miRTarBase - #MIRT198187


—
pre-miRNA Information
pre-miRNA hsa-mir-1284   
Genomic Coordinates chr3: 71541970 - 71542089
Synonyms MIRN1284, hsa-mir-1284, MIR1284
Description Homo sapiens miR-1284 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-1284
Sequence 30| UCUAUACAGACCCUGGCUUUUC |51
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30511077 21 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1214878057 1 dbSNP
rs1247879523 2 dbSNP
rs1463875891 2 dbSNP
rs917753908 4 dbSNP
rs370463488 6 dbSNP
rs1423493129 7 dbSNP
rs1471537963 7 dbSNP
rs764647172 11 dbSNP
rs763621942 12 dbSNP
rs775929072 14 dbSNP
rs1461964877 17 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol EIF4A1   
Synonyms DDX2A, EIF-4A, EIF4A, eIF-4A-I, eIF4A-I
Description eukaryotic translation initiation factor 4A1
Transcript NM_001416   
Expression
Putative miRNA Targets on EIF4A1
3'UTR of EIF4A1
(miRNA target sites are highlighted)		 
>EIF4A1|NM_001416|3'UTR
   1 GGGGCTGTCCTGCCACCCAGCCCCAGCCAGGGCTCAATCTCTGGGGGCTGAGGAGCAGCAGGAGGGGGGAGGGAAGGGAG
  81 CCAAGGGATGGACATCTTGTCATTTTTTTTCTTTGAATAAATGTCACTTTTTGAGGCAAAAGAAGGAACCGTGAACATTT
 161 TAGACACCCTTTTCTTTGGGGTAGGCTCTTGCCCCAGGCGCCGGCTCTTCTCCCAAAAAAAAAAAAAAAACACTAATCCA
 241 TTTCCCTAACCTAGTAACCTCCAGATCCCAGAGGCTCTCCTCACCTCAGCTGAGCTCCTTTGAAAGTGATTCAAGGGACT
 321 ATGTCACTCAGCCTCATTTGCTGGACCAAATCTGGAGGGAGAACCCCTAAAACCCCTAAGTGAGGTTGCCCAGGGGGTTG
 401 TCCCCAGGTGGGGGGAAGCAGGGGAGAGAAAATGGTAGCCATTTTTACATTGTTTTGTATAGTATTTATTGATTCAGGAA
 481 ACAAACACAAAATTCTGAATAAAATGACTTGGAAACTGCCAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' cuuuucggucCCAGACAUAUCu 5'
                    | |:||||||| 
Target 5' tttttacattGTTTTGTATAGt 3'
 442 - 463 148.00 -9.30
2 
miRNA  3' cuuuUCGGUCCC-AG--ACAUAUCu 5'
              |||||||| ||  | | |:| 
Target 5' ccccAGCCAGGGCTCAATCTCTGGg 3'
 21 - 45 92.00 -15.57
3 
miRNA  3' cuUUUCGGUCCCAGACAUAUcu 5'
            ::||||| ||  || | |  
Target 5' agGGAGCCAAGGGATGGACAtc 3'
 75 - 96 84.00 -13.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30455022 3 COSMIC
COSN30481310 4 COSMIC
COSN23020003 24 COSMIC
COSN7455755 70 COSMIC
COSN31506037 92 COSMIC
COSN31600611 107 COSMIC
COSN31499588 118 COSMIC
COSN31558674 126 COSMIC
COSN31537989 201 COSMIC
COSN19664629 215 COSMIC
COSN20113472 231 COSMIC
COSN20113473 231 COSMIC
COSN21290921 266 COSMIC
COSN23015247 391 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1365826106 1 dbSNP
rs747389657 3 dbSNP
