miRTarBase - #MIRT191172


—
pre-miRNA Information
pre-miRNA hsa-mir-6809   
Genomic Coordinates chr2: 217900513 - 217900628
Description Homo sapiens miR-6809 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-6809-3p
Sequence 96| CUUCUCUUCUCUCCUUCCCAG |116
Evidence Experimental
Experiments Meta-analysis
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs755634163 1 dbSNP
rs1312617571 9 dbSNP
rs1345275794 10 dbSNP
rs1175271401 19 dbSNP
rs113090389 21 dbSNP
Putative Targets

Gene Information
Gene Symbol PTCH2   
Synonyms PTC2
Description patched 2
Transcript NM_001166292   
Other Transcripts NM_003738   
Expression
Putative miRNA Targets on PTCH2
3'UTR of PTCH2
(miRNA target sites are highlighted)		 
>PTCH2|NM_001166292|3'UTR
   1 CCTCTGCCTCCCACCCCAGCACCCCCTCATCAGACACACGGAGCGCCACTGTCTGGACAGGCTGAATTGGTCTTCGGGTC
  81 CCTAATTTCTCATACGCCATTCCCTCTGCCTAGAACACTTTCTCACCTCCCCTTGATGTGACCCCATATCACCCTTCGAG
 161 GTGAATTGGATCGGATGCCATCTCCTCCAGGAGGGGTGGGGTCGTGCCTCCTGTGAGGTCCCAGTGCCCCTGAGTGTCTG
 241 TGCCCGTCTGTTTCCCCGTCCCTCTCTCTAAGCCCGGAGGCTTACTGCGGGTAAGGACGGCGGGACAGGACCTTAACCCC
 321 TGGGACGAACACCAGCTCCGCAAAGGACTCCGCACCCGGCGCCGCCCACGGGGTGCGGGTCCCAGGAGGACCAGCAGAGA
 401 GGAGCATAGGAGAGCAAAGGAGATCAGTGACCCATGGCTTCCCCGGTGGCGCGGAACAGCCCGGAGCCGCCTGTGATTTG
 481 CATACCCATGGTGCACCACGAAAAGATACCCTCAAGATGCTTGCACTCCCTCTGTGCGCGCATTTCTGCACTGTTTTAGA
 561 GCATGATGCCTCTTACACGCATCTGTGTGCATAAACTACATATAGGGAGTGCGTACCACGCAGGCATCCAACAACCATAA
 641 GTGTGTTAAGTGTTAGTTCTCCCTGCGAGGTTCGAAGCGGAAGTCACGAATATACTCGGGTTTCTCTTCAAAGCGCATAA
 721 ATCTTTCGCCTTTTACTAAAGATTTCCGTGGAGAGAAAGTTGTGAGTTTTTATTCAATTTTTTGAGGCCTCTTATTTCCT
 801 GAGGCTACATTTTTAAGTATTAAAAGTTAGGCAACTACAACCAAG
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' gacccUUCCU-----CUCUUCUCUUc 5'
               || ||     | |:|||||| 
Target 5' ttactAAAGATTTCCGTGGAGAGAAa 3'
 733 - 758 132.00 -9.34
2 
miRNA  3' gacCCUUCCUC-UCUUCUCUUc 5'
             | :||||| | |:||||: 
Target 5' gcaGAGAGGAGCATAGGAGAGc 3'
 394 - 415 130.00 -15.00
3 
miRNA  3' gacCCUUCCUCUC----UUCUCUUc 5'
             ||:: | |:|    |:|||:| 
Target 5' cacGGGGTGCGGGTCCCAGGAGGAc 3'
 367 - 391 116.00 -12.70
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30757690 75 COSMIC
COSN6036545 136 COSMIC
COSN1104786 260 COSMIC
COSN8638358 353 COSMIC
COSN28734222 370 COSMIC
COSN26814489 543 COSMIC
COSN17117828 587 COSMIC
COSN17452112 593 COSMIC
COSN20774236 641 COSMIC
COSN1446396 712 COSMIC
COSN5741512 756 COSMIC
COSN28201960 780 COSMIC
COSN21960984 830 COSMIC
rs188241457 746 GWAS
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs777079047 1 dbSNP
rs1471438206 5 dbSNP
rs1367237036 7 dbSNP
rs1438657353 11 dbSNP
rs1186546731 15 dbSNP
rs949019496 17 dbSNP
rs917513311 22 dbSNP
rs1231891204 23 dbSNP
rs1259059745 24 dbSNP
rs560944695 25 dbSNP
rs1446128465 26 dbSNP
rs747435195 28 dbSNP
rs371688861 31 dbSNP
rs11573603 32 dbSNP
rs1442051682 33 dbSNP
rs1031089818 35 dbSNP
rs1264815042 37 dbSNP
rs189756125 39 dbSNP
rs947482386 40 dbSNP
rs915093655 41 dbSNP
rs558442200 45 dbSNP
rs1462773059 50 dbSNP
rs549549303 53 dbSNP
rs1167592465 55 dbSNP
rs1320213031 61 dbSNP
rs1398822490 62 dbSNP
rs1407170200 64 dbSNP
rs1326654204 68 dbSNP
rs1370204845 69 dbSNP
rs1383689540 75 dbSNP
rs769009116 76 dbSNP
rs1299664852 82 dbSNP
rs964861460 84 dbSNP
rs1382980121 85 dbSNP
rs1226332450 89 dbSNP
rs1028945696 99 dbSNP
rs1209984992 104 dbSNP
rs1018871281 106 dbSNP
rs1468465620 109 dbSNP
rs901709546 119 dbSNP
rs1250406035 142 dbSNP
rs987318862 146 dbSNP
rs1371619256 157 dbSNP
rs1191677637 160 dbSNP
rs1473877932 161 dbSNP
rs1393857474 172 dbSNP
rs545293102 173 dbSNP
rs1322469701 181 dbSNP
rs950404176 183 dbSNP
rs1446911892 184 dbSNP
