miRTarBase - #MIRT204634


—
pre-miRNA Information
pre-miRNA hsa-mir-640   
Genomic Coordinates chr19: 19435063 - 19435158
Synonyms MIRN640, hsa-mir-640, MIR640
Description Homo sapiens miR-640 stem-loop
Comment None
RNA Secondary Structure
Associated Diseases

Mature miRNA Information
Mature miRNA hsa-miR-640
Sequence 61| AUGAUCCAGGAACCUGCCUCU |81
Evidence Experimental
Experiments RT-PCR
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN30153378 1 COSMIC
COSN23015356 12 COSMIC
COSN30513185 19 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs111726405 1 dbSNP
rs765622881 2 dbSNP
rs1249744889 6 dbSNP
rs752995186 12 dbSNP
rs758746736 13 dbSNP
rs918887970 19 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MOB4   
Synonyms 2C4D, CGI-95, MOB1, MOB3, MOBKL3, PHOCN, PREI3
Description MOB family member 4, phocein
Transcript NM_001100819   
Other Transcripts NM_015387 , NM_199482   
Expression
Putative miRNA Targets on MOB4
3'UTR of MOB4
(miRNA target sites are highlighted)		 
>MOB4|NM_001100819|3'UTR
   1 AGGGAATCATAGGAAAAATGTACTGATCATATAATTAACATTATGTACTGTATATATCATTTTAGACACATCAATCATGT
  81 ATCCATATTATAGCTTCTTTGTTTAGTATAGGTTTTTGTATGCTGGGTTTGCCTTTTAAAATGGGAAATACTTTTTAAGT
 161 TATTCATAAGCTGTATATTCACCAGTGTGGCACTCATGGTTTTTAAATAAGATTAGTATTATCTGTTTATAATGCCTGTT
 241 AATAAAAGAATTTACAGTTTGGTAAAATTGCTGCTAAACAATCATTGGATCACAATCCTCATCAGACAAACCCATCTGTA
 321 AAAAAAATGAGGGAGAGCTTGAGGTTTCACACAAGCCATTTACTAAAGAGGTAGAAATGTTTTCTATTGGTTTTACCTTG
 401 AGTTTAGATATCCTAAAAAATTCTGTAGTACGTAGTTTTGTCTTACCTGTTAACTTTCCCCAATTGAGATAAAAGTGTTT
 481 TAAAATTCTGTTTATAGTTTTTGATATGCATATATAATTATGTGTATATCTAAATACAAATGCAAATGAAGCATTAGTAA
 561 TACTTAAATAATTTTACTGTGCTACATAAAGTATAACATACTTGGAAAGGATTTACCGTTCTGCAACAACGGACTGGTAC
 641 ATACAGGATGATCACAATGGTAAGGCACATAAATTATTTTCCCACTGGAAACCTGCCCTGTCCACCCCTTCTCATTTCCC
 721 TTAACCTTATCTTCAAACTACTTTAGCTGAGAAGCTTTTCACCAGACTGAGTTAGTGGTGGCTTATACCTATTTATATTT
 801 GTATTAATTGCTTACAGATTATACCTCATATTAGCAATTACATTACACTACAAGAAAATGTATTTGCATAGGCTCTTGCT
 881 TATCTTTGTTTTGCAAAATTGTTCTACTTAGAAAACAGTCCTTAAAATAGTTTGACTCTTCCTGTTAGTAATATATTAAT
 961 CTTTCATTTAACCAGCTAGGCAGCATTAAATAGAATTGAAGAAATACCATAGTATTTATTTTACACCCCCTCTCCCACGA
1041 AGTTTATGTTTGGATTACATGCACGTGTGAGATTATTTGCAATAATTCATAGGTTCCAAGGGTGTTGATGAATAGTCATA
1121 CATTTTTTTGGACTTTGTTATAATTCATTGTGGTAAGAATGATTGAAATGCAGATTTAACAATCTTATAATCTATTGAAT
1201 GCCATTTTTGATAAAGCACTGGAGGTCTTATTGCCAAACTGATTGTAATGAGGCAGTAAGGGTGAAAACATTGTACATGT
1281 TGTGAAGAAAGTATTTAAATCCAACTTTTGAACAGATTTAACAAACATGAGGAACTTTTTTATTTAGAAGGATAATTTTG
1361 AAGATGAAAATGTATTCATCTTAATTGTTTTTTCAAATTTAAGGGAATAATTTATACCATCTTTTCAGACAAGAATGTAC
1441 AGCAAAAATAAGGGGAACAGTAGTATACTGAGAGTGTGTGTATGTATAGTGTATGCCTTTCCAAGCTTGCCAGTCTTTTT
1521 GGCTTTGAACACTGCCCATCAGCTACAGTCATTACTGTTCCCCAACCCACAACTATCTTTTAAGAAGTCTTAGTTCACAG
