miRTarBase - #MIRT190654


—
pre-miRNA Information
pre-miRNA hsa-mir-4271   
Genomic Coordinates chr3: 49274120 - 49274186
Description Homo sapiens miR-4271 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4271
Sequence 39| GGGGGAAGAAAAGGUGGGG |57
Evidence Experimental
Experiments SOLiD
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30481495 1 COSMIC
COSN31532060 5 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs760829741 1 dbSNP
rs1277951968 2 dbSNP
rs189148716 3 dbSNP
rs757021935 4 dbSNP
rs1285201145 6 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol PABPN1   
Synonyms OPMD, PAB2, PABII, PABP-2, PABP2
Description poly(A) binding protein nuclear 1
Transcript NM_004643   
Expression
Putative miRNA Targets on PABPN1
3'UTR of PABPN1
(miRNA target sites are highlighted)		 
>PABPN1|NM_004643|3'UTR
   1 AAAAAGTGTGTATTAGGAGGAGAGAGAGGAAAAAAAGAGGAAAGAAGGAAAAAAAAAAGAATTAAAAAAAAAAAAAAGAA
  81 AAACAGAAGATGACCTTGATGGAAAAAAAATATTTTTTAAAAAAAAGATATACTGTGGAAGGGGGGAGAATCCCATAACT
 161 AACTGCTGAGGAGGGACCTGCTTTGGGGAGTAGGGGAAGGCCCAGGGAGTGGGGCAGGGGGCTGCTTATTCACTCTGGGG
 241 ATTCGCCATGGACACGTCTCAACTGCGCAAGCTGCTGCCCATGTTTCCCTGCCCCACTTCACCCCCTTGGGGGCTGCTCA
 321 AGGGTAGGTGGGCGTGGGTGGTAGGAGGTTTTTTTTTTTACCCAGGGCTCTGGAAGGACACCAAACTGTTCTGCTTGTTA
 401 CCTTCCCTCCGTCTTCTCCTCGCCTTTCACAGTCCCCTCCTGCCTGCTCCTGTCCAGCCAGGTCTACCACCCACCCCACC
 481 CCTCTTCTCCGGCTCCCTGCCCCTCCAGATTGCCTGGTGATCTATTTTGTTTCCTTTTGTGTTTCTTTTTCTGTTTTGAG
 561 TGTCTTTCTTTGCAGGTTTCTGTAGCCGGAAGATCTCCGTTCCGCTCCCAGCGGCTCCAGTGTAAATTCCCCTTCCCCCT
 641 GGGGAAATGCACTACCTTGTTTTGGGGGGTTTAGGGGTGTTTTTGTTTTTCAGTTGTTTTGTTTTTTTGTTTTTTTTTTT
 721 TTTCCTTTGCCTTTTTTCCCTTTTATTTGGAGGGAATGGGAGGAAGTGGGAACAGGGAGGTGGGAGGTGGATTTTGTTTA
 801 TTTTTTTAGCTCATTTCCAGGGGTGGGAATTTTTTTTTAATATGTGTCATGAATAAAGTTGTTTTTGAAAATAAAAATTG
 881 TTTGGCCTTTTGGGTGTAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ggGGUGGAA---AA---GAAGGGGg 5'
            ||| : |   ||   ||||||| 
Target 5' ctCCAGTGTAAATTCCCCTTCCCCc 3'
 615 - 639 141.00 -18.14
2 
miRNA  3' ggGGUGGAAAAGAAGGGGg 5'
            |||||   |||||:|| 
Target 5' ccCCACC-CCTCTTCTCCg 3'
 474 - 491 140.00 -23.90
3 
miRNA  3' ggGGUGGAAAA--GAAGGGGg 5'
            |::|:| ||  ||||||: 
Target 5' ttCTGCTTGTTACCTTCCCTc 3'
 389 - 409 139.00 -15.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSM1685706 6 COSMIC
COSM8209215 6 COSMIC
COSN15667009 38 COSMIC
COSN18738429 60 COSMIC
COSN28209498 64 COSMIC
COSN32061408 78 COSMIC
COSN1165935 79 COSMIC
COSN30613278 111 COSMIC
COSN30695539 111 COSMIC
COSN13578623 119 COSMIC
COSN30496551 120 COSMIC
COSN26574568 144 COSMIC
COSN31594631 147 COSMIC
COSN31547666 149 COSMIC
COSN31531048 165 COSMIC
COSN26575308 196 COSMIC
COSN1165936 284 COSMIC
COSN31533667 292 COSMIC
COSN1640427 316 COSMIC
COSN20111109 360 COSMIC