rs1442775481 189 dbSNP
rs1025916137 190 dbSNP
rs1381496181 193 dbSNP
rs994573127 194 dbSNP
rs1341936481 210 dbSNP
rs866542297 213 dbSNP
rs1295253305 227 dbSNP
rs1398364794 228 dbSNP
rs185397548 232 dbSNP
rs1319311519 234 dbSNP
rs1248599696 235 dbSNP
rs931342354 237 dbSNP
rs1402817923 243 dbSNP
rs1389158602 245 dbSNP
rs1164799959 246 dbSNP
rs771943530 250 dbSNP
rs373328320 251 dbSNP
rs1462477383 256 dbSNP
rs1419377274 257 dbSNP
rs1167999604 260 dbSNP
rs752347446 261 dbSNP
rs1223488668 265 dbSNP
rs1486474394 266 dbSNP
rs12079597 268 dbSNP
rs767173269 272 dbSNP
rs1045329698 273 dbSNP
rs1260055469 276 dbSNP
rs948216599 281 dbSNP
rs754821728 282 dbSNP
rs181152082 285 dbSNP
rs766379252 286 dbSNP
rs895946007 289 dbSNP
rs1336925356 290 dbSNP
rs1275117096 291 dbSNP
rs763119836 293 dbSNP
rs1057408841 299 dbSNP
rs1216878167 301 dbSNP
rs1338914437 302 dbSNP
rs139116635 310 dbSNP
rs1433207078 312 dbSNP
rs1329693208 317 dbSNP
rs1325724496 318 dbSNP
rs1404115224 318 dbSNP
rs371774515 319 dbSNP
rs1397330943 320 dbSNP
rs1167848215 321 dbSNP
rs1408886793 324 dbSNP
rs903214770 327 dbSNP
rs935096358 335 dbSNP
rs1325752859 340 dbSNP
rs1043071355 344 dbSNP
rs1303282880 345 dbSNP
rs1238982473 346 dbSNP
rs1259444437 348 dbSNP
rs1347583345 349 dbSNP
rs1211971401 351 dbSNP
rs1484810860 355 dbSNP
rs979495916 357 dbSNP
rs1426026732 358 dbSNP
rs947498433 369 dbSNP
rs1379231714 372 dbSNP
rs189882698 377 dbSNP
rs546590868 378 dbSNP
rs1162538700 379 dbSNP
rs1429926412 392 dbSNP
rs1028905034 396 dbSNP
rs547050695 399 dbSNP
rs1372015856 402 dbSNP
rs534001733 405 dbSNP
rs571832195 408 dbSNP
rs527422532 411 dbSNP
rs1280021891 414 dbSNP
rs1292642731 415 dbSNP
rs1346054306 420 dbSNP
rs943228931 421 dbSNP
rs1207588123 422 dbSNP
rs1247827539 423 dbSNP
rs1008283348 427 dbSNP
rs911702561 432 dbSNP
rs569986267 434 dbSNP
rs1269450707 435 dbSNP
rs1489882090 436 dbSNP
rs750618325 437 dbSNP
rs551635493 441 dbSNP
rs538546910 442 dbSNP
rs1454655146 443 dbSNP
rs186548203 444 dbSNP
rs987370651 447 dbSNP
rs950621632 453 dbSNP
rs1431356128 458 dbSNP
rs1206211508 459 dbSNP
rs549831093 460 dbSNP
rs527500657 462 dbSNP
rs1212564057 466 dbSNP
rs12079506 471 dbSNP
rs1294770175 485 dbSNP
rs973087910 486 dbSNP
rs963341934 491 dbSNP
rs146658804 494 dbSNP
rs1283883311 495 dbSNP
rs1369284644 496 dbSNP
rs1406620887 496 dbSNP
rs1013058864 506 dbSNP
rs546992971 508 dbSNP
rs896011750 509 dbSNP
rs560834132 510 dbSNP
rs746055680 511 dbSNP
rs1202608309 513 dbSNP
rs1301971978 524 dbSNP
rs781373183 537 dbSNP
rs1213000972 540 dbSNP
rs999143636 543 dbSNP
rs181872399 549 dbSNP
rs1355902533 559 dbSNP
rs1186868612 566 dbSNP
rs1043291741 567 dbSNP
rs1045256536 569 dbSNP
rs948310526 575 dbSNP
rs896631186 576 dbSNP
rs947417398 578 dbSNP
rs1430340360 579 dbSNP
rs527352099 582 dbSNP
rs1460405855 585 dbSNP
rs866865902 595 dbSNP
rs935544872 596 dbSNP
rs899803168 597 dbSNP
rs41269089 599 dbSNP
rs544869419 601 dbSNP
rs757079857 606 dbSNP
rs753656371 616 dbSNP
rs1335586631 617 dbSNP
rs1051537723 620 dbSNP
rs1271251882 622 dbSNP
rs1231415988 625 dbSNP
rs866249659 629 dbSNP
rs921598784 630 dbSNP
rs974632197 632 dbSNP
rs929262276 636 dbSNP
rs41269087 641 dbSNP
rs113960979 644 dbSNP
rs562791589 645 dbSNP
rs995557680 646 dbSNP
rs1429016921 651 dbSNP
rs1282147132 659 dbSNP
rs35144044 664 dbSNP
rs759279007 664 dbSNP
rs1356315126 665 dbSNP
rs962647416 667 dbSNP
rs1291509401 668 dbSNP
rs1352823150 670 dbSNP
rs542643672 670 dbSNP
rs1283389586 671 dbSNP
rs1374828927 673 dbSNP
rs1314941370 676 dbSNP
rs1445562189 676 dbSNP
rs376784866 678 dbSNP
rs1012427555 679 dbSNP
rs1185245179 679 dbSNP
rs573710480 680 dbSNP
rs752745338 681 dbSNP
rs776112446 682 dbSNP
rs115899954 683 dbSNP