1601 TGAAAGGAATGATGACTTTGAAATTATGGATTTATATTAATGGCACTATAAACCAATGGTAATGGTAATTTTTAAACTTG
1681 CTAAATATTGAGAAACTAAACTACTAAGTTAATAAATTATATATAGCAGTGTAGCTGTTCTCTCTAGATGGTGTCTCACA
1761 ATGGATTTCTGTTGCTTGACTATTTTCTTAGTGAATATTTATACTAAGGTAGTGACTGAGATTTGGTGATCTGGCTGAGT
1841 ATTTTGAAACACATTTTGAATAATATGGCTTAGTGTTAACGGGGACTTAAATATGATTTTTTTTTCTTACTCATTTCACC
1921 TTCCCTGTACTGTATGTTTGGAATTGATCATAAAACATCTCCAAAAGAAAATAATCAGTTTGTAGTCTTGCTTTTGTATT
2001 CATGTTGATAATCTTACTAATTGTGAAGTTGATTCACTACTATACTAGGTAAGACCTAAGTGAAACAGTTCCTGTTTTTC
2081 CTTAATACTGTTTTCAGAATTTTGAAAATGTACTTATATATACATAAATACTACTAAAAAATTAATGAGCCTGGCAAACC
2161 ATTGATTTATAAAAGTAAGTGTTCTAAGAGGGGAACAAGACAGTTCTGTGTGATAAGGAAGTTAGGCTCCACTTTTTGTT
2241 TGAATTACCCTATGTATATCCGAAGGTAAACTTAGGCTTTTCTTTCCAAAAGATCGTATAGTCAATTCATTCTTTTTCTC
2321 CTATCACATCTGGGAAAGTAGCTAACTTTTAACTATTTATGTTCCCATAAGTAACCCTTCTTTTGTGTGTATACATTTCC
2401 TTTTCTCTGACTTGAGATGTCAAATTTGGATTTCTAGAACAGTTTCTCAGTTAAATTCTTGATGACTTAACAACTTTTAC
2481 TATCAGAATACAATTAGAAATCCTTGGTCAGGCACAGGGGCTCACGCCTGTAATCCCAGCACTTTGGGAAGCCAAGGCAG
2561 ACAGATCACCTGAGGTCAGGAGTTCGAGACCAGCCTGACCAACATGGAGAAACCCTGTCTCTACTAAAAATACAAAAATT
2641 AGCCGGGCGTGGTGCTACTCGTGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGGAGGTGGAGGTTGCGGTGAGCTGAGA
2721 TCGTGCCATTGCACTCCAGCCTGGGTAACGAGCAAAACTCCGTCTCAAAAACTCCGTCTCAAAAAAAAAAAATCCTTGAT
2801 TACATTGTTAGTAAGGACTGTGTTACGATTATAAACACATTTATTGGTTGATGTCAAATTCACTGTAATAGTAGAACTAA
2881 GTTTTTTATGTGAGTACTTTGCCCTACTGTCTATATGATGACATCTTTTTTGAGCAGCTAAATTTTAAATTGTATATACT
2961 TTATTTTGTGAATCCTTGTTGAATGTGCTAAAGGTTTCTTTGTGTAGTTCTTCCATGCTATGCGAATATTTTAGTAAAAG
3041 TAGTTGATTTTTAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ucuccguccaAG-GACCUAGUa 5'
                    || :||||||| 
Target 5' tgctaaacaaTCATTGGATCAc 3'
 272 - 293 143.00 -9.40
2 
miRNA  3' ucUCCGUCCAA---GGACCUAGUa 5'
            | | || ||   ::|||||:| 
Target 5' ccACGAAGTTTATGTTTGGATTAc 3'
 1035 - 1058 135.00 -7.40
3 
miRNA  3' ucucCGUCCAAG---GACCUAGUa 5'
              |:| |||:    | ||||| 
Target 5' tactGTATGTTTGGAATTGATCAt 3'
 1928 - 1951 117.00 -6.50
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30117434 15 COSMIC
COSN31586555 22 COSMIC
COSN30534770 53 COSMIC
COSN31610592 57 COSMIC
COSN30181876 66 COSMIC
COSN30160254 77 COSMIC
COSN19382089 86 COSMIC
COSN31559109 207 COSMIC
COSN31530018 249 COSMIC
COSN31596851 328 COSMIC
COSN21526024 426 COSMIC
COSN7156323 576 COSMIC
COSN31553364 647 COSMIC
COSN31564350 674 COSMIC
COSN21734580 802 COSMIC
COSN6163017 936 COSMIC
COSN7156324 938 COSMIC
COSN16105221 967 COSMIC
COSN31585606 994 COSMIC
COSN6163018 1018 COSMIC
COSN31522230 1048 COSMIC
COSN9870996 1216 COSMIC
COSN20097614 1363 COSMIC
COSN17075887 1640 COSMIC
COSN5493921 2239 COSMIC