COSN22327992 422 COSMIC
COSN19363454 540 COSMIC
COSN31485828 555 COSMIC
COSN31609626 589 COSMIC
COSN20111113 723 COSMIC
COSN20111111 724 COSMIC
COSN31522434 738 COSMIC
COSN31482473 808 COSMIC
COSN30543888 842 COSMIC
COSN31546853 852 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs144841285 1 dbSNP
rs1402719809 6 dbSNP
rs1282689230 7 dbSNP
rs747100665 16 dbSNP
rs1168626892 20 dbSNP
rs754022244 20 dbSNP
rs768850285 23 dbSNP
rs1347453573 25 dbSNP
rs1221815445 27 dbSNP
rs762783207 28 dbSNP
rs1318911171 29 dbSNP
rs1196106320 30 dbSNP
rs1274871248 32 dbSNP
rs1435936150 36 dbSNP
rs776757269 38 dbSNP
rs577048276 39 dbSNP
rs766130036 39 dbSNP
rs748378670 42 dbSNP
rs769858590 45 dbSNP
rs774229260 47 dbSNP
rs759255838 48 dbSNP
rs1167790907 49 dbSNP
rs751517593 49 dbSNP
rs752252926 49 dbSNP
rs754929166 49 dbSNP
rs780929696 49 dbSNP
rs1472110999 50 dbSNP
rs1462200253 51 dbSNP
rs371252638 59 dbSNP
rs373625324 59 dbSNP
rs201110573 60 dbSNP
rs202153798 63 dbSNP
rs1273235905 64 dbSNP
rs1456900635 64 dbSNP
rs376203495 64 dbSNP
rs1159524550 65 dbSNP
rs1404641897 73 dbSNP
rs1224063962 75 dbSNP
rs1054460772 79 dbSNP
rs1329497188 81 dbSNP
rs1338575344 85 dbSNP
rs985279040 93 dbSNP
rs1395381336 95 dbSNP
rs926848552 107 dbSNP
rs1295351633 112 dbSNP
rs915112122 113 dbSNP
rs545879467 117 dbSNP
rs1441877511 119 dbSNP
rs200118006 119 dbSNP
rs182814853 120 dbSNP
rs1176438723 132 dbSNP
rs1375341630 142 dbSNP
rs1042314567 143 dbSNP
rs1011358370 145 dbSNP
rs1253148284 148 dbSNP
rs1211101944 149 dbSNP
rs923573734 172 dbSNP
rs78041837 176 dbSNP
rs1216260205 178 dbSNP
rs903020242 181 dbSNP
rs34164276 185 dbSNP
rs939048014 187 dbSNP
rs1306784222 189 dbSNP
rs1239773357 191 dbSNP
rs1282890453 191 dbSNP
rs1321454582 202 dbSNP
rs997316903 205 dbSNP
rs80204954 211 dbSNP
rs1437730287 213 dbSNP
rs386775604 213 dbSNP
rs894880223 215 dbSNP
rs1390675099 217 dbSNP
rs953250540 219 dbSNP
rs530033115 221 dbSNP
rs1289921351 223 dbSNP
rs1203121669 230 dbSNP
rs1422024623 236 dbSNP
rs1234951185 240 dbSNP
rs1470726786 243 dbSNP
rs1007462960 245 dbSNP
rs765008147 246 dbSNP
rs963708603 256 dbSNP
rs1430899452 257 dbSNP
rs1177934473 263 dbSNP
rs1194368896 266 dbSNP
rs759640107 267 dbSNP
rs546789070 268 dbSNP
rs1044538123 272 dbSNP
rs1257932128 272 dbSNP
rs972179183 279 dbSNP
rs919303853 282 dbSNP
rs1330639092 283 dbSNP
rs1296360525 288 dbSNP
rs1355994175 294 dbSNP
rs1339081017 296 dbSNP
rs560367991 297 dbSNP
rs1402494017 299 dbSNP
rs532389197 301 dbSNP
rs926776293 302 dbSNP
rs1410243961 303 dbSNP
rs1464215448 304 dbSNP
rs1302729663 305 dbSNP
rs1170771733 307 dbSNP
rs1054084 313 dbSNP
rs1260867340 314 dbSNP
rs1015862114 316 dbSNP
rs961654587 318 dbSNP
rs1257973096 321 dbSNP
rs1198997689 322 dbSNP
rs998179710 326 dbSNP
rs1343852665 334 dbSNP
rs1030105971 335 dbSNP