rs534304002 684 dbSNP
rs369237595 685 dbSNP
rs760119847 686 dbSNP
rs375558597 687 dbSNP
rs189101437 688 dbSNP
rs759096648 689 dbSNP
rs761691944 690 dbSNP
rs1445448130 691 dbSNP
rs368827055 692 dbSNP
rs1040095238 693 dbSNP
rs1303988012 693 dbSNP
rs1008343502 694 dbSNP
rs561199379 695 dbSNP
rs1047094413 696 dbSNP
rs12036829 697 dbSNP
rs1254132833 697 dbSNP
rs532496087 698 dbSNP
rs560397178 699 dbSNP
rs140180112 700 dbSNP
rs1383029310 701 dbSNP
rs184653286 701 dbSNP
rs527424987 702 dbSNP
rs1320042247 703 dbSNP
rs12132510 704 dbSNP
rs1326719076 704 dbSNP
rs1336347976 704 dbSNP
rs1468402933 705 dbSNP
rs1264280620 706 dbSNP
rs551187137 706 dbSNP
rs531385686 707 dbSNP
rs753230933 708 dbSNP
rs113598000 709 dbSNP
rs1417165634 709 dbSNP
rs542534618 710 dbSNP
rs573551566 711 dbSNP
rs781327865 711 dbSNP
rs1414910456 712 dbSNP
rs41269085 713 dbSNP
rs1243267182 714 dbSNP
rs540254924 714 dbSNP
rs150681043 715 dbSNP
rs192626269 716 dbSNP
rs79027712 717 dbSNP
rs1047404827 718 dbSNP
rs544685386 719 dbSNP
rs867688106 720 dbSNP
rs188051405 721 dbSNP
rs866977985 722 dbSNP
rs141950484 723 dbSNP
rs1022545436 725 dbSNP
rs964835222 726 dbSNP
rs567045658 727 dbSNP
rs183639735 728 dbSNP
rs533529607 729 dbSNP
rs74485107 730 dbSNP
rs1307629094 731 dbSNP
rs1382511973 731 dbSNP
rs867231647 734 dbSNP
rs755939838 735 dbSNP
rs559156897 736 dbSNP
rs115827181 737 dbSNP
rs990718389 738 dbSNP
rs148551547 739 dbSNP
rs779305541 740 dbSNP
rs1429917572 741 dbSNP
rs192524658 741 dbSNP
rs754188893 742 dbSNP
rs751034233 743 dbSNP
rs994248780 744 dbSNP
rs1026057568 745 dbSNP
rs188241457 746 dbSNP
rs540658149 747 dbSNP
rs184930641 748 dbSNP
rs894281328 749 dbSNP
rs144745590 750 dbSNP
rs1420737766 751 dbSNP
rs763942102 751 dbSNP
rs576900913 752 dbSNP
rs567801023 753 dbSNP
rs775169423 754 dbSNP
rs1295192386 755 dbSNP
rs193075289 755 dbSNP
rs187608069 756 dbSNP
rs201444688 756 dbSNP
rs772331828 757 dbSNP
rs748246961 758 dbSNP
rs573505698 759 dbSNP
rs963083174 759 dbSNP
rs183280839 760 dbSNP
rs1025641250 761 dbSNP
rs972711406 762 dbSNP
rs564955524 763 dbSNP
rs191094224 764 dbSNP
rs1314931100 765 dbSNP
rs1404611627 765 dbSNP
rs572881320 766 dbSNP
rs1224196369 767 dbSNP
rs555010282 767 dbSNP
rs1308239361 768 dbSNP
rs775822251 768 dbSNP
rs894322684 769 dbSNP
rs1207382035 770 dbSNP
rs1034171316 771 dbSNP
rs139560838 772 dbSNP
rs1471437918 772 dbSNP
rs41269083 772 dbSNP
rs182864574 773 dbSNP
rs1414018634 774 dbSNP
rs1480714352 774 dbSNP
rs1041614399 775 dbSNP
rs552412145 776 dbSNP
rs41269081 777 dbSNP
rs1217035246 778 dbSNP
rs532422394 778 dbSNP
rs942454051 779 dbSNP
rs568602036 780 dbSNP
rs1456758382 781 dbSNP
rs1051204217 782 dbSNP
rs756468604 783 dbSNP
rs745579203 784 dbSNP
rs981353522 784 dbSNP
rs1421743619 785 dbSNP
rs1466170615 785 dbSNP
rs548811131 785 dbSNP
rs190972044 786 dbSNP
rs566625888 787 dbSNP
rs186502463 788 dbSNP
rs959476531 789 dbSNP
rs181420462 790 dbSNP
rs540615118 791 dbSNP
rs942168431 792 dbSNP
rs530255931 793 dbSNP
rs139076008 794 dbSNP
rs1020224744 795 dbSNP
rs561362432 796 dbSNP
rs531077110 797 dbSNP
rs146347925 798 dbSNP
rs116205686 799 dbSNP
rs1007094457 800 dbSNP
rs561678205 801 dbSNP
rs190420749 802 dbSNP
rs375688837 803 dbSNP
rs185960645 804 dbSNP
rs546181243 805 dbSNP
rs1456238799 806 dbSNP
rs577425751 807 dbSNP
rs748004237 808 dbSNP
rs142939610 809 dbSNP
rs1396055921 810 dbSNP
rs887917653 810 dbSNP
rs959594086 811 dbSNP
rs537444387 813 dbSNP
rs1284090430 814 dbSNP
rs1201081796 815 dbSNP
rs1486724549 815 dbSNP
rs1255472196 816 dbSNP
rs138929510 817 dbSNP
rs982161799 818 dbSNP
rs945671040 819 dbSNP
rs150155835 820 dbSNP
rs553388855 821 dbSNP
rs368781041 822 dbSNP
rs533536389 822 dbSNP
rs1010605747 823 dbSNP