COSN1817325 2416 COSMIC
COSN29861648 2446 COSMIC
COSN27160196 2447 COSMIC
COSN15765848 3038 COSMIC
COSN26245259 3049 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1167382202 4 dbSNP
rs1445819151 5 dbSNP
rs1032020620 9 dbSNP
rs1167810031 11 dbSNP
rs1483089942 16 dbSNP
rs1233183064 18 dbSNP
rs1233678881 24 dbSNP
rs1206829650 27 dbSNP
rs761839479 28 dbSNP
rs1197139773 29 dbSNP
rs1406524855 30 dbSNP
rs767306009 31 dbSNP
rs773290934 32 dbSNP
rs1008188593 36 dbSNP
rs1360142745 40 dbSNP
rs145276780 42 dbSNP
rs766654247 43 dbSNP
rs777115834 45 dbSNP
rs1225964423 46 dbSNP
rs1274535654 48 dbSNP
rs375483019 50 dbSNP
rs1279807445 55 dbSNP
rs1443981399 56 dbSNP
rs1368294354 57 dbSNP
rs1179680315 58 dbSNP
rs1255081704 59 dbSNP
rs1368010280 70 dbSNP
rs975457026 71 dbSNP
rs1423617004 73 dbSNP
rs1172330457 75 dbSNP
rs1409123336 79 dbSNP
rs1179283206 88 dbSNP
rs544029948 89 dbSNP
rs1251339151 97 dbSNP
rs1223404545 102 dbSNP
rs1318148580 105 dbSNP
rs185836058 111 dbSNP
rs1219238630 113 dbSNP
rs1321020865 121 dbSNP
rs1284753530 123 dbSNP
rs1225246504 124 dbSNP
rs1348316201 128 dbSNP
rs532623912 133 dbSNP
rs908793023 134 dbSNP
rs1429094392 143 dbSNP
rs938876160 144 dbSNP
rs1292324100 146 dbSNP
rs1056857663 151 dbSNP
rs1174200512 151 dbSNP
rs14657 153 dbSNP
rs1377284992 155 dbSNP
rs1413049084 157 dbSNP
rs1455968646 158 dbSNP
rs915571769 169 dbSNP
rs879156594 176 dbSNP
rs1053337 182 dbSNP
rs1302435185 184 dbSNP
rs188364358 188 dbSNP
rs1362982890 190 dbSNP
rs1190666124 194 dbSNP
rs748476204 198 dbSNP
rs1261236989 205 dbSNP
rs1293958493 213 dbSNP
rs1365080948 215 dbSNP
rs1235579082 217 dbSNP
rs948476986 220 dbSNP
rs1349365117 225 dbSNP
rs1042847090 226 dbSNP
rs193156924 230 dbSNP
rs1325205047 234 dbSNP
rs999103140 239 dbSNP
rs1385716539 240 dbSNP
rs1052920889 249 dbSNP
rs1255029765 267 dbSNP
rs1433381691 280 dbSNP
rs184003852 282 dbSNP
rs1177566585 283 dbSNP
rs1471109297 286 dbSNP
rs890409847 289 dbSNP
rs188731602 296 dbSNP
rs1429130040 301 dbSNP
rs1019603570 305 dbSNP
rs899823949 308 dbSNP
rs1463401536 312 dbSNP
rs1247226636 318 dbSNP
rs1396839805 320 dbSNP
rs1027495453 329 dbSNP
rs568010982 329 dbSNP
rs1231891719 330 dbSNP
rs952790203 331 dbSNP
rs983357208 353 dbSNP
rs1226897541 356 dbSNP
rs1015760428 372 dbSNP
rs1455589084 373 dbSNP
rs1287352317 380 dbSNP
rs1400344921 387 dbSNP
rs960312227 390 dbSNP
rs1442142201 395 dbSNP
rs993066156 403 dbSNP
rs181371049 411 dbSNP
rs948382542 412 dbSNP
rs1389467985 432 dbSNP
rs1184044868 433 dbSNP
rs1443861310 439 dbSNP
rs1253656460 445 dbSNP
rs556583357 449 dbSNP
rs1480737765 458 dbSNP
rs1276218518 464 dbSNP
rs1316097082 465 dbSNP
rs1342162443 466 dbSNP
rs1316269582 471 dbSNP
rs1247465591 473 dbSNP
rs1339027543 475 dbSNP
rs978417404 476 dbSNP
rs1300063965 477 dbSNP