rs1316606826 340 dbSNP
rs1278066697 341 dbSNP
rs1415812377 343 dbSNP
rs1342673279 349 dbSNP
rs1400969671 349 dbSNP
rs35455483 349 dbSNP
rs397852863 349 dbSNP
rs398024557 349 dbSNP
rs149299976 350 dbSNP
rs954102336 351 dbSNP
rs985583132 360 dbSNP
rs1421430721 361 dbSNP
rs1275512304 364 dbSNP
rs1338891502 367 dbSNP
rs1473073244 372 dbSNP
rs1213269335 378 dbSNP
rs1275724222 385 dbSNP
rs915043434 388 dbSNP
rs1442063868 392 dbSNP
rs564060814 396 dbSNP
rs552245849 398 dbSNP
rs1267268613 401 dbSNP
rs1200623637 410 dbSNP
rs1257467414 411 dbSNP
rs150958673 411 dbSNP
rs749257506 412 dbSNP
rs1359076664 413 dbSNP
rs769676403 416 dbSNP
rs1377683083 420 dbSNP
rs537806866 422 dbSNP
rs939291606 423 dbSNP
rs1166049632 424 dbSNP
rs1448493166 428 dbSNP
rs1397562874 435 dbSNP
rs1421597357 436 dbSNP
rs1405949972 437 dbSNP
rs755065610 451 dbSNP
rs77613634 454 dbSNP
rs947002959 458 dbSNP
rs1472313369 461 dbSNP
rs947766256 464 dbSNP
rs1162665002 467 dbSNP
rs1363560730 469 dbSNP
rs1237719777 470 dbSNP
rs1222316209 473 dbSNP
rs1453850196 478 dbSNP
rs1288295724 479 dbSNP
rs547890319 481 dbSNP
rs1041476215 482 dbSNP
rs14947 489 dbSNP
rs568385003 491 dbSNP
rs1311888376 492 dbSNP
rs1241944110 498 dbSNP
rs997366735 504 dbSNP
rs191663420 509 dbSNP
rs554081795 512 dbSNP
rs1005738831 515 dbSNP
rs1007516060 521 dbSNP
rs1016557968 524 dbSNP
rs866598554 525 dbSNP
rs577016839 526 dbSNP
rs1245935405 530 dbSNP
rs539694546 530 dbSNP
rs897393406 533 dbSNP
rs556576341 534 dbSNP
rs1191872680 542 dbSNP
rs1479027073 551 dbSNP
rs796225168 557 dbSNP
rs1362112572 561 dbSNP
rs998879063 567 dbSNP
rs1488896368 588 dbSNP
rs752333454 589 dbSNP
rs1214819358 590 dbSNP
rs1351067701 594 dbSNP
rs1283057584 596 dbSNP
rs993879193 600 dbSNP
rs1267652620 604 dbSNP
rs1404315349 608 dbSNP
rs757993574 613 dbSNP
rs970810205 614 dbSNP
rs1397858559 618 dbSNP
rs1360172169 622 dbSNP
rs1177108893 634 dbSNP
rs1249392178 638 dbSNP
rs982149610 640 dbSNP
rs1423224649 641 dbSNP
rs1172064611 642 dbSNP
rs1182977192 650 dbSNP
rs1006951059 651 dbSNP
rs1191978754 656 dbSNP
rs926828792 658 dbSNP
rs959528978 659 dbSNP
rs1238376962 661 dbSNP
rs1164006854 664 dbSNP
rs867458356 666 dbSNP
rs1399222881 668 dbSNP
rs968146958 670 dbSNP
rs977937592 671 dbSNP
rs915443991 679 dbSNP
rs576470434 682 dbSNP
rs1279975209 693 dbSNP
rs1031284571 697 dbSNP
rs1216690859 697 dbSNP
rs1320330653 697 dbSNP
rs773621711 698 dbSNP
rs1450543621 701 dbSNP
rs1357575838 702 dbSNP
rs960653009 702 dbSNP
rs992485914 702 dbSNP
rs1344898560 705 dbSNP
rs947086091 706 dbSNP
rs1452528674 708 dbSNP
rs916211954 709 dbSNP
rs1202522042 710 dbSNP
rs1259403513 710 dbSNP
rs1457857994 710 dbSNP
rs1477766385 710 dbSNP
rs201653941 710 dbSNP
rs398024558 710 dbSNP
rs58264930 710 dbSNP
rs71119016 710 dbSNP
rs74574876 710 dbSNP