rs1384670275 824 dbSNP
rs535505182 825 dbSNP
rs1307403187 826 dbSNP
rs1333874496 826 dbSNP
rs371388317 826 dbSNP
rs181782534 827 dbSNP
rs1030796252 828 dbSNP
rs368132498 830 dbSNP
rs779476471 831 dbSNP
rs189325432 832 dbSNP
rs537658937 833 dbSNP
rs888012499 834 dbSNP
rs548244957 835 dbSNP
rs907377273 836 dbSNP
rs746651037 837 dbSNP
rs530908612 838 dbSNP
rs562025324 839 dbSNP
rs185730820 840 dbSNP
rs757919440 841 dbSNP
rs777185172 842 dbSNP
rs528537055 843 dbSNP
rs559705439 844 dbSNP
rs546367337 845 dbSNP
rs764973796 845 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 8643.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 8643.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' gacccUUCCU-----CUCUUCUCUuc 5'
               || ||     | |:|||||  
Target 5' uuacuAAAGAUUUCCGUGGAGAGA-- 3'
 		22 - 45
Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000447098.2 | 3UTR | AUACUCGGGUUUCUCUUCAAAGCGCAUAAAUCUUUCGCCUUUUACUAAAGAUUUCCGUGGAGAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000447098.2 | 3UTR | AUACUCGGGUUUCUCUUCAAAGCGCAUAAAUCUUUCGCCUUUUACUAAAGAUUUCCGUGGAGAGAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000447098.2 | 3UTR | AUAUACUCGGGUUUCUCUUCAAAGCGCAUAAAUCUUUCGCCUUUUACUAAAGAUUUCCGUGGAGAGAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000447098.2 | 3UTR | AUACUCGGGUUUCUCUUCAAAGCGCAUAAAUCUUUCGCCUUUUACUAAAGAUUUCCGUGGAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000447098.2 | 3UTR | AUAUACUCGGGUUUCUCUUCAAAGCGCAUAAAUCUUUCGCCUUUUACUAAAGAUUUCCGUGGAGAGAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000447098.2 | 3UTR | AGCGCAUAAAUCUUUCGCCUUUUACUAAAGAUUUCCGUGGAGAGA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
310 hsa-miR-6809-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT063208 ADIPOR2 adiponectin receptor 2 2 2
MIRT111451 UBE2Q1 ubiquitin conjugating enzyme E2 Q1 2 2
MIRT191172 PTCH2 patched 2 2 8
MIRT279711 EIF2S1 eukaryotic translation initiation factor 2 subunit alpha 2 4
MIRT294087 ZNF616 zinc finger protein 616 2 4
MIRT316917 ATXN1 ataxin 1 2 2
MIRT317590 NUDT3 nudix hydrolase 3 2 2
MIRT356077 OTUD4 OTU deubiquitinase 4 2 4
MIRT388055 POU2F2 POU class 2 homeobox 2 2 2
MIRT396148 CDK6 cyclin dependent kinase 6 2 4
MIRT443398 HMX3 H6 family homeobox 3 2 2
MIRT443916 ZNF99 zinc finger protein 99 2 6
MIRT448002 HLA-DOA major histocompatibility complex, class II, DO alpha 2 2
MIRT450587 ATIC 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase 2 2
MIRT468227 SGK1 serum/glucocorticoid regulated kinase 1 2 2
MIRT471552 PATL1 PAT1 homolog 1, processing body mRNA decay factor 2 6
MIRT472651 NAA25 N(alpha)-acetyltransferase 25, NatB auxiliary subunit 2 4
MIRT483900 GNB1L G protein subunit beta 1 like 2 6
MIRT489671 CYP1A1 cytochrome P450 family 1 subfamily A member 1 2 2
MIRT492162 STAT3 signal transducer and activator of transcription 3 2 2
MIRT495196 EDN3 endothelin 3 2 2
MIRT497429 SEC63 SEC63 homolog, protein translocation regulator 2 2
MIRT498330 PRELID2 PRELI domain containing 2 2 2
MIRT499475 ZNF669 zinc finger protein 669 2 8
MIRT500248 ZNF791 zinc finger protein 791 2 8
MIRT500289 ZNF667 zinc finger protein 667 2 4
MIRT500533 XPO4 exportin 4 2 2
MIRT507225 FOXN2 forkhead box N2 2 4
MIRT507516 DSTN destrin, actin depolymerizing factor 2 4
MIRT512060 DEK DEK proto-oncogene 2 6
MIRT513379 TUBB4A tubulin beta 4A class IVa 2 2
MIRT514671 ZNF701 zinc finger protein 701 2 4
MIRT515157 ZNF90 zinc finger protein 90 2 2
MIRT530860 TRUB1 TruB pseudouridine synthase family member 1 2 2
MIRT535206 PKIA cAMP-dependent protein kinase inhibitor alpha 2 2
MIRT535873 MLLT10 MLLT10, histone lysine methyltransferase DOT1L cofactor 2 2