rs763110700 494 dbSNP
rs1317001067 497 dbSNP
rs1429182754 500 dbSNP
rs1369879774 505 dbSNP
rs925696378 511 dbSNP
rs536988559 513 dbSNP
rs1366543035 521 dbSNP
rs1186553769 526 dbSNP
rs550345812 544 dbSNP
rs1053398750 554 dbSNP
rs1179402774 558 dbSNP
rs1265886395 561 dbSNP
rs1482411229 571 dbSNP
rs1293172040 574 dbSNP
rs773078783 579 dbSNP
rs1464231625 588 dbSNP
rs1214147295 594 dbSNP
rs890276018 599 dbSNP
rs1477036418 601 dbSNP
rs116325631 611 dbSNP
rs539490073 612 dbSNP
rs766360053 618 dbSNP
rs900397221 619 dbSNP
rs1407062739 622 dbSNP
rs552806888 623 dbSNP
rs996809044 626 dbSNP
rs1388211145 631 dbSNP
rs375329015 632 dbSNP
rs1328394739 635 dbSNP
rs535448058 638 dbSNP
rs1179512460 639 dbSNP
rs866148498 642 dbSNP
rs183727771 652 dbSNP
rs1436315372 656 dbSNP
rs867905992 658 dbSNP
rs13727 661 dbSNP
rs1267264109 665 dbSNP
rs1206094260 685 dbSNP
rs544165738 687 dbSNP
rs1224988189 694 dbSNP
rs1016204809 696 dbSNP
rs1324513999 709 dbSNP
rs1276748960 714 dbSNP
rs563853597 726 dbSNP
rs1434396860 741 dbSNP
rs1329277990 745 dbSNP
rs960214619 749 dbSNP
rs1435576142 761 dbSNP
rs992968192 764 dbSNP
rs1023231650 772 dbSNP
rs1156650484 781 dbSNP
rs1456421786 783 dbSNP
rs970258531 787 dbSNP
rs577390320 796 dbSNP
rs1173884449 801 dbSNP
rs978876846 810 dbSNP
rs760580235 811 dbSNP
rs1194456475 818 dbSNP
rs763968842 824 dbSNP
rs1466552929 825 dbSNP
rs189620240 832 dbSNP
rs1461987272 838 dbSNP
rs1280920629 847 dbSNP
rs766571595 853 dbSNP
rs756931653 859 dbSNP
rs1274219272 861 dbSNP
rs1220658698 872 dbSNP
rs1233420226 874 dbSNP
rs1367238674 876 dbSNP
rs1318358493 882 dbSNP
rs1434079926 888 dbSNP
rs1281747783 895 dbSNP
rs1359381787 900 dbSNP
rs911616224 907 dbSNP
rs944554511 922 dbSNP
rs764956082 923 dbSNP
rs1038806205 925 dbSNP
rs1168634300 927 dbSNP
rs900428194 931 dbSNP
rs750030883 936 dbSNP
rs1388854200 942 dbSNP
rs930573725 943 dbSNP
rs1475696767 948 dbSNP
rs1167534164 949 dbSNP
rs1239458726 953 dbSNP
rs1048908667 971 dbSNP
rs888440417 972 dbSNP
rs1004727542 973 dbSNP
rs1344310600 973 dbSNP
rs1295221874 974 dbSNP
rs1405170237 986 dbSNP
rs1379562101 992 dbSNP
rs182095023 994 dbSNP
rs773096416 997 dbSNP
rs1037132306 1006 dbSNP
rs528631391 1011 dbSNP
rs1431033081 1012 dbSNP
rs1369260635 1019 dbSNP
rs895870929 1021 dbSNP
rs1406354467 1023 dbSNP
rs548165904 1025 dbSNP
rs187415700 1033 dbSNP
rs1351560628 1039 dbSNP
rs530693781 1040 dbSNP
rs1252803647 1047 dbSNP
rs1184439731 1055 dbSNP
rs757992168 1058 dbSNP
rs1272418198 1065 dbSNP
rs550483259 1066 dbSNP
rs149124891 1069 dbSNP
rs1291820649 1083 dbSNP
rs1226398164 1092 dbSNP
rs1288524683 1099 dbSNP
rs1411149447 1101 dbSNP
rs191430444 1112 dbSNP
rs1033117136 1122 dbSNP
rs955752862 1134 dbSNP
rs988852044 1137 dbSNP
rs546628962 1138 dbSNP