rs749193731 710 dbSNP
rs773166413 710 dbSNP
rs774179209 710 dbSNP
rs796121388 710 dbSNP
rs878927408 710 dbSNP
rs200356031 711 dbSNP
rs1385353446 714 dbSNP
rs947738683 715 dbSNP
rs984484698 716 dbSNP
rs1349467992 717 dbSNP
rs908949379 718 dbSNP
rs940466748 719 dbSNP
rs1037195027 720 dbSNP
rs1491258347 723 dbSNP
rs1422398609 724 dbSNP
rs1491131952 724 dbSNP
rs879250269 724 dbSNP
rs1464969454 725 dbSNP
rs1202886307 726 dbSNP
rs1241236811 729 dbSNP
rs1425281251 730 dbSNP
rs1187967161 731 dbSNP
rs1239537150 732 dbSNP
rs1439908465 732 dbSNP
rs1363048598 738 dbSNP
rs897354921 738 dbSNP
rs1468791725 739 dbSNP
rs1161721071 740 dbSNP
rs1044475807 746 dbSNP
rs1223535118 747 dbSNP
rs1319744078 757 dbSNP
rs542174392 767 dbSNP
rs934221690 769 dbSNP
rs1051359042 773 dbSNP
rs1379388304 775 dbSNP
rs924253321 781 dbSNP
rs1307179167 782 dbSNP
rs1368957346 801 dbSNP
rs747411810 801 dbSNP
rs1006875924 802 dbSNP
rs933084019 803 dbSNP
rs1365408245 811 dbSNP
rs777368091 813 dbSNP
rs1159626030 818 dbSNP
rs1419936775 820 dbSNP
rs1335269355 823 dbSNP
rs183808166 824 dbSNP
rs1417958792 829 dbSNP
rs1000055543 830 dbSNP
rs1192900347 830 dbSNP
rs903929029 830 dbSNP
rs1306733886 837 dbSNP
rs1267993285 838 dbSNP
rs1030791837 839 dbSNP
rs1216982283 844 dbSNP
rs960828831 862 dbSNP
rs907338904 868 dbSNP
rs1238568958 873 dbSNP
rs1312902138 875 dbSNP
rs771408031 878 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gggguggaaaaGAAGGGGg 5'
                     ||||||| 
Target 5' --uaaauucccCUUCCCCc 3'
 		1 - 17
Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000397276.2 | 3UTR | UAAAUUCCCCUUCCCCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
181 hsa-miR-4271 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT066209 MARCH9 membrane associated ring-CH-type finger 9 2 2
MIRT079367 CCDC137 coiled-coil domain containing 137 2 2
MIRT081183 MIDN midnolin 2 4
MIRT083278 ZCCHC3 zinc finger CCHC-type containing 3 2 6
MIRT086207 HOXD13 homeobox D13 2 2
MIRT133713 SKI SKI proto-oncogene 2 4
MIRT150653 SLC27A1 solute carrier family 27 member 1 2 2
MIRT159166 NRBP1 nuclear receptor binding protein 1 2 2
MIRT160059 TET3 tet methylcytosine dioxygenase 3 2 4
MIRT180856 RPRD2 regulation of nuclear pre-mRNA domain containing 2 2 2
MIRT181931 MARK2 microtubule affinity regulating kinase 2 2 2
MIRT190628 BCL2L2-PABPN1 BCL2L2-PABPN1 readthrough 2 2
MIRT190654 PABPN1 poly(A) binding protein nuclear 1 2 2
MIRT196107 MPRIP myosin phosphatase Rho interacting protein 2 2
MIRT263248 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT321168 EIF4H eukaryotic translation initiation factor 4H 2 2
MIRT338624 SHMT2 serine hydroxymethyltransferase 2 2 2
MIRT366301 GDI1 GDP dissociation inhibitor 1 2 4
MIRT375172 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 2
