miRTarBase - #MIRT202308


—
pre-miRNA Information
pre-miRNA hsa-mir-561   
Genomic Coordinates chr2: 188297492 - 188297588
Synonyms MIRN561, hsa-mir-561, MIR561
Description Homo sapiens miR-561 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-561-3p
Sequence 61| CAAAGUUUAAGAUCCUUGAAGU |82
Evidence Experimental
Experiments SAGE
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 3 2 + 188297554 26449202, 27587585, 29233923 MiREDiBase
A-to-I 4 2 + 188297555 26449202, 27587585, 29233923 MiREDiBase
A-to-I 9 2 + 188297560 26449202, 27587585, 29267965, 29165639 MiREDiBase
A-to-I 10 2 + 188297561 26449202, 27587585, 29233923 MiREDiBase
A-to-I 19 2 + 188297570 29233923 MiREDiBase
A-to-I 20 2 + 188297571 26449202, 27587585, 29233923 MiREDiBase
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN16051820 1 COSMIC
COSN30152233 18 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1050331859 4 dbSNP
rs1308584826 15 dbSNP
rs1022262507 18 dbSNP
rs1317728266 20 dbSNP
Putative Targets

Gene Information
Gene Symbol CEBPB   
Synonyms C/EBP-beta, IL6DBP, NF-IL6, TCF5
Description CCAAT/enhancer binding protein beta
Transcript NM_005194   
Expression
Putative miRNA Targets on CEBPB
3'UTR of CEBPB
(miRNA target sites are highlighted)		 
>CEBPB|NM_005194|3'UTR
   1 CGCGGCCCCCGCGCGCGTCCCCCTGCCGGCCGGGGCTGAGACTCCGGGGAGCGCCCGCGCCCGCGCCCTCGCCCCCGCCC
  81 CCGGCGGCGCCGGCAAAACTTTGGCACTGGGGCACTTGGCAGCGCGGGGAGCCCGTCGGTAATTTTAATATTTTATTATA
 161 TATATATATCTATATTTTTGTCCAAACCAACCGCACATGCAGATGGGGCTCCCGCCCGTGGTGTTATTTAAAGAAGAAAC
 241 GTCTATGTGTACAGATGAATGATAAACTCTCTGCTTCTCCCTCTGCCCCTCTCCAGGCGCCGGCGGGCGGGCCGGTTTCG
 321 AAGTTGATGCAATCGGTTTAAACATGGCTGAACGCGTGTGTACACGGGACTGACGCAACCCACGTGTAACTGTCAGCCGG
 401 GCCCTGAGTAATCGCTTAAAGATGTTCCTACGGGCTTGTTGCTGTTGATGTTTTGTTTTGTTTTGTTTTTTGGTCTTTTT
 481 TTGTATTATAAAAAATAATCTATTTCTATGAGAAAAGAGGCGTCTGTATATTTTGGGAATCTTTTCCGTTTCAAGCATTA
 561 AGAACACTTTTAATAAACTTTTTTTTGAGAATGGTTACAAAGCCTTTTGGGGGCAGTAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ugaaguuccuagaaUUUGAAAc 5'
                        ||||||| 
Target 5' cggcggcgccggcaAAACTTTg 3'
 82 - 103 140.00 -10.00
2 
miRNA  3' ugaaguuccUAGAA---UUUGAAAc 5'
                   ||:||   || |||| 
Target 5' cgtctgtatATTTTGGGAATCTTTt 3'
 521 - 545 117.00 -6.63
3 
miRNA  3' ugaaguuCCUAGAAUUUGAaac 5'
                 ||: || |:|||   
Target 5' gccggccGGGGCTGAGACTccg 3'
 25 - 46 99.00 -8.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30174428 33 COSMIC
COSN32063403 90 COSMIC
COSN30530035 120 COSMIC
COSN30513130 145 COSMIC
COSN24307028 209 COSMIC
COSN26293284 314 COSMIC
COSN31484132 321 COSMIC
COSN15623616 326 COSMIC
COSN31484130 351 COSMIC
COSN19420489 386 COSMIC
COSN8000431 437 COSMIC
COSN30534996 483 COSMIC
COSN30533436 485 COSMIC
COSN31551053 496 COSMIC
COSN30534028 575 COSMIC
COSN15623617 587 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1477186025 4 dbSNP