rs533466008 4 dbSNP
rs777134562 5 dbSNP
rs1225536205 6 dbSNP
rs1333540275 10 dbSNP
rs1377776585 11 dbSNP
rs777167454 11 dbSNP
rs769381459 13 dbSNP
rs376082166 14 dbSNP
rs1289570782 16 dbSNP
rs762627348 17 dbSNP
rs766288889 18 dbSNP
rs751368160 19 dbSNP
rs759368862 21 dbSNP
rs767393553 23 dbSNP
rs940785799 27 dbSNP
rs1242296894 30 dbSNP
rs545128288 40 dbSNP
rs3199620 42 dbSNP
rs763400800 42 dbSNP
rs368888501 43 dbSNP
rs1383965148 48 dbSNP
rs757627171 50 dbSNP
rs1164710289 52 dbSNP
rs376209593 56 dbSNP
rs549187649 57 dbSNP
rs1045348843 60 dbSNP
rs1050095840 61 dbSNP
rs1199711076 64 dbSNP
rs1342196325 65 dbSNP
rs904116739 66 dbSNP
rs889959383 67 dbSNP
rs1019905056 76 dbSNP
rs1430520053 81 dbSNP
rs1369973643 85 dbSNP
rs1167280768 87 dbSNP
rs1269962446 94 dbSNP
rs1369477585 95 dbSNP
rs1187270034 97 dbSNP
rs1422933651 103 dbSNP
rs936883220 104 dbSNP
rs183353697 105 dbSNP
rs1253611261 116 dbSNP
rs1183850077 128 dbSNP
rs1483101969 128 dbSNP
rs1054126029 130 dbSNP
rs3209632 143 dbSNP
rs1203010545 145 dbSNP
rs891435102 151 dbSNP
rs1265854238 152 dbSNP
rs1243769326 158 dbSNP
rs1338432809 162 dbSNP
rs1290477057 163 dbSNP
rs1410595208 165 dbSNP
rs940861498 167 dbSNP
rs762312853 169 dbSNP
rs531923664 170 dbSNP
rs1392037523 175 dbSNP
rs186194028 175 dbSNP
rs958003546 181 dbSNP
rs568806217 187 dbSNP
rs970585586 200 dbSNP
rs1472708110 201 dbSNP
rs1250518814 204 dbSNP
rs981921212 208 dbSNP
rs751996944 209 dbSNP
rs1160360825 211 dbSNP
rs1209123848 212 dbSNP
rs1353997778 213 dbSNP
rs1269722095 215 dbSNP
rs1385541045 215 dbSNP
rs1491052350 215 dbSNP
rs575255819 215 dbSNP
rs745903438 215 dbSNP
rs879054228 215 dbSNP
rs907812521 215 dbSNP
rs962279814 215 dbSNP
rs973318934 216 dbSNP
rs920257660 226 dbSNP
rs1050166349 227 dbSNP
rs368262848 227 dbSNP
rs1198093282 228 dbSNP
rs551534772 228 dbSNP
rs1041598571 229 dbSNP
rs1249729390 229 dbSNP
rs902651986 229 dbSNP
rs1000205759 230 dbSNP
rs1306071910 231 dbSNP
rs1231794547 232 dbSNP
rs1405959558 232 dbSNP
rs1054004272 234 dbSNP
rs893821618 236 dbSNP
rs1012248344 237 dbSNP
rs1315791185 238 dbSNP
rs996401120 240 dbSNP
rs1028798386 243 dbSNP
rs1402367066 245 dbSNP
rs1171478754 247 dbSNP
rs1241166690 251 dbSNP
rs1391921705 252 dbSNP
rs1189076173 254 dbSNP
rs1448672428 255 dbSNP
rs1281860014 258 dbSNP
rs1245906411 259 dbSNP
rs1212587836 261 dbSNP
rs1443214215 262 dbSNP
rs970786958 263 dbSNP
rs1198783276 271 dbSNP
rs765536393 274 dbSNP
rs1344348889 277 dbSNP