MIRT441488 NCEH1 neutral cholesterol ester hydrolase 1 2 2
MIRT442333 WNT9B Wnt family member 9B 2 2
MIRT443889 CNKSR3 CNKSR family member 3 2 2
MIRT445880 WBP1L WW domain binding protein 1 like 2 2
MIRT449312 MRO maestro 2 2
MIRT449844 BCL2L13 BCL2 like 13 2 2
MIRT450304 DRAXIN dorsal inhibitory axon guidance protein 2 2
MIRT450515 EMX1 empty spiracles homeobox 1 2 2
MIRT451243 ZNF444 zinc finger protein 444 2 2
MIRT451713 OLR1 oxidized low density lipoprotein receptor 1 2 2
MIRT451792 TLR5 toll like receptor 5 2 2
MIRT451823 ALDH3B1 aldehyde dehydrogenase 3 family member B1 2 2
MIRT451906 ILK integrin linked kinase 2 2
MIRT452181 KIAA1456 KIAA1456 2 4
MIRT452242 TRAM1 translocation associated membrane protein 1 2 2
MIRT452544 ZNF467 zinc finger protein 467 2 2
MIRT452605 REPIN1 replication initiator 1 2 2
MIRT454505 ZFYVE27 zinc finger FYVE-type containing 27 2 2
MIRT454657 FBXL18 F-box and leucine rich repeat protein 18 2 2
MIRT455354 KDM5C lysine demethylase 5C 2 2
MIRT455452 EPB41L4B erythrocyte membrane protein band 4.1 like 4B 2 2
MIRT455587 TAF12 TATA-box binding protein associated factor 12 2 2
MIRT456501 PFKFB2 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2 2 2
MIRT456815 PIGP phosphatidylinositol glycan anchor biosynthesis class P 2 2
MIRT457425 NOL10 nucleolar protein 10 2 2
MIRT457468 SLC35F6 solute carrier family 35 member F6 2 2
MIRT457660 SERINC1 serine incorporator 1 2 2
MIRT458231 NXPH3 neurexophilin 3 2 2
MIRT458374 ITM2C integral membrane protein 2C 2 2
MIRT458667 GPR35 G protein-coupled receptor 35 2 2
MIRT459665 VPS37C VPS37C, ESCRT-I subunit 2 2
MIRT459825 TPP1 tripeptidyl peptidase 1 2 2
MIRT460564 FEM1A fem-1 homolog A 2 2
MIRT460725 ASXL3 additional sex combs like 3, transcriptional regulator 2 2
MIRT461121 RAB36 RAB36, member RAS oncogene family 2 2
MIRT461529 C14orf1 ergosterol biosynthesis 28 homolog 2 2
MIRT461750 DDX11 DEAD/H-box helicase 11 2 2
MIRT462570 STS steroid sulfatase 2 2
MIRT462798 NTN1 netrin 1 2 2
MIRT463030 ZNF689 zinc finger protein 689 2 2
MIRT463991 WDTC1 WD and tetratricopeptide repeats 1 2 2
MIRT464684 UBE2V1 ubiquitin conjugating enzyme E2 V1 2 2
MIRT465439 TP53 tumor protein p53 2 2
MIRT465512 PRICKLE4 prickle planar cell polarity protein 4 2 2
MIRT465649 TNPO2 transportin 2 2 10
MIRT465947 TMEM189-UBE2V1 TMEM189-UBE2V1 readthrough 2 2
MIRT466028 TMEM189 transmembrane protein 189 2 2
MIRT468076 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 6
MIRT468131 SH3PXD2A SH3 and PX domains 2A 2 2
MIRT468498 SESN2 sestrin 2 2 2
MIRT468879 RREB1 ras responsive element binding protein 1 2 2
MIRT469318 RGP1 RGP1 homolog, RAB6A GEF complex partner 1 2 2
MIRT469558 RARA retinoic acid receptor alpha 2 2
MIRT469793 RAB15 RAB15, member RAS oncogene family 2 2