rs745903016 6 dbSNP
rs777416244 7 dbSNP
rs1400136193 9 dbSNP
rs1050023817 10 dbSNP
rs1156782494 11 dbSNP
rs1362456954 14 dbSNP
rs1420205677 15 dbSNP
rs1302350805 17 dbSNP
rs561942729 18 dbSNP
rs757651622 22 dbSNP
rs756312550 26 dbSNP
rs779200975 28 dbSNP
rs746426283 29 dbSNP
rs1310793776 31 dbSNP
rs772450886 32 dbSNP
rs775696986 33 dbSNP
rs1289656851 34 dbSNP
rs891398872 44 dbSNP
rs1316354446 46 dbSNP
rs915880813 47 dbSNP
rs1008414622 49 dbSNP
rs747071489 50 dbSNP
rs1021117795 51 dbSNP
rs1345520317 51 dbSNP
rs1339862755 52 dbSNP
rs1234437973 56 dbSNP
rs1470287820 57 dbSNP
rs1318385571 60 dbSNP
rs966842459 63 dbSNP
rs1345220687 64 dbSNP
rs1319921648 65 dbSNP
rs1173399251 70 dbSNP
rs1412374759 70 dbSNP
rs1382794256 71 dbSNP
rs1445932209 72 dbSNP
rs1454926772 72 dbSNP
rs529249404 73 dbSNP
rs1485602609 74 dbSNP
rs1242745236 78 dbSNP
rs1392068904 79 dbSNP
rs898006913 81 dbSNP
rs1032800115 84 dbSNP
rs1327218969 87 dbSNP
rs991197826 88 dbSNP
rs746535168 89 dbSNP
rs917908550 92 dbSNP
rs1447719299 93 dbSNP
rs1314637512 96 dbSNP
rs1213884682 106 dbSNP
rs1362098554 114 dbSNP
rs1380935350 116 dbSNP
rs971345491 118 dbSNP
rs929437390 121 dbSNP
rs200273644 138 dbSNP
rs939796566 139 dbSNP
rs45491391 140 dbSNP
rs45554839 140 dbSNP
rs560057016 142 dbSNP
rs919642184 149 dbSNP
rs932407115 157 dbSNP
rs1474386139 159 dbSNP
rs1256877102 160 dbSNP
rs1211743865 164 dbSNP
rs1486590900 165 dbSNP
rs1249571791 166 dbSNP
rs777282272 169 dbSNP
rs887567829 181 dbSNP
rs1007707663 185 dbSNP
rs1049883526 185 dbSNP
rs1297543062 197 dbSNP
rs1231062824 198 dbSNP
rs890793877 204 dbSNP
rs1008467942 212 dbSNP
rs1274802523 214 dbSNP
rs1017293001 223 dbSNP
rs1296970134 224 dbSNP
rs1381911295 224 dbSNP
rs1438200270 228 dbSNP
rs1461737930 232 dbSNP
rs1355472507 234 dbSNP
rs1173057726 236 dbSNP
rs1460049326 239 dbSNP
rs761553552 245 dbSNP
rs1042582044 246 dbSNP
rs1240880707 252 dbSNP
rs901483819 261 dbSNP
rs997445163 263 dbSNP
rs1248249732 270 dbSNP
rs1176548202 271 dbSNP
rs533591849 272 dbSNP
rs758459434 272 dbSNP
rs768721866 276 dbSNP
rs1020846589 280 dbSNP
rs1211631026 281 dbSNP
rs1475345181 282 dbSNP
rs551986838 282 dbSNP
rs1166676303 287 dbSNP
rs1422012570 288 dbSNP
rs966617547 289 dbSNP
rs1391304235 290 dbSNP
rs1374754500 292 dbSNP
rs1439196045 299 dbSNP
rs979325617 300 dbSNP
rs1466461894 303 dbSNP
rs111742036 306 dbSNP
rs563412156 314 dbSNP
rs1025432810 315 dbSNP
rs1158540507 320 dbSNP
rs991960692 332 dbSNP
rs915927724 333 dbSNP
rs1191461657 334 dbSNP
rs1334874849 335 dbSNP
rs1467879451 336 dbSNP
rs971337797 345 dbSNP
rs1325956221 359 dbSNP
rs1348169624 360 dbSNP
rs981662249 366 dbSNP
rs974343478 376 dbSNP
rs762250460 377 dbSNP
rs929551875 399 dbSNP
rs1312121316 400 dbSNP
rs932431275 405 dbSNP
rs1340066662 409 dbSNP
rs1327065196 433 dbSNP
rs1222660054 435 dbSNP
rs370088659 436 dbSNP