rs1003599612 278 dbSNP
rs951983656 280 dbSNP
rs984636868 282 dbSNP
rs374716669 284 dbSNP
rs566584944 289 dbSNP
rs757831321 295 dbSNP
rs189726598 298 dbSNP
rs1340668150 304 dbSNP
rs1332983183 307 dbSNP
rs1432349809 308 dbSNP
rs1371821561 309 dbSNP
rs1169142692 312 dbSNP
rs1429017904 313 dbSNP
rs1417215266 314 dbSNP
rs962013896 316 dbSNP
rs1183351313 320 dbSNP
rs1473277945 322 dbSNP
rs3809719 322 dbSNP
rs553858139 332 dbSNP
rs920513809 333 dbSNP
rs543029747 334 dbSNP
rs985743049 335 dbSNP
rs1292515469 337 dbSNP
rs1229223230 342 dbSNP
rs1481894128 348 dbSNP
rs746249034 354 dbSNP
rs969469146 360 dbSNP
rs1283263996 362 dbSNP
rs1412462853 362 dbSNP
rs1250328638 369 dbSNP
rs781219405 370 dbSNP
rs573837480 373 dbSNP
rs1409180886 374 dbSNP
rs115950468 375 dbSNP
rs936915699 377 dbSNP
rs1052680842 378 dbSNP
rs140579540 380 dbSNP
rs1163070332 381 dbSNP
rs766422287 389 dbSNP
rs1040156431 391 dbSNP
rs1444108828 393 dbSNP
rs1248984969 394 dbSNP
rs901604204 395 dbSNP
rs1222897826 409 dbSNP
rs1164350495 410 dbSNP
rs924110024 410 dbSNP
rs935481357 410 dbSNP
rs995918975 410 dbSNP
rs751644715 412 dbSNP
rs1343900559 415 dbSNP
rs182358735 418 dbSNP
rs754935155 419 dbSNP
rs894062809 422 dbSNP
rs781147325 425 dbSNP
rs1295224001 427 dbSNP
rs1437036257 429 dbSNP
rs1349145292 431 dbSNP
rs1323641138 433 dbSNP
rs1428134328 437 dbSNP
rs752467776 440 dbSNP
rs1459057125 442 dbSNP
rs1412943305 452 dbSNP
rs1045101146 456 dbSNP
rs1417435435 457 dbSNP
rs1396961498 462 dbSNP
rs1006130804 465 dbSNP
rs1192293919 465 dbSNP
rs1392994198 466 dbSNP
rs1014773749 468 dbSNP
rs1251571264 473 dbSNP
rs545019014 476 dbSNP
rs1014016770 478 dbSNP
rs1332147679 479 dbSNP
rs1024950526 482 dbSNP
rs1302748867 483 dbSNP
rs1314627959 483 dbSNP
rs200091502 485 dbSNP
rs1316624395 489 dbSNP
rs186625963 494 dbSNP
rs755853157 497 dbSNP
rs1366780936 506 dbSNP
rs192649386 507 dbSNP
rs1014975354 509 dbSNP
rs1389048509 510 dbSNP
rs533094531 517 dbSNP
rs1227232474 518 dbSNP
rs969879666 519 dbSNP
rs1361023004 521 dbSNP
rs747058645 521 dbSNP
Experimental Support 1 for Non-Functional miRNA-Target Interaction
miRNA:Target xx
Validation Method
     
Conditions SGC7901
Disease 1973.0; gastric cancer
Location of target site 3'UTR
Tools used in this research TargetScan
Original Description (Extracted from the article) ... "miR-1284 can heighten the expression of MYC and reduce the expression of JUN ...

- Cao W; Wei W; Zhan Z; Xie Y; Xiao Q, 2016, Oncology reports.