MIRT537362 FIGN fidgetin, microtubule severing factor 2 2
MIRT544397 ZSCAN12 zinc finger and SCAN domain containing 12 2 2
MIRT545008 ZNF439 zinc finger protein 439 2 2
MIRT549707 NUP37 nucleoporin 37 2 2
MIRT550780 VAV3 vav guanine nucleotide exchange factor 3 2 2
MIRT551779 ZNF117 zinc finger protein 117 2 4
MIRT553355 TRIM8 tripartite motif containing 8 2 2
MIRT553595 TMCO1 transmembrane and coiled-coil domains 1 2 6
MIRT554594 RRAGC Ras related GTP binding C 2 2
MIRT556808 KIAA1161 myogenesis regulating glycosidase (putative) 2 4
MIRT559784 ZNF415 zinc finger protein 415 2 2
MIRT559798 ZNF468 zinc finger protein 468 2 4
MIRT559807 ZNF83 zinc finger protein 83 2 4
MIRT560159 ZNF286A zinc finger protein 286A 2 2
MIRT562225 HMGB2 high mobility group box 2 2 2
MIRT562801 ZNF611 zinc finger protein 611 2 2
MIRT563958 ZNF431 zinc finger protein 431 2 2
MIRT564730 ZNF23 zinc finger protein 23 2 2
MIRT564743 ZNF207 zinc finger protein 207 2 2
MIRT567299 HNRNPA0 heterogeneous nuclear ribonucleoprotein A0 2 2
MIRT568280 BCOR BCL6 corepressor 2 2
MIRT571531 ZNF286B zinc finger protein 286B 2 2
MIRT576781 Thbs1 thrombospondin 1 2 2
MIRT607122 MARCH4 membrane associated ring-CH-type finger 4 2 2
MIRT607270 IL5RA interleukin 5 receptor subunit alpha 2 4
MIRT607273 CPEB3 cytoplasmic polyadenylation element binding protein 3 2 4
MIRT607283 CD300E CD300e molecule 2 4
MIRT607352 TNS1 tensin 1 2 6
MIRT609192 CDH8 cadherin 8 2 2
MIRT609528 ADPRH ADP-ribosylarginine hydrolase 2 2
MIRT609656 ITIH5 inter-alpha-trypsin inhibitor heavy chain family member 5 2 2
MIRT609683 EMX2 empty spiracles homeobox 2 2 2
MIRT609765 PLCL1 phospholipase C like 1 (inactive) 2 2
MIRT610048 MYBPC1 myosin binding protein C, slow type 2 2
MIRT610531 FAM46A family with sequence similarity 46 member A 2 4
MIRT610731 NFIX nuclear factor I X 2 4
MIRT611983 WDR59 WD repeat domain 59 2 2
MIRT612079 TIMM10 translocase of inner mitochondrial membrane 10 2 2
MIRT612498 SH3PXD2A SH3 and PX domains 2A 2 2
MIRT613452 ZFX zinc finger protein, X-linked 2 2
MIRT613562 YY2 YY2 transcription factor 2 2
MIRT613686 QPRT quinolinate phosphoribosyltransferase 2 2
MIRT613735 GK5 glycerol kinase 5 (putative) 2 2
MIRT614172 FAM53B family with sequence similarity 53 member B 2 2
MIRT614190 ENTPD5 ectonucleoside triphosphate diphosphohydrolase 5 2 2
MIRT614508 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT614817 PVRL4 nectin cell adhesion molecule 4 2 2
MIRT615671 NAV2 neuron navigator 2 2 2
MIRT615926 RNF157 ring finger protein 157 2 2
MIRT615967 ASCL1 achaete-scute family bHLH transcription factor 1 2 2
MIRT616393 TRIM10 tripartite motif containing 10 2 2
MIRT617307 FAM9C family with sequence similarity 9 member C 2 2
MIRT617599 SHOX2 short stature homeobox 2 2 2
MIRT617648 RWDD1 RWD domain containing 1 2 2
MIRT617768 C17orf105 chromosome 17 open reading frame 105 2 2
MIRT618105 OPRM1 opioid receptor mu 1 2 2
MIRT618218 CST3 cystatin C 2 2
MIRT618636 ATP6AP1L ATPase H+ transporting accessory protein 1 like 2 2
MIRT619092 IFI44L interferon induced protein 44 like 2 2
MIRT619353 CFHR5 complement factor H related 5 2 2
MIRT619904 FAM43B family with sequence similarity 43 member B 2 2
MIRT620135 ZNF283 zinc finger protein 283 2 2
MIRT620164 EGFLAM EGF like, fibronectin type III and laminin G domains 2 2
MIRT620265 SLCO3A1 solute carrier organic anion transporter family member 3A1 2 2
MIRT620630 RFT1 RFT1 homolog 2 2
MIRT621046 DGKD diacylglycerol kinase delta 2 2
MIRT621055 ZC2HC1A zinc finger C2HC-type containing 1A 2 2
MIRT621208 SULT1C4 sulfotransferase family 1C member 4 2 2
MIRT622022 STAT5A signal transducer and activator of transcription 5A 2 2