MIRT469896 PTRF caveolae associated protein 1 2 2
MIRT470235 PRRC2A proline rich coiled-coil 2A 2 2
MIRT470808 PLXND1 plexin D1 2 2
MIRT471597 PAQR5 progestin and adipoQ receptor family member 5 2 10
MIRT471710 OTUB1 OTU deubiquitinase, ubiquitin aldehyde binding 1 2 2
MIRT471752 OGT O-linked N-acetylglucosamine (GlcNAc) transferase 2 2
MIRT472978 MRRF mitochondrial ribosome recycling factor 2 2
MIRT473538 MAX MYC associated factor X 2 2
MIRT473581 MAT2A methionine adenosyltransferase 2A 2 2
MIRT473970 LRRC58 leucine rich repeat containing 58 2 2
MIRT474223 LCOR ligand dependent nuclear receptor corepressor 2 4
MIRT474553 KLHDC3 kelch domain containing 3 2 2
MIRT474777 KIAA0895L KIAA0895 like 2 2
MIRT476042 GRSF1 G-rich RNA sequence binding factor 1 2 2
MIRT476438 GBA2 glucosylceramidase beta 2 2 2
MIRT477773 E2F3 E2F transcription factor 3 2 4
MIRT477946 DPM2 dolichyl-phosphate mannosyltransferase subunit 2, regulatory 2 2
MIRT478782 CRTC2 CREB regulated transcription coactivator 2 2 2
MIRT479320 VPS72 vacuolar protein sorting 72 homolog 2 2
MIRT480405 C19orf47 chromosome 19 open reading frame 47 2 2
MIRT480593 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 2 2
MIRT480963 BBC3 BCL2 binding component 3 2 2
MIRT481127 AZIN1 antizyme inhibitor 1 2 4
MIRT481444 ARRB2 arrestin beta 2 2 2
MIRT481687 AR androgen receptor 2 2
MIRT481730 APH1A aph-1 homolog A, gamma-secretase subunit 2 2
MIRT482386 AEN apoptosis enhancing nuclease 2 2
MIRT482564 ABHD2 abhydrolase domain containing 2 2 2
MIRT482605 ABHD14B abhydrolase domain containing 14B 2 2
MIRT483256 CITED4 Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 4 2 4
MIRT483531 TAGLN2 transgelin 2 2 2
MIRT483840 UNC5B unc-5 netrin receptor B 2 4
MIRT483935 LENG8 leukocyte receptor cluster member 8 2 4
MIRT484414 SNX19 sorting nexin 19 2 2
MIRT484487 SLC9A1 solute carrier family 9 member A1 2 2
MIRT484609 SIX3 SIX homeobox 3 2 6
MIRT484703 RNF11 ring finger protein 11 2 2
MIRT485244 POGZ pogo transposable element derived with ZNF domain 2 2
MIRT485607 FOSL1 FOS like 1, AP-1 transcription factor subunit 2 4
MIRT485965 RTBDN retbindin 2 2
MIRT487308 GLTSCR1 BRD4 interacting chromatin remodeling complex associated protein 2 2
MIRT487329 SREBF1 sterol regulatory element binding transcription factor 1 2 4
MIRT487410 CACNB1 calcium voltage-gated channel auxiliary subunit beta 1 2 2
MIRT487607 C20orf96 chromosome 20 open reading frame 96 2 2
MIRT487689 CDK14 cyclin dependent kinase 14 2 2
MIRT487787 GPR20 G protein-coupled receptor 20 2 4
MIRT488026 ADO 2-aminoethanethiol dioxygenase 2 2
MIRT488476 B3GALNT2 beta-1,3-N-acetylgalactosaminyltransferase 2 2 2
MIRT488761 FXYD1 FXYD domain containing ion transport regulator 1 2 2