rs912236969 443 dbSNP
rs1325207896 449 dbSNP
rs943665321 454 dbSNP
rs1042635791 455 dbSNP
rs1382032562 466 dbSNP
rs549014431 467 dbSNP
rs1171687763 475 dbSNP
rs1049257009 484 dbSNP
rs1395440206 487 dbSNP
rs909352221 492 dbSNP
rs1195314790 494 dbSNP
rs567160237 496 dbSNP
rs902742839 497 dbSNP
rs1205148710 498 dbSNP
rs936909943 499 dbSNP
rs1054403765 501 dbSNP
rs1194782997 503 dbSNP
rs943150307 503 dbSNP
rs1347855481 504 dbSNP
rs1304588013 508 dbSNP
rs1244320138 515 dbSNP
rs3209551 518 dbSNP
rs1324860208 519 dbSNP
rs1039162806 520 dbSNP
rs895308966 522 dbSNP
rs1012753708 525 dbSNP
rs1362533499 535 dbSNP
rs1311199754 539 dbSNP
rs901514963 540 dbSNP
rs770581511 541 dbSNP
rs534576560 547 dbSNP
rs1474314510 549 dbSNP
rs1427674915 567 dbSNP
rs1372080105 568 dbSNP
rs765739307 572 dbSNP
rs1478633784 575 dbSNP
rs1254750313 577 dbSNP
rs1173393677 579 dbSNP
rs1485609446 579 dbSNP
rs1042070076 580 dbSNP
rs1380603668 581 dbSNP
rs546518988 588 dbSNP
rs1337859470 590 dbSNP
rs1251169862 596 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000303004.3 | 3UTR | AACACUUUUAAUAAACUUUUUUUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE28544 Breast cancer -0.555 2.4e-3 -0.645 3.3e-4 24 Click to see details
GSE42095 Differentiated embryonic stem cells -0.425 2.2e-2 -0.498 7.8e-3 23 Click to see details
GSE14794 Lymphoblastoid cells -0.191 3.6e-2 -0.170 5.5e-2 90 Click to see details
GSE38226 Liver fibrosis 0.392 3.9e-2 0.366 5.1e-2 21 Click to see details
GSE26953 Aortic valvular endothelial cells 0.288 8.6e-2 0.238 1.3e-1 24 Click to see details
GSE28260 Renal cortex and medulla -0.385 9.7e-2 -0.374 1.0e-1 13 Click to see details
GSE32688 Pancreatic cancer 0.165 1.8e-1 0.209 1.3e-1 32 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis -0.161 2.5e-1 -0.015 4.7e-1 20 Click to see details
GSE15076 Monocyte-derived dendritic cells 0.225 3.0e-1 0.143 3.7e-1 8 Click to see details
GSE17306 Multiple myeloma 0.073 3.1e-1 0.503 1.2e-4 49 Click to see details
GSE21687 Ependynoma primary tumors -0.057 3.3e-1 0.006 4.8e-1 64 Click to see details
GSE38974 Chronic obstructive pulmonary disease 0.086 3.4e-1 0.103 3.1e-1 25 Click to see details
GSE27834 Pluripotent stem cells 0.081 3.8e-1 0.103 3.5e-1 16 Click to see details
GSE17498 Multiple myeloma -0.003 4.9e-1 -0.002 5.0e-1 40 Click to see details
GSE21849 B cell lymphoma 0.003 4.9e-1 0.310 5.1e-2 29 Click to see details
GSE21849 B cell lymphoma 0.003 4.9e-1 0.310 5.1e-2 29 Click to see details
GSE21849 B cell lymphoma 0.003 4.9e-1 0.310 5.1e-2 29 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
0.003 4.9e-1 0.310 5.1e-2 29 Click to see details
133 hsa-miR-561-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT072097 CHAC1 ChaC glutathione specific gamma-glutamylcyclotransferase 1 2 4
MIRT080799 SH3GLB1 SH3 domain containing GRB2 like, endophilin B1 2 4
