK signaling antagonist 4 2 2
MIRT653765 SIX5 SIX homeobox 5 2 2
MIRT653792 SIRPA signal regulatory protein alpha 2 2
MIRT655649 OAZ2 ornithine decarboxylase antizyme 2 2 2
MIRT656263 MEX3A mex-3 RNA binding family member A 2 2
MIRT657044 KCNH6 potassium voltage-gated channel subfamily H member 6 2 2
MIRT657375 HMGA1 high mobility group AT-hook 1 2 2
MIRT657532 GTDC1 glycosyltransferase like domain containing 1 2 2
MIRT657542 GSTO2 glutathione S-transferase omega 2 2 2
MIRT657828 GJD3 gap junction protein delta 3 2 2
MIRT658946 DOK6 docking protein 6 2 2
MIRT660363 BACH2 BTB domain and CNC homolog 2 2 2
MIRT660406 ATXN7L3 ataxin 7 like 3 2 2
MIRT660948 ABL2 ABL proto-oncogene 2, non-receptor tyrosine kinase 2 2
MIRT661031 AAK1 AP2 associated kinase 1 2 2
MIRT662435 RALGAPA1 Ral GTPase activating protein catalytic alpha subunit 1 2 2
MIRT668419 FAM217B family with sequence similarity 217 member B 2 2
MIRT669332 BSND barttin CLCNK type accessory beta subunit 2 2
MIRT676105 CLUAP1 clusterin associated protein 1 2 2
MIRT677084 SMIM15 small integral membrane protein 15 2 2
MIRT677127 OGFOD3 2-oxoglutarate and iron dependent oxygenase domain containing 3 2 2
MIRT678001 CPM carboxypeptidase M 2 2
MIRT678531 TMEM78 transmembrane protein 78 2 2
MIRT680000 ZNF860 zinc finger protein 860 2 2
MIRT680098 PXMP4 peroxisomal membrane protein 4 2 2
MIRT686795 SOX12 SRY-box 12 2 2
MIRT698887 SPTBN2 spectrin beta, non-erythrocytic 2 2 2
MIRT699371 SLC30A6 solute carrier family 30 member 6 2 2
MIRT702005 MIDN midnolin 2 2
MIRT708101 IGF2BP1 insulin like growth factor 2 mRNA binding protein 1 2 2
MIRT709563 GYG2 glycogenin 2 2 2
MIRT710559 PPP2R5E protein phosphatase 2 regulatory subunit B'epsilon 2 2
MIRT710585 CDCA4 cell division cycle associated 4 2 2
MIRT710873 NT5DC1 5'-nucleotidase domain containing 1 2 2
MIRT711876 VASP vasodilator stimulated phosphoprotein 2 2
MIRT712226 RIMS3 regulating synaptic membrane exocytosis 3 2 2
MIRT713211 FAM13A family with sequence similarity 13 member A 2 2
MIRT713261 GPR55 G protein-coupled receptor 55 2 2
MIRT713327 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 2
MIRT713889 RNF19B ring finger protein 19B 2 2
MIRT714015 UBAP2L ubiquitin associated protein 2 like 2 2
MIRT714202 NLRP12 NLR family pyrin domain containing 12 2 2
MIRT714717 VPS8 VPS8, CORVET complex subunit 2 2
MIRT714748 ZNF385D zinc finger protein 385D 2 2
MIRT714806 ARHGEF19 Rho guanine nucleotide exchange factor 19 2 2
MIRT714852 ADAMTS17 ADAM metallopeptidase with thrombospondin type 1 motif 17 2 2
MIRT715717 MRPL4 mitochondrial ribosomal protein L4 2 2
MIRT715852 GRIN2A glutamate ionotropic receptor NMDA type subunit 2A 2 2
MIRT716853 MFSD12 major facilitator superfamily domain containing 12 2 2
MIRT717134 EBPL emopamil binding protein like 2 2
MIRT717248 TMEM246 transmembrane protein 246 2 2
MIRT717997 ZNF79 zinc finger protein 79 2 2
MIRT718341 PURA purine rich element binding protein A 2 2
MIRT719587 TFCP2L1 transcription factor CP2 like 1 2 2
MIRT720520 PTGR2 prostaglandin reductase 2 2 2
MIRT720671 SLC39A13 solute carrier family 39 member 13 2 2
MIRT721213 DCLK3 doublecortin like kinase 3 2 2
MIRT721757 INF2 inverted formin, FH2 and WH2 domain containing 2 2
MIRT721826 POU6F1 POU class 6 homeobox 1 2 2
MIRT722091 SUSD1 sushi domain containing 1 2 2
MIRT722275 LURAP1 leucine rich adaptor protein 1 2 2
MIRT722802 ARHGAP19 Rho GTPase activating protein 19 2 2
MIRT722866 FAM212B family with sequence similarity 212 member B 2 2
MIRT723113 ZSCAN16 zinc finger and SCAN domain containing 16 2 2
MIRT724378 NEK8 NIMA related kinase 8 2 2
MIRT732775 PYCR1 pyrroline-5-carboxylate reductase 1 3 0
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-2355 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-2355-5p Gemcitabine 60750 NSC613327 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-2355-5p Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PANC-1)
hsa-miR-2355-5p Imatinib 5291 NSC743414 approved resistant High Chronic Myelogenous Leukemia cell line (K562)
hsa-miR-2355-5p Cisplatin 5460033 NSC119875 approved resistant High Non-Small Cell Lung Cancer cell line (A549, HCC827)
hsa-miR-2355-5p Gefitinib 123631 NSC715055 approved resistant High Non-Small Cell Lung Cancer cell line (A549, HCC827)
hsa-miR-2355-5p Temozolomide 5394 NSC362856 approved resistant High Glioma tissue
hsa-miR-2355-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-2355-5p Vemurafenib 42611257 NSC761431 approved resistant cell line (451Lu)
hsa-miR-2355-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-2355-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-2355-5p Tamoxifen+Fulvestrant sensitive cell line (LCC9)
hsa-miR-2355-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-2355-5p Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-2355-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (TOV-112D)
hsa-miR-2355-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (OVSAHO)

Error report submission