MIRT489161 MRPL12 mitochondrial ribosomal protein L12 2 4
MIRT489529 MRE11A MRE11 homolog, double strand break repair nuclease 2 8
MIRT489774 GRINA glutamate ionotropic receptor NMDA type subunit associated protein 1 2 2
MIRT489878 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT490094 FN3K fructosamine 3 kinase 2 2
MIRT490202 PKNOX2 PBX/knotted 1 homeobox 2 2 2
MIRT490283 ISL2 ISL LIM homeobox 2 2 2
MIRT490377 LHFPL3 LHFPL tetraspan subfamily member 3 2 2
MIRT491035 ALPK3 alpha kinase 3 2 2
MIRT491186 JUND JunD proto-oncogene, AP-1 transcription factor subunit 2 4
MIRT491766 ZNF385A zinc finger protein 385A 2 2
MIRT491888 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 2 2
MIRT491981 UNK unkempt family zinc finger 2 2
MIRT492400 SDK1 sidekick cell adhesion molecule 1 2 2
MIRT493647 HDLBP high density lipoprotein binding protein 2 2
MIRT494010 DUSP9 dual specificity phosphatase 9 2 2
MIRT494167 CNOT6L CCR4-NOT transcription complex subunit 6 like 2 2
MIRT495712 PADI1 peptidyl arginine deiminase 1 2 2
MIRT496873 AHCYL2 adenosylhomocysteinase like 2 2 2
MIRT499175 RBPJL recombination signal binding protein for immunoglobulin kappa J region like 2 2
MIRT501652 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT506645 MAPK1 mitogen-activated protein kinase 1 2 4
MIRT510590 TUBB2A tubulin beta 2A class IIa 2 6
MIRT511907 FKBP1A FK506 binding protein 1A 2 2
MIRT513063 ANKRD45 ankyrin repeat domain 45 2 2
MIRT513104 DYNAP dynactin associated protein 2 2
MIRT521804 POM121C POM121 transmembrane nucleoporin C 2 2
MIRT523520 GLUL glutamate-ammonia ligase 2 2
MIRT525085 FRK fyn related Src family tyrosine kinase 2 2
MIRT530930 SCIN scinderin 2 2
MIRT533501 TRIM71 tripartite motif containing 71 2 2
MIRT538560 CECR2 CECR2, histone acetyl-lysine reader 2 2
MIRT544556 CSNK2A1 casein kinase 2 alpha 1 2 2
MIRT555912 ORMDL3 ORMDL sphingolipid biosynthesis regulator 3 2 2
MIRT560405 TMEM69 transmembrane protein 69 2 2
MIRT560664 RTN3 reticulon 3 2 2
MIRT564061 CDT1 chromatin licensing and DNA replication factor 1 2 2
MIRT565504 SP1 Sp1 transcription factor 2 2
MIRT570014 COL1A2 collagen type I alpha 2 chain 2 2
MIRT572321 HSPB6 heat shock protein family B (small) member 6 2 2
MIRT573229 TRIM21 tripartite motif containing 21 2 2
MIRT573487 IQSEC3 IQ motif and Sec7 domain 3 2 2
MIRT574137 MARVELD1 MARVEL domain containing 1 2 2
MIRT574323 ZNF703 zinc finger protein 703 2 2
MIRT620939 OSMR oncostatin M receptor 2 2
MIRT650080 MTL5 testis expressed metallothionein like protein 2 2
MIRT684553 ZNF708 zinc finger protein 708 2 2
MIRT685841 ANGEL1 angel homolog 1 2 2
MIRT688551 DCAF16 DDB1 and CUL4 associated factor 16 2 2
MIRT701985 MIER3 MIER family member 3 2 2
MIRT703899 EPT1 selenoprotein I 2 2
MIRT706388 MC2R melanocortin 2 receptor 2 2