rs1405065520 1143 dbSNP
rs1273605846 1149 dbSNP
rs1412986595 1154 dbSNP
rs566442046 1157 dbSNP
rs1161577718 1172 dbSNP
rs1471669087 1177 dbSNP
rs1251225998 1182 dbSNP
rs1191820662 1183 dbSNP
rs535584825 1185 dbSNP
rs530024584 1187 dbSNP
rs765709814 1189 dbSNP
rs974584198 1189 dbSNP
rs921760383 1191 dbSNP
rs930584648 1195 dbSNP
rs1048952147 1205 dbSNP
rs1326618403 1213 dbSNP
rs907759928 1219 dbSNP
rs34094655 1221 dbSNP
rs747568736 1222 dbSNP
rs1370363575 1231 dbSNP
rs1486042292 1240 dbSNP
rs1292229174 1241 dbSNP
rs940045440 1245 dbSNP
rs1436230770 1270 dbSNP
rs1190278656 1271 dbSNP
rs1389789699 1285 dbSNP
rs1036995128 1291 dbSNP
rs895943916 1302 dbSNP
rs1235966769 1305 dbSNP
rs1472660860 1309 dbSNP
rs1176889610 1311 dbSNP
rs1014342544 1318 dbSNP
rs1422263499 1321 dbSNP
rs1434924042 1323 dbSNP
rs1428444022 1327 dbSNP
rs1189359327 1330 dbSNP
rs1044615244 1343 dbSNP
rs867390693 1350 dbSNP
rs3838584 1359 dbSNP
rs59524141 1359 dbSNP
rs143577743 1360 dbSNP
rs1259710331 1369 dbSNP
rs1434837088 1373 dbSNP
rs1335730572 1377 dbSNP
rs1299854271 1381 dbSNP
rs1313386013 1381 dbSNP
rs755566958 1385 dbSNP
rs1000749848 1388 dbSNP
rs1366530214 1390 dbSNP
rs181594861 1400 dbSNP
rs1388199404 1401 dbSNP
rs1009905609 1405 dbSNP
rs1303597224 1412 dbSNP
rs1270621101 1420 dbSNP
rs1367254150 1422 dbSNP
rs1175426674 1427 dbSNP
rs1018560615 1431 dbSNP
rs1390710529 1438 dbSNP
rs1190274964 1450 dbSNP
rs1447372788 1455 dbSNP
rs1273866516 1458 dbSNP
rs1260631572 1467 dbSNP
rs1200633763 1470 dbSNP
rs748529044 1471 dbSNP
rs769999697 1475 dbSNP
rs1253788901 1481 dbSNP
rs3792157 1490 dbSNP
rs1276726282 1492 dbSNP
rs974451752 1497 dbSNP
rs1442124746 1498 dbSNP
rs1226678953 1499 dbSNP
rs1326174490 1516 dbSNP
rs185364211 1523 dbSNP
rs537715361 1528 dbSNP
rs1398061811 1538 dbSNP
rs1377235975 1547 dbSNP
rs749469841 1574 dbSNP
rs532501436 1576 dbSNP
rs1188444748 1586 dbSNP
rs1170353668 1593 dbSNP
rs1396238066 1593 dbSNP
rs1434778877 1598 dbSNP
rs1173864053 1599 dbSNP
rs1399605599 1614 dbSNP
rs1187971219 1627 dbSNP
rs190013910 1629 dbSNP
rs1253636912 1645 dbSNP
rs1186609560 1646 dbSNP
rs1318582679 1648 dbSNP
rs56197471 1652 dbSNP
rs1277435127 1653 dbSNP
rs984997659 1662 dbSNP
rs774433498 1669 dbSNP
rs1339282941 1676 dbSNP
rs1266464932 1678 dbSNP
rs1247442712 1681 dbSNP
rs759570328 1683 dbSNP
rs1320150941 1691 dbSNP
rs1390515127 1693 dbSNP
rs1292837266 1697 dbSNP
rs1432660256 1704 dbSNP
rs1296751903 1709 dbSNP
rs1352369000 1711 dbSNP
rs1306225791 1713 dbSNP
rs747315527 1716 dbSNP
rs1371689379 1721 dbSNP
rs1389651094 1721 dbSNP
rs577329606 1726 dbSNP
rs1395665124 1738 dbSNP
rs768580974 1762 dbSNP
rs1163692480 1765 dbSNP
rs1459189725 1775 dbSNP
rs907789341 1783 dbSNP
rs562906218 1791 dbSNP
rs1273212218 1796 dbSNP