MIRT622113 SPRY3 sprouty RTK signaling antagonist 3 2 2
MIRT622299 SGK3 serum/glucocorticoid regulated kinase family member 3 2 2
MIRT622588 PRRG4 proline rich and Gla domain 4 2 2
MIRT622769 PGM2L1 phosphoglucomutase 2 like 1 2 2
MIRT622848 PDGFA platelet derived growth factor subunit A 2 2
MIRT623012 ONECUT3 one cut homeobox 3 2 2
MIRT623095 NLGN4X neuroligin 4, X-linked 2 2
MIRT623416 KMT2A lysine methyltransferase 2A 2 2
MIRT623656 HRK harakiri, BCL2 interacting protein 2 2
MIRT623952 FBXL16 F-box and leucine rich repeat protein 16 2 2
MIRT624029 ELAVL3 ELAV like RNA binding protein 3 2 2
MIRT624250 CSNK2A1 casein kinase 2 alpha 1 2 4
MIRT624462 CADM2 cell adhesion molecule 2 2 2
MIRT624500 C8orf44-SGK3 C8orf44-SGK3 readthrough 2 2
MIRT624852 ABI2 abl interactor 2 2 2
MIRT625931 SCYL3 SCY1 like pseudokinase 3 2 2
MIRT625941 OLIG3 oligodendrocyte transcription factor 3 2 2
MIRT627038 HOXA13 homeobox A13 2 2
MIRT627277 WSB1 WD repeat and SOCS box containing 1 2 2
MIRT627568 SLC5A12 solute carrier family 5 member 12 2 2
MIRT627834 PPAP2B phospholipid phosphatase 3 2 2
MIRT627850 PITPNM3 PITPNM family member 3 2 2
MIRT628147 HIP1 huntingtin interacting protein 1 2 2
MIRT628432 ANTXR2 anthrax toxin receptor 2 2 2
MIRT628937 AICDA activation induced cytidine deaminase 2 2
MIRT630764 MSANTD3 Myb/SANT DNA binding domain containing 3 2 2
MIRT630938 SIK2 salt inducible kinase 2 2 2
MIRT632061 NARS asparaginyl-tRNA synthetase 2 2
MIRT632114 FKBP9 FK506 binding protein 9 2 2
MIRT635064 MICA MHC class I polypeptide-related sequence A 2 2
MIRT635078 LIMS3 LIM zinc finger domain containing 3 2 2
MIRT635147 LIMS3L LIM zinc finger domain containing 4 2 2
MIRT635809 KCNK6 potassium two pore domain channel subfamily K member 6 2 2
MIRT635985 EHD4 EH domain containing 4 2 2
MIRT636482 KIAA2018 upstream transcription factor family member 3 2 2
MIRT636823 FSIP2 fibrous sheath interacting protein 2 2 2
MIRT636846 ZSCAN2 zinc finger and SCAN domain containing 2 2 2
MIRT637012 TRABD2A TraB domain containing 2A 2 2
MIRT638051 YAE1D1 Yae1 domain containing 1 2 4
MIRT638410 PRDM10 PR/SET domain 10 2 4
MIRT639346 TBXA2R thromboxane A2 receptor 2 2
MIRT639527 CD86 CD86 molecule 2 2
MIRT639605 SLC25A32 solute carrier family 25 member 32 2 4
MIRT639626 ZSCAN23 zinc finger and SCAN domain containing 23 2 2
MIRT640046 MYOCD myocardin 2 2
MIRT640369 UQCRB ubiquinol-cytochrome c reductase binding protein 2 2
MIRT640419 COG6 component of oligomeric golgi complex 6 2 2
MIRT640858 TSHZ2 teashirt zinc finger homeobox 2 2 4
MIRT640891 RBM20 RNA binding motif protein 20 2 2
MIRT641226 SEMA3E semaphorin 3E 2 4
MIRT641753 SF3A1 splicing factor 3a subunit 1 2 2
MIRT642055 KCNK2 potassium two pore domain channel subfamily K member 2 2 2
MIRT642464 RSL1D1 ribosomal L1 domain containing 1 2 2
MIRT642688 ZNF878 zinc finger protein 878 2 2
MIRT643233 PRSS21 protease, serine 21 2 2
MIRT643250 ZNF566 zinc finger protein 566 2 2
MIRT643777 DCLK3 doublecortin like kinase 3 2 2
MIRT643962 FHL2 four and a half LIM domains 2 2 4
MIRT644069 PARG poly(ADP-ribose) glycohydrolase 2 2
MIRT644115 FAM166B family with sequence similarity 166 member B 2 2
MIRT644250 WEE2 WEE1 homolog 2 2 2
MIRT645281 ANGPTL7 angiopoietin like 7 2 2
MIRT645949 TTF2 transcription termination factor 2 2 2
MIRT646722 RHOG ras homolog family member G 2 2
MIRT646757 WDR3 WD repeat domain 3 2 2
MIRT646821 IL6R interleukin 6 receptor 2 2
MIRT647110 CRISP1 cysteine rich secretory protein 1 2 2
MIRT647162 TMLHE trimethyllysine hydroxylase, epsilon 2 2
MIRT647278 JAG2 jagged 2 2 2
MIRT647609 IGSF9B immunoglobulin superfamily member 9B 2 2