MIRT088833 MSH6 mutS homolog 6 2 2
MIRT093446 MSMO1 methylsterol monooxygenase 1 2 2
MIRT099908 SOX4 SRY-box 4 2 10
MIRT107568 VLDLR very low density lipoprotein receptor 2 2
MIRT130135 TXNIP thioredoxin interacting protein 2 2
MIRT136944 FNDC3A fibronectin type III domain containing 3A 2 2
MIRT158447 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT161901 FXR1 FMR1 autosomal homolog 1 2 2
MIRT166271 C5ORF51 chromosome 5 open reading frame 51 2 4
MIRT187291 CLIC4 chloride intracellular channel 4 2 4
MIRT202308 CEBPB CCAAT/enhancer binding protein beta 2 2
MIRT210742 PPP4R2 protein phosphatase 4 regulatory subunit 2 2 2
MIRT249020 PABPC3 poly(A) binding protein cytoplasmic 3 2 2
MIRT268845 C1ORF21 chromosome 1 open reading frame 21 2 2
MIRT304688 GTF2E1 general transcription factor IIE subunit 1 2 2
MIRT316774 FOXC1 forkhead box C1 2 2
MIRT325708 CSTF2 cleavage stimulation factor subunit 2 2 2
MIRT327970 CHIC1 cysteine rich hydrophobic domain 1 2 6
MIRT328758 DHODH dihydroorotate dehydrogenase (quinone) 2 2
MIRT356391 RBPJ recombination signal binding protein for immunoglobulin kappa J region 2 2
MIRT437448 NR0B1 nuclear receptor subfamily 0 group B member 1 1 1
MIRT441383 FRS2 fibroblast growth factor receptor substrate 2 2 2
MIRT442496 PCDH10 protocadherin 10 2 4
MIRT444054 PROX2 prospero homeobox 2 2 2
MIRT446062 RABIF RAB interacting factor 2 2
MIRT446714 FUT10 fucosyltransferase 10 2 2
MIRT456384 CRB1 crumbs 1, cell polarity complex component 2 2
MIRT457022 ACADSB acyl-CoA dehydrogenase, short/branched chain 2 2
MIRT457056 NEGR1 neuronal growth regulator 1 2 2
MIRT457353 RAD51AP1 RAD51 associated protein 1 2 2
MIRT466850 STX6 syntaxin 6 2 2
MIRT471347 PELO pelota mRNA surveillance and ribosome rescue factor 2 2
MIRT474051 LONRF1 LON peptidase N-terminal domain and ring finger 1 2 2
MIRT479058 CNOT6L CCR4-NOT transcription complex subunit 6 like 2 8
MIRT479398 CDKN1B cyclin dependent kinase inhibitor 1B 2 8
MIRT492072 TMED7 transmembrane p24 trafficking protein 7 2 2
MIRT492810 PCBP1 poly(rC) binding protein 1 2 6
MIRT494861 ZNF99 zinc finger protein 99 2 2
MIRT496888 TMTC2 transmembrane and tetratricopeptide repeat containing 2 2 2
MIRT498041 TAOK1 TAO kinase 1 2 2
MIRT500856 SYPL1 synaptophysin like 1 2 8
MIRT501323 RNFT1 ring finger protein, transmembrane 1 2 2
MIRT502795 CELSR3 cadherin EGF LAG seven-pass G-type receptor 3 2 6
MIRT503684 SLC46A1 solute carrier family 46 member 1 2 2
MIRT506383 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT507320 FAM60A SIN3-HDAC complex associated factor 2 6
MIRT507671 CPEB4 cytoplasmic polyadenylation element binding protein 4 2 4
MIRT510809 SENP3 SUMO1/sentrin/SMT3 specific peptidase 3 2 8
MIRT512260 ARPP19 cAMP regulated phosphoprotein 19 2 6
MIRT514215 LRRC63 leucine rich repeat containing 63 2 2