rs1253410926 1809 dbSNP
rs997487278 1812 dbSNP
rs1344412362 1813 dbSNP
rs546076810 1815 dbSNP
rs1037070094 1818 dbSNP
rs1046466 1822 dbSNP
rs1268591687 1838 dbSNP
rs891116579 1840 dbSNP
rs1008308222 1841 dbSNP
rs1463790168 1843 dbSNP
rs1015595009 1865 dbSNP
rs961862553 1866 dbSNP
rs2599 1867 dbSNP
rs1028003588 1873 dbSNP
rs1331451639 1874 dbSNP
rs1286593023 1880 dbSNP
rs1238413939 1881 dbSNP
rs1335101095 1882 dbSNP
rs1470048372 1883 dbSNP
rs1324061424 1895 dbSNP
rs1044519100 1897 dbSNP
rs905916217 1897 dbSNP
rs1456018689 1910 dbSNP
rs764937267 1914 dbSNP
rs572983280 1921 dbSNP
rs1200359478 1923 dbSNP
rs1469133968 1929 dbSNP
rs1201589088 1935 dbSNP
rs1378738628 1935 dbSNP
rs1054991293 1966 dbSNP
rs915618527 1977 dbSNP
rs541945132 1983 dbSNP
rs1158738209 1996 dbSNP
rs1466469966 1996 dbSNP
rs561718769 1997 dbSNP
rs1204643807 1998 dbSNP
rs750128318 2000 dbSNP
rs1276658627 2004 dbSNP
rs981195430 2009 dbSNP
rs924327101 2010 dbSNP
rs1368682693 2011 dbSNP
rs1455415554 2015 dbSNP
rs934832875 2020 dbSNP
rs1054652050 2023 dbSNP
rs1435463062 2028 dbSNP
rs1390407081 2029 dbSNP
rs762490148 2030 dbSNP
rs1315734556 2032 dbSNP
rs1018593397 2040 dbSNP
rs932950569 2041 dbSNP
rs1319717186 2045 dbSNP
rs1395106274 2052 dbSNP
rs901498358 2055 dbSNP
rs1388382877 2065 dbSNP
rs1321509032 2068 dbSNP
rs1395003244 2072 dbSNP
rs1050430895 2090 dbSNP
rs1330558377 2093 dbSNP
rs891131313 2098 dbSNP
rs1008150987 2105 dbSNP
rs142155261 2111 dbSNP
rs182646863 2118 dbSNP
rs1443193530 2121 dbSNP
rs984680591 2122 dbSNP
rs752615306 2126 dbSNP
rs1274263922 2141 dbSNP
rs564228550 2155 dbSNP
rs533306505 2156 dbSNP
rs1015163882 2158 dbSNP
rs1027518130 2161 dbSNP
rs755755601 2168 dbSNP
rs962018300 2171 dbSNP
rs1429648990 2176 dbSNP
rs1340683869 2182 dbSNP
rs1450514867 2205 dbSNP
rs1432249750 2216 dbSNP
rs1375387486 2218 dbSNP
rs1169729122 2232 dbSNP
rs1432136905 2235 dbSNP
rs1181952409 2242 dbSNP
rs992060258 2243 dbSNP
rs1186283351 2253 dbSNP
rs1253516843 2257 dbSNP
rs77185746 2258 dbSNP
rs9646751 2262 dbSNP
rs1012838939 2263 dbSNP
rs950046191 2269 dbSNP
rs1459274442 2271 dbSNP
rs748798577 2273 dbSNP
rs1023269864 2274 dbSNP
rs971064416 2277 dbSNP
rs1270689083 2286 dbSNP
rs981079497 2287 dbSNP
rs187558420 2292 dbSNP
rs151205062 2293 dbSNP
rs191202872 2296 dbSNP
rs1354223970 2297 dbSNP
rs914783993 2298 dbSNP
rs1412290634 2305 dbSNP
rs1310010186 2318 dbSNP
rs1353266119 2324 dbSNP
rs932775674 2326 dbSNP
rs183647045 2331 dbSNP
rs1409379785 2335 dbSNP
rs1406263991 2336 dbSNP
rs912787386 2338 dbSNP
rs1163010672 2343 dbSNP
rs944063049 2352 dbSNP
rs1323839402 2360 dbSNP
rs946324716 2368 dbSNP
rs1040621667 2372 dbSNP
rs1481613376 2388 dbSNP
rs1231035261 2390 dbSNP
rs902074098 2393 dbSNP
rs1451917521 2396 dbSNP
rs140159972 2399 dbSNP