MIRT647890 CD55 CD55 molecule (Cromer blood group) 2 2
MIRT648212 TM4SF20 transmembrane 4 L six family member 20 2 2
MIRT648564 CAPN13 calpain 13 2 2
MIRT649534 VAMP8 vesicle associated membrane protein 8 2 2
MIRT649801 GALC galactosylceramidase 2 2
MIRT650265 KLF2 Kruppel like factor 2 2 4
MIRT650313 TMX4 thioredoxin related transmembrane protein 4 2 2
MIRT650628 LTF lactotransferrin 2 2
MIRT651577 WDR26 WD repeat domain 26 2 2
MIRT651629 WASF3 WAS protein family member 3 2 2
MIRT651831 USP37 ubiquitin specific peptidase 37 2 2
MIRT652085 TSKU tsukushi, small leucine rich proteoglycan 2 2
MIRT652377 TMEM55A phosphatidylinositol-4,5-bisphosphate 4-phosphatase 2 2 2
MIRT652537 TLX1 T-cell leukemia homeobox 1 2 2
MIRT652986 SUGT1 SGT1 homolog, MIS12 kinetochore complex assembly cochaperone 2 2
MIRT653079 SSR3 signal sequence receptor subunit 3 2 2
MIRT653577 SLC35B3 solute carrier family 35 member B3 2 2
MIRT654141 RPAP2 RNA polymerase II associated protein 2 2 2
MIRT654264 RGS17 regulator of G protein signaling 17 2 2
MIRT654336 RBM27 RNA binding motif protein 27 2 2
MIRT654599 PTPRT protein tyrosine phosphatase, receptor type T 2 2
MIRT654748 PRKCB protein kinase C beta 2 2
MIRT655008 PLA2G16 phospholipase A2 group XVI 2 2
MIRT655556 P2RX7 purinergic receptor P2X 7 2 2
MIRT655651 NUPL2 nucleoporin like 2 2 2
MIRT655754 NPTX1 neuronal pentraxin 1 2 2
MIRT655785 NOVA2 NOVA alternative splicing regulator 2 2 2
MIRT656090 MTA3 metastasis associated 1 family member 3 2 2
MIRT656125 MSH6 mutS homolog 6 2 2
MIRT656812 KLHL28 kelch like family member 28 2 2
MIRT656818 KLHL14 kelch like family member 14 2 2
MIRT656985 KDM5A lysine demethylase 5A 2 2
MIRT657286 HOXB5 homeobox B5 2 2
MIRT657430 HHIP hedgehog interacting protein 2 2
MIRT657455 C21orf33 chromosome 21 open reading frame 33 2 2
MIRT657623 GPX8 glutathione peroxidase 8 (putative) 2 2
MIRT657660 GPR26 G protein-coupled receptor 26 2 2
MIRT657695 GPC5 glypican 5 2 2
MIRT657875 GFRA1 GDNF family receptor alpha 1 2 2
MIRT657934 GATM glycine amidinotransferase 2 2
MIRT657956 GAPVD1 GTPase activating protein and VPS9 domains 1 2 2
MIRT658071 FOXR2 forkhead box R2 2 2
MIRT658091 FOXO1 forkhead box O1 2 2
MIRT659005 DHX33 DEAH-box helicase 33 2 2
MIRT659526 CHD9 chromodomain helicase DNA binding protein 9 2 2
MIRT659623 CDON cell adhesion associated, oncogene regulated 2 2
MIRT659897 CAMK2G calcium/calmodulin dependent protein kinase II gamma 2 2
MIRT659975 C2CD2L C2CD2 like 2 2
MIRT660035 C15orf61 chromosome 15 open reading frame 61 2 2
MIRT661559 EPHX2 epoxide hydrolase 2 2 2
MIRT661716 KLF8 Kruppel like factor 8 2 2
MIRT662464 SERPINF2 serpin family F member 2 2 2
MIRT664403 AQP3 aquaporin 3 (Gill blood group) 2 2
MIRT665753 TMEM43 transmembrane protein 43 2 2
MIRT666718 RBFOX1 RNA binding protein, fox-1 homolog 1 2 2
MIRT666749 RALGPS2 Ral GEF with PH domain and SH3 binding motif 2 2 2
MIRT667496 LZIC leucine zipper and CTNNBIP1 domain containing 2 2
MIRT667931 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT668182 GDAP1L1 ganglioside induced differentiation associated protein 1 like 1 2 2
MIRT668217 GABRA1 gamma-aminobutyric acid type A receptor alpha1 subunit 2 2
MIRT668417 FAM217B family with sequence similarity 217 member B 2 2
MIRT668672 DR1 down-regulator of transcription 1 2 2
MIRT669073 CELF1 CUGBP Elav-like family member 1 2 2
MIRT669119 CD84 CD84 molecule 2 2
MIRT679735 CABP4 calcium binding protein 4 2 2
MIRT683631 ZNF480 zinc finger protein 480 2 2
MIRT683820 ZNF682 zinc finger protein 682 2 2
MIRT686181 ZNF594 zinc finger protein 594 2 2
MIRT694368 MTA1 metastasis associated 1 2 2