MIRT517729 NT5DC1 5'-nucleotidase domain containing 1 2 4
MIRT520570 TMF1 TATA element modulatory factor 1 2 2
MIRT523456 GPBP1L1 GC-rich promoter binding protein 1 like 1 2 6
MIRT524538 CDCA4 cell division cycle associated 4 2 2
MIRT525478 SPIC Spi-C transcription factor 2 2
MIRT532321 GHSR growth hormone secretagogue receptor 2 2
MIRT534716 RFX7 regulatory factor X7 2 2
MIRT535042 PRKAA1 protein kinase AMP-activated catalytic subunit alpha 1 2 2
MIRT535111 PMEPA1 prostate transmembrane protein, androgen induced 1 2 2
MIRT536665 INIP INTS3 and NABP interacting protein 2 2
MIRT537636 ERGIC2 ERGIC and golgi 2 2 2
MIRT537701 ELOVL6 ELOVL fatty acid elongase 6 2 2
MIRT538060 DMD dystrophin 2 4
MIRT538811 C21orf91 chromosome 21 open reading frame 91 2 2
MIRT539270 ANKRD28 ankyrin repeat domain 28 2 2
MIRT541158 PABPC1 poly(A) binding protein cytoplasmic 1 2 2
MIRT543500 MDM2 MDM2 proto-oncogene 2 4
MIRT545101 TRIM66 tripartite motif containing 66 2 2
MIRT545328 SLC7A5P2 solute carrier family 7 member 5 pseudogene 2 2 2
MIRT545838 ZNF275 zinc finger protein 275 2 2
MIRT546109 USP48 ubiquitin specific peptidase 48 2 4
MIRT548100 GFPT1 glutamine--fructose-6-phosphate transaminase 1 2 4
MIRT549216 BCLAF1 BCL2 associated transcription factor 1 2 4
MIRT549705 RBM23 RNA binding motif protein 23 2 4
MIRT550139 ZNF138 zinc finger protein 138 2 2
MIRT551104 TTC8 tetratricopeptide repeat domain 8 2 2
MIRT551212 MRPL35 mitochondrial ribosomal protein L35 2 2
MIRT551389 ZNF543 zinc finger protein 543 2 4
MIRT553330 TSC22D2 TSC22 domain family member 2 2 2
MIRT553885 SUPT7L SPT7 like, STAGA complex gamma subunit 2 4
MIRT554651 ROBO1 roundabout guidance receptor 1 2 2
MIRT554879 RCAN2 regulator of calcineurin 2 2 2
MIRT555602 PIP4K2C phosphatidylinositol-5-phosphate 4-kinase type 2 gamma 2 2
MIRT556467 LMNB2 lamin B2 2 4
MIRT557838 FNBP1L formin binding protein 1 like 2 2
MIRT558143 ENC1 ectodermal-neural cortex 1 2 2
MIRT558754 CHERP calcium homeostasis endoplasmic reticulum protein 2 2
MIRT560530 TMEM98 transmembrane protein 98 2 2
MIRT561068 EIF4A3 eukaryotic translation initiation factor 4A3 2 2
MIRT561384 TWF1 twinfilin actin binding protein 1 2 2
MIRT561460 TEAD1 TEA domain transcription factor 1 2 2
MIRT561818 NUP155 nucleoporin 155 2 2
MIRT561963 LSM12 LSM12 homolog 2 2
MIRT562183 HNRNPF heterogeneous nuclear ribonucleoprotein F 2 2
MIRT564363 PPWD1 peptidylprolyl isomerase domain and WD repeat containing 1 2 2
MIRT564470 SLC35E2 solute carrier family 35 member E2 2 2
MIRT564755 ZNF146 zinc finger protein 146 2 2
MIRT565532 SON SON DNA binding protein 2 2
MIRT565744 SESN3 sestrin 3 2 2
MIRT566236 PTCH1 patched 1 2 2
MIRT568636 ACVR2A activin A receptor type 2A 2 2
MIRT571081 TCHHL1 trichohyalin like 1 2 2
MIRT571559 YWHAQ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein theta 2 2