rs897149898 2400 dbSNP
rs1340764741 2414 dbSNP
rs1231128331 2415 dbSNP
rs1205234065 2420 dbSNP
rs1029075049 2430 dbSNP
rs1288506950 2430 dbSNP
rs528349662 2441 dbSNP
rs1371832010 2444 dbSNP
rs1298060774 2461 dbSNP
rs1437673733 2463 dbSNP
rs1006370715 2464 dbSNP
rs1048955069 2465 dbSNP
rs1461172022 2469 dbSNP
rs72914979 2470 dbSNP
rs540158898 2472 dbSNP
rs866217569 2475 dbSNP
rs1256452901 2489 dbSNP
rs1425316235 2493 dbSNP
rs961892583 2503 dbSNP
rs1022906207 2508 dbSNP
rs991964978 2512 dbSNP
rs1478297186 2515 dbSNP
rs1024906952 2516 dbSNP
rs1211585714 2518 dbSNP
rs969252891 2521 dbSNP
rs553266741 2526 dbSNP
rs971325857 2527 dbSNP
rs1002775498 2531 dbSNP
rs927275591 2540 dbSNP
rs1314575785 2546 dbSNP
rs1220358886 2547 dbSNP
rs772080114 2554 dbSNP
rs1370339278 2562 dbSNP
rs571418992 2566 dbSNP
rs1440536668 2567 dbSNP
rs1170430639 2571 dbSNP
rs990621592 2576 dbSNP
rs1031374821 2586 dbSNP
rs1368711561 2587 dbSNP
rs955894359 2601 dbSNP
rs1429224296 2615 dbSNP
rs58837777 2618 dbSNP
rs1381669799 2621 dbSNP
rs1415038474 2625 dbSNP
rs1040484722 2626 dbSNP
rs1191531062 2632 dbSNP
rs1394647062 2632 dbSNP
rs200711891 2634 dbSNP
rs770009018 2634 dbSNP
rs923565033 2634 dbSNP
rs1021760952 2645 dbSNP
rs760476176 2646 dbSNP
rs1327400467 2649 dbSNP
rs1210198015 2650 dbSNP
rs1278738543 2653 dbSNP
rs756573652 2657 dbSNP
rs1366327473 2661 dbSNP
rs1273138548 2662 dbSNP
rs1286473896 2664 dbSNP
rs1361525109 2675 dbSNP
rs1339379153 2683 dbSNP
rs1203882008 2684 dbSNP
rs192832194 2693 dbSNP
rs1171640581 2694 dbSNP
rs1433995759 2695 dbSNP
rs912711960 2697 dbSNP
rs1172258965 2698 dbSNP
rs555450121 2699 dbSNP
rs972952907 2702 dbSNP
rs1486337831 2705 dbSNP
rs1024808845 2709 dbSNP
rs575193863 2710 dbSNP
rs931271749 2723 dbSNP
rs1253519940 2724 dbSNP
rs1048484787 2725 dbSNP
rs1225616112 2727 dbSNP
rs1002516575 2729 dbSNP
rs1313650010 2731 dbSNP
rs1416737482 2734 dbSNP
rs1034377085 2735 dbSNP
rs1353688863 2736 dbSNP
rs1312324397 2748 dbSNP
rs137857626 2750 dbSNP
rs990138317 2751 dbSNP
rs777797059 2754 dbSNP
rs564546238 2761 dbSNP
rs533062391 2762 dbSNP
rs556620980 2763 dbSNP
rs932260386 2772 dbSNP
rs540549132 2776 dbSNP
rs1186591725 2777 dbSNP
rs909439592 2779 dbSNP
rs1464680287 2780 dbSNP
rs201764936 2781 dbSNP
rs749575966 2781 dbSNP
rs879782593 2781 dbSNP
rs1035991770 2782 dbSNP
rs560364094 2787 dbSNP
rs1013331786 2791 dbSNP
rs1046290088 2792 dbSNP
rs1386075927 2799 dbSNP
rs891470310 2802 dbSNP
rs1330756326 2806 dbSNP
rs1389494364 2810 dbSNP
rs866361467 2812 dbSNP
rs1011631625 2813 dbSNP
rs1365160097 2819 dbSNP
rs1002018715 2820 dbSNP
rs1227025551 2825 dbSNP
rs529119525 2827 dbSNP
rs549060496 2828 dbSNP
rs957946477 2833 dbSNP
rs1180334269 2835 dbSNP
rs1418980231 2838 dbSNP
rs568979332 2840 dbSNP