Article - Cao W; Wei W; Zhan Z; Xie Y; Xiao Q
- Oncology reports, 2016
Routine chemotherapy as an important treatment mode often can not be effective because of multidrug resistance (MDR). MicroRNA (miRNA) modulates the expression of a great number of genes, including MDR. In this study, the expression of miR-1284 was reduced in gastric cancer (GC) tissue specimens with metastasis and in vincristine-resistant (VCR) GC SGC7901 cells (SGC-7901/VCR) compared to that in the controls. Recombinant lentiviral vectors with miR-1284 led to the overexpression of miR-1284 mRNA and reversed the chemoresistance of SGC7901/VCR cells, promoted cell cycle arrested at the G0/G1 phase, accelerated drug-induced apoptosis, and decreased migration and invasiveness of SGC-7901/VCR. In addition, the overexpression of miR-1284 sensitized tumors to chemotherapy in vivo. Our data provide combined evidence that miR-1284 can heighten the expression of MYC and reduce the expression of JUN, MMP12, and EIF4A1 that was the direct target. In conclusion, miR-1284 can function as a new regulator to reduce GC MDR cells by targeting EIF4A1.
LinkOut: [PMID: 26936591]
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.656 2.5e-4 -0.612 7.4e-4 24 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.412 2.0e-2 0.432 1.6e-2 25 Click to see details
GSE42095 Differentiated embryonic stem cells 0.326 6.4e-2 -0.029 4.5e-1 23 Click to see details
GSE38226 Liver fibrosis 0.341 6.5e-2 0.045 4.2e-1 21 Click to see details
GSE32688 Pancreatic cancer 0.235 9.8e-2 0.261 7.5e-2 32 Click to see details
GSE28260 Renal cortex and medulla -0.257 2.0e-1 -0.203 2.5e-1 13 Click to see details
GSE26953 Aortic valvular endothelial cells -0.011 4.8e-1 0.066 3.8e-1 24 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
KIRP -0.591 0.05 -0.617 0.04 9 Click to see details
LUSC 0.364 0.08 0.225 0.19 17 Click to see details
THCA -0.259 0.11 -0.235 0.13 25 Click to see details
PAAD -0.769 0.22 -0.500 0.33 3 Click to see details
HNSC 0.184 0.26 0.007 0.49 14 Click to see details
LUAD -0.317 0.27 0.086 0.44 6 Click to see details
LIHC 0.106 0.32 0.068 0.38 21 Click to see details
CHOL -0.21 0.34 -0.314 0.27 6 Click to see details
KIRC -0.259 0.37 -0.400 0.3 4 Click to see details
STAD -0.099 0.39 -0.082 0.41 11 Click to see details
KICH 0.176 0.39 0.300 0.31 5 Click to see details
BLCA 0.085 0.44 0.257 0.31 6 Click to see details
BRCA 0.019 0.48 -0.027 0.47 13 Click to see details
UCEC 0.006 0.5 -0.143 0.39 6 Click to see details
UCEC 0.006 0.5 -0.143 0.39 6 Click to see details
UCEC 0.006 0.5 -0.143 0.39 6 Click to see details
UCEC 0.006 0.5 -0.143 0.39 6 Click to see details
46 hsa-miR-1284 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT035831 PRRC2B proline rich coiled-coil 2B 1 1
MIRT079621 DNAJB4 DnaJ heat shock protein family (Hsp40) member B4 2 2
MIRT149901 LDLR low density lipoprotein receptor 2 2
MIRT182786 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT188827 TMTC3 transmembrane and tetratricopeptide repeat containing 3 2 2
MIRT198187 EIF4A1 eukaryotic translation initiation factor 4A1 3 1
MIRT245472 ARID5B AT-rich interaction domain 5B 2 2
MIRT252245 PMAIP1 phorbol-12-myristate-13-acetate-induced protein 1 2 6
MIRT269363 WEE1 WEE1 G2 checkpoint kinase 2 2
MIRT320406 HOXA9 homeobox A9 2 4
MIRT474722 KIF13A kinesin family member 13A 2 6
MIRT497926 BTG1 BTG anti-proliferation factor 1 2 2
MIRT504264 C1orf147 chromosome 1 open reading frame 147 2 4