MIRT572246 ANP32E acidic nuclear phosphoprotein 32 family member E 2 2
MIRT572908 RUNDC3B RUN domain containing 3B 2 2
MIRT573201 TTC19 tetratricopeptide repeat domain 19 2 2
MIRT573981 DDX21 DExD-box helicase 21 2 2
MIRT614493 LIX1 limb and CNS expressed 1 2 2
MIRT614579 TMTC1 transmembrane and tetratricopeptide repeat containing 1 2 2
MIRT614898 PAPOLG poly(A) polymerase gamma 2 2
MIRT615469 BNC2 basonuclin 2 2 2
MIRT617968 ZNF713 zinc finger protein 713 2 2
MIRT620418 TFDP3 transcription factor Dp family member 3 2 2
MIRT623571 ISL1 ISL LIM homeobox 1 2 2
MIRT624902 USP6NL USP6 N-terminal like 2 2
MIRT625346 TAPBP TAP binding protein 2 2
MIRT628309 CNN3 calponin 3 2 2
MIRT630979 ARL4C ADP ribosylation factor like GTPase 4C 2 2
MIRT637274 KLHL12 kelch like family member 12 2 2
MIRT643959 GALNT13 polypeptide N-acetylgalactosaminyltransferase 13 2 2
MIRT649795 LPCAT3 lysophosphatidylcholine acyltransferase 3 2 2
MIRT653573 SLC35B3 solute carrier family 35 member B3 2 2
MIRT653997 SCYL3 SCY1 like pseudokinase 3 2 2
MIRT654011 SCO1 SCO1, cytochrome c oxidase assembly protein 2 2
MIRT658530 ERP44 endoplasmic reticulum protein 44 2 2
MIRT683755 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT690907 TOP2A DNA topoisomerase II alpha 2 2
MIRT697689 WASL Wiskott-Aldrich syndrome like 2 2
MIRT698820 STK38 serine/threonine kinase 38 2 2
MIRT701625 MYO1B myosin IB 2 2
MIRT712319 PER2 period circadian clock 2 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-561 Glucose NULL 5793 Microarray endothelial cells 24394957 2014 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-561-3p Oxaliplatin 6857599 NSC266046 approved resistant High Colorectal Cancer cell line (HT-29)
hsa-miR-561-3p Trametinib 11707110 NSC758246 approved sensitive High Melanoma cell line (WM266) (200nM)
hsa-miR-561-3p Vemurafenib 42611257 NSC761431 approved sensitive High Melanoma cell line (WM266) (200nM)
hsa-miR-561-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-561-3p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-561-3p Osimertinib 71496458 NSC779217 approved resistant cell line (PC9)
hsa-miR-561-3p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-561-3p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)
hsa-miR-561-3p Fluorouracil 3385 NSC19893 approved resistant cell line (KM12C) (72 h)
hsa-miR-561-3p Sunitinib 5329102 NSC750690 approved resistant tissue (CardA)
hsa-miR-561-3p Pegylated interferon alpha+Ribavirin resistant tissue (chronic hepatitis C)
hsa-miR-561-3p Cisplatin 5460033 NSC119875 approved resistant cell line (IGROV-1)
hsa-miR-561-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-561-3p Cisplatin 5460033 NSC119875 approved resistant cell line (H460)
hsa-miR-561-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)
hsa-miR-561-3p Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)

Error report submission