MIRT707487 UGT2B4 UDP glucuronosyltransferase family 2 member B4 2 2
MIRT711885 INSIG2 insulin induced gene 2 2 2
MIRT719164 KIF6 kinesin family member 6 2 2
MIRT721294 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT721775 ARL6IP4 ADP ribosylation factor like GTPase 6 interacting protein 4 2 2
MIRT723763 NKIRAS2 NFKB inhibitor interacting Ras like 2 2 2
MIRT725485 GPR26 G protein-coupled receptor 26 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-4 Dexamethasone approved 5743 Microarray primary rat thymocytes 20847043 2010 up-regulated
miR-4271 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4271 Cisplatin 5460033 NSC119875 approved sensitive High Gastric Cancer cell line (BGC823)
hsa-miR-4271 Platinum-based doublet chemotherapy sensitive High Lung Adenocarcinoma tissue
hsa-miR-4271 Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-4271 Fluorouracil 3385 NSC19893 approved sensitive High Pancreatic Cancer cell line (PATU8988)
hsa-miR-4271 Cisplatin 5460033 NSC119875 approved resistant Low Tongue Squamous Cell Carcinoma cell line (CAL-27, SCC-9)
hsa-miR-4271 Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (H460)
hsa-miR-4271 Anlotinib 25017411 NSC832523 sensitive Low Non-Small Cell Lung Cancer cell line (A549, PDC, H460)
hsa-miR-4271 Gefitinib 123631 NSC715055 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549, PDC, H460)
hsa-miR-4271 Icotinib 22024915 NSC800770 sensitive Low Non-Small Cell Lung Cancer cell line (A549, PDC, H460)
hsa-miR-4271 Erlotinib 176870 NSC718781 approved sensitive Low Non-Small Cell Lung Cancer cell line (A549, PDC, H460)
hsa-mir-4271 Cisplatin 5460033 NSC119875 approved resistant cell line (W1)
hsa-mir-4271 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-mir-4271 Androstenedione+Anastrozole resistant cell line (MCF-7)
hsa-mir-4271 Androstenedione+Letrozole resistant cell line (MCF-7)
hsa-mir-4271 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-mir-4271 Cisplatin 5460033 NSC119875 approved sensitive cell line (BGC-823)
hsa-miR-4271 Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (cytosolic RNA)
hsa-miR-4271 Cisplatin 5460033 NSC119875 approved resistant cell line (CAL-27) (total RNA)
hsa-miR-4271 Osimertinib 71496458 NSC779217 approved resistant cell line (H1975)
hsa-miR-4271 Platinum-based doublet chemotherapy sensitive tissue (lung adenocarcinoma)
hsa-miR-4271 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-4271 Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM16)
hsa-miR-4271 Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (1500 ng/ml)
hsa-miR-4271 Gemcitabine 60750 NSC613327 approved resistant cell line (PANC-1) (100 ng/ml)
hsa-miR-4271 Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)

Error report submission