MIRT520449 TSPAN2 tetraspanin 2 2 4
MIRT524092 DNAJB14 DnaJ heat shock protein family (Hsp40) member B14 2 4
MIRT528639 SENP6 SUMO1/sentrin specific peptidase 6 2 2
MIRT537385 FGF2 fibroblast growth factor 2 2 2
MIRT538902 BRI3BP BRI3 binding protein 2 2
MIRT542095 KCNK10 potassium two pore domain channel subfamily K member 10 2 6
MIRT543976 PRR23A proline rich 23A 2 2
MIRT549625 ADCYAP1 adenylate cyclase activating polypeptide 1 2 4
MIRT554298 SIPA1L2 signal induced proliferation associated 1 like 2 2 2
MIRT554872 RCAN2 regulator of calcineurin 2 2 2
MIRT567623 FAM210A family with sequence similarity 210 member A 2 2
MIRT571137 TTC33 tetratricopeptide repeat domain 33 2 2
MIRT576361 Pxdn peroxidasin 2 2
MIRT611088 PHF8 PHD finger protein 8 2 2
MIRT612380 TCTE1 t-complex-associated-testis-expressed 1 2 4
MIRT613725 MTPN myotrophin 2 2
MIRT614627 YAE1D1 Yae1 domain containing 1 2 2
MIRT615818 KIAA1549L KIAA1549 like 2 2
MIRT620949 TBCK TBC1 domain containing kinase 2 2
MIRT622339 SCN4A sodium voltage-gated channel alpha subunit 4 2 2
MIRT623219 MTA3 metastasis associated 1 family member 3 2 4
MIRT628932 SLC1A4 solute carrier family 1 member 4 2 2
MIRT632121 FKBP9 FK506 binding protein 9 2 2
MIRT635877 COX17 COX17, cytochrome c oxidase copper chaperone 2 2
MIRT636485 IKBKG inhibitor of nuclear factor kappa B kinase subunit gamma 2 2
MIRT653097 SRSF7 serine and arginine rich splicing factor 7 2 2
MIRT655048 PKN2 protein kinase N2 2 2
MIRT686946 SFT2D3 SFT2 domain containing 3 2 2
MIRT692724 INPP5B inositol polyphosphate-5-phosphatase B 2 2
MIRT697282 ZNF800 zinc finger protein 800 2 2
MIRT698995 SPAG9 sperm associated antigen 9 2 2
MIRT704462 CRNKL1 crooked neck pre-mRNA splicing factor 1 2 2
MIRT715163 FIG4 FIG4 phosphoinositide 5-phosphatase 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-1 Anthocyanin NULL 145858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Caffeic acid NULL 689043 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Catechin approved 9064 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Curcumin NULL 969516 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Ferulic acid NULL 445858 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Hesperidin NULL 10621 Microarray apoE−/− mice 22253797 2012 up-regulated
miR-1 Quercetin NULL 5280343 Microarray apoE−/− mice 22253797 2012 down-regulated
miR-1 Galactose NULL 6036 Quantitative real-time PCR lens 22736950 2012 up-regulated
miR-1 Hexahydro-1,3,5-trinitro-1,3,5-triazine (RDX) NULL 8490 Microarray mouse brain 19270793 2009 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Quantitative real-time PCR myocardial differentiation of mouse ES cells 19521018 2009 down-regulated
miR-1 Sulfonyl-hydrazone-1 (SHZ) NULL NULL Quantitative real-time PCR Murine broblast-derived Induced pluripotent stem cells 21445862 2011 up-regulated
miR-1 Cocaine NULL 446220 Next-generation sequencing ventral striatum 21708909 2011 up-regulated
miR-1 Atorvastatin approved 60823 Quantitative real-time PCR Cardiomyocyte 23860036 2013 down-regualted
miR-1 Glucose NULL 5793 Quantitative real-time PCR endothelial cells 24394957 2014 down-regulated
miR-1 Docosahexaenoic acid NULL 445580 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 Palmitic acid approved 985 Quantitative real-time PCR Caco-2 cells 24623846 2014 up-regulated
miR-1 17beta-estradiol (E2) approved 5757 Microarray MCF-7AKT breast cancer cells 19528081 2009 down-regulated