MIRT695098 LSM3 LSM3 homolog, U6 small nuclear RNA and mRNA degradation associated 2 2
MIRT697033 GOLGA5 golgin A5 2 2
MIRT698516 TFRC transferrin receptor 2 2
MIRT706075 HNRNPU heterogeneous nuclear ribonucleoprotein U 2 2
MIRT707561 ARID3A AT-rich interaction domain 3A 2 2
MIRT708297 MPPE1 metallophosphoesterase 1 2 2
MIRT709806 AR androgen receptor 2 2
MIRT710004 SH3GLB1 SH3 domain containing GRB2 like, endophilin B1 2 2
MIRT710455 METTL15 methyltransferase like 15 2 2
MIRT710861 B3GALNT1 beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group) 2 2
MIRT711133 CLEC7A C-type lectin domain containing 7A 2 2
MIRT711137 TMEM174 transmembrane protein 174 2 2
MIRT711164 EMCN endomucin 2 2
MIRT711195 SMIM14 small integral membrane protein 14 2 2
MIRT711403 RAB3C RAB3C, member RAS oncogene family 2 2
MIRT711739 DTX1 deltex E3 ubiquitin ligase 1 2 2
MIRT712251 PTPRN2 protein tyrosine phosphatase, receptor type N2 2 2
MIRT713079 ZG16 zymogen granule protein 16 2 2
MIRT714221 ARMC10 armadillo repeat containing 10 2 2
MIRT714249 TMEM78 transmembrane protein 78 2 2
MIRT714374 PPP1R8 protein phosphatase 1 regulatory subunit 8 2 2
MIRT714554 LMTK2 lemur tyrosine kinase 2 2 2
MIRT714955 MEOX2 mesenchyme homeobox 2 2 2
MIRT714962 N4BP2 NEDD4 binding protein 2 2 2
MIRT715157 FIG4 FIG4 phosphoinositide 5-phosphatase 2 2
MIRT715340 VMP1 vacuole membrane protein 1 2 2
MIRT716244 PALM2 paralemmin 2 2 2
MIRT716476 SAMD7 sterile alpha motif domain containing 7 2 2
MIRT716876 PHF16 jade family PHD finger 3 1 1
MIRT716981 GPR155 G protein-coupled receptor 155 2 2
MIRT717026 KRTAP4-9 keratin associated protein 4-9 2 2
MIRT717657 THBS2 thrombospondin 2 2 2
MIRT717834 NEGR1 neuronal growth regulator 1 2 2
MIRT718053 CYP3A5 cytochrome P450 family 3 subfamily A member 5 2 2
MIRT718312 TMPRSS11B transmembrane protease, serine 11B 2 2
MIRT718679 FZD2 frizzled class receptor 2 2 2
MIRT719109 MAML1 mastermind like transcriptional coactivator 1 2 2
MIRT719275 SETD7 SET domain containing lysine methyltransferase 7 2 2
MIRT719670 SPDYE1 speedy/RINGO cell cycle regulator family member E1 2 2
MIRT719689 STX6 syntaxin 6 2 2
MIRT719863 CYP4F11 cytochrome P450 family 4 subfamily F member 11 2 2
MIRT719887 RRP36 ribosomal RNA processing 36 2 2
MIRT720307 CSRNP3 cysteine and serine rich nuclear protein 3 2 2
MIRT721135 SNRK SNF related kinase 2 2
MIRT721494 THRB thyroid hormone receptor beta 2 2
MIRT721585 LRRC2 leucine rich repeat containing 2 2 2
MIRT721855 CENPJ centromere protein J 2 2
MIRT721971 RAD50 RAD50 double strand break repair protein 2 2
MIRT722262 MAT1A methionine adenosyltransferase 1A 2 2
MIRT722323 PKHD1 PKHD1, fibrocystin/polyductin 2 2
MIRT722360 LGSN lengsin, lens protein with glutamine synthetase domain 2 2
MIRT722486 PNKD paroxysmal nonkinesigenic dyskinesia 2 2
MIRT722768 KCNK5 potassium two pore domain channel subfamily K member 5 2 2
MIRT722959 SLC25A26 solute carrier family 25 member 26 2 2
MIRT723266 TAL2 TAL bHLH transcription factor 2 2 2
MIRT723277 KRTAP21-2 keratin associated protein 21-2 2 2
MIRT723438 NDUFAF3 NADH:ubiquinone oxidoreductase complex assembly factor 3 2 2
MIRT723539 PAGR1 PAXIP1 associated glutamate rich protein 1 2 2
MIRT723629 KLC3 kinesin light chain 3 2 2
MIRT723801 BDKRB2 bradykinin receptor B2 2 2
MIRT723869 KLHL26 kelch like family member 26 2 2
MIRT723960 GPR146 G protein-coupled receptor 146 2 2
MIRT724476 CSNK1A1 casein kinase 1 alpha 1 2 2
MIRT724533 ABCG5 ATP binding cassette subfamily G member 5 2 2
MIRT725154 SEC62 SEC62 homolog, preprotein translocation factor 2 2
MIRT725362 MTF2 metal response element binding transcription factor 2 2 2

Error report submission