miR-1 Essential amino acids (EAA) NULL NULL Quantitative real-time PCR skeletal muscle of young adults 19828686 2009 up-regulated
miR-1 Hydrogen peroxide (H2O2) NULL 784 Quantitative real-time PCR Human umbilical vein endothelial cells 21527937 2011 down-regulated
miR-1 Trichostatin A (TSA) NULL 444732 Microarray apoptosis-resistant breast cancer cells 21971930 2011 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR acute promyelocytic leukemia 22072212 2012 up-regulated
miR-1 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miR-1 Bicalutamide approved 2375 Microarray prostate 22674191 2012 up-regulated
miR-1 Arsenic trioxide approved 14888 Quantitative real-time PCR cardia 22889704 2012 up-regulated
miR-1 Perfluorooctane sulfonate NULL 74483 Microarray zebrafish embryos 20878907 2011 up-regulated
miR-1 Quinidine approved 441074 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 up-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR myocardial infarction (MI) rats 19775284 2009 down-regulated
miR-1 Tanshinone IIA NULL 164676 Quantitative real-time PCR post-infarction rat cardiomyocytes 21220930 2011 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 down-regulated
miR-1 Dexamethasone approved 5743 Microarray adrenals and granulosa cells 24205079 2014 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 up-regulated
miR-1 Thiourea (TU) NULL 737139 Quantitative real-time PCR skeletal muscle and heart 22142802 2012 down-regulated
miR-1 Isoproterenol approved 3779 Quantitative real-time PCR heart 22847192 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-1284 Ceritinib 57379345 NSC776422 approved resistant High Non-Small Cell Lung Cancer cell line (H3122, H2228)
hsa-mir-1284 Sorafenib 216239 NSC747971 approved sensitive High Hepatocellular Carcinoma tissue
hsa-miR-1284 Vincristine 5978 approved sensitive Low Gastric Cancer cell line (SGC-7901)
hsa-miR-1284 Cisplatin 5460033 NSC119875 approved sensitive Low Cervical Cancer cell line (HeLa, SiHa)
hsa-miR-1284 Cisplatin + Decitabine sensitive High Non-Small Cell Lung Cancer cell line (A549)
hsa-mir-1284 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-1284 Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-1284 Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-1284 Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-1284 Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-1284 Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-1284 Vemurafenib 42611257 NSC761431 approved resistant cell line (LM16)
hsa-miR-1284 Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM17)
hsa-miR-1284 Vemurafenib 42611257 NSC761431 approved resistant cell line (LM47)
hsa-miR-1284 Vemurafenib 42611257 NSC761431 approved resistant cell line (LM36)
hsa-miR-1284 Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM43)
hsa-miR-1284 Vemurafenib 42611257 NSC761431 approved sensitive cell line (LM11)
hsa-miR-1284 Tamoxifen 2733525 NSC180973 approved sensitive cell line (LCC2)
hsa-miR-1284 4-Hydroxytamoxifen+Tamoxifen resistant cell line (LY2)
hsa-miR-1284 Pegylated interferon alpha+Ribavirin sensitive tissue (chronic hepatitis C)
hsa-miR-1284 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-1284 Neoadjuvant chemotherapy resistant tissue (breast cancer)
hsa-miR-1284 Ceritinib 57379345 NSC776422 approved resistant cell line (H3122)
hsa-miR-1284 Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide sensitive cell line (Bads-200)

Error report submission