rs985163945 2861 dbSNP
rs1215932419 2864 dbSNP
rs1268562710 2864 dbSNP
rs531472397 2866 dbSNP
rs1019774934 2867 dbSNP
rs1011993385 2874 dbSNP
rs1272722677 2882 dbSNP
rs568537223 2889 dbSNP
rs1277821967 2890 dbSNP
rs1352882374 2890 dbSNP
rs1236854973 2895 dbSNP
rs972962749 2902 dbSNP
rs1303966841 2904 dbSNP
rs976120727 2906 dbSNP
rs1368360620 2909 dbSNP
rs1324755797 2910 dbSNP
rs1255083588 2912 dbSNP
rs1386559253 2915 dbSNP
rs1156288101 2924 dbSNP
rs775213762 2926 dbSNP
rs140810714 2927 dbSNP
rs953688063 2954 dbSNP
rs931348382 2955 dbSNP
rs779036753 2957 dbSNP
rs766546723 2960 dbSNP
rs1252646628 2968 dbSNP
rs909460135 2972 dbSNP
rs1448936172 2975 dbSNP
rs571246500 2978 dbSNP
rs971754799 2982 dbSNP
rs1204627961 2989 dbSNP
rs1349887227 2990 dbSNP
rs1280896063 3002 dbSNP
rs13012711 3004 dbSNP
rs1236259069 3006 dbSNP
rs1191714896 3021 dbSNP
rs539713230 3024 dbSNP
rs918911157 3041 dbSNP
rs984552057 3054 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 25843.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 25843.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000233892.4 | 3UTR | UAAAAUUGCUGCUAAACAAUCAUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000233892.4 | 3UTR | UAAAAUUGCUGCUAAACAAUCAUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000233892.4 | 3UTR | UAAAAUUGCUGCUAAACAAUCAUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000233892.4 | 3UTR | UAAAAUUGCUGCUAAACAAUCAUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000233892.4 | 3UTR | UAAAAUUGCUGCUAAACAAUCAUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000233892.4 | 3UTR | UAAAAUUGCUGCUAAACAAUCAUUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
GSE21849 B cell lymphoma -0.44 8.5e-3 -0.279 7.1e-2 29 Click to see details
GSE19783 ER+ ER+ breast cancer -0.465 1.9e-2 -0.468 1.9e-2 20 Click to see details
GSE32688 Pancreatic cancer -0.363 2.1e-2 -0.437 6.2e-3 32 Click to see details
GSE42095 Differentiated embryonic stem cells 0.309 7.6e-2 0.000 5.0e-1 23 Click to see details
GSE19350 CNS germ cell tumors -0.43 8.1e-2 0.028 4.7e-1 12 Click to see details
GSE28260 Renal cortex and medulla 0.385 9.7e-2 0.405 8.5e-2 13 Click to see details
GSE28544 Breast cancer -0.268 1.0e-1 -0.162 2.2e-1 24 Click to see details
GSE26953 Aortic valvular endothelial cells -0.26 1.1e-1 -0.298 7.9e-2 24 Click to see details
GSE27834 Pluripotent stem cells 0.319 1.1e-1 0.315 1.2e-1 16 Click to see details
GSE19536 Breast cancer -0.112 1.3e-1 -0.146 7.4e-2 100 Click to see details
GSE35602 Colorectal cancer stromal tissue 0.192 1.8e-1 0.212 1.5e-1 25 Click to see details
GSE38226 Liver fibrosis -0.184 2.1e-1 0.002 5.0e-1 21 Click to see details
GSE38974 Chronic obstructive pulmonary disease -0.142 2.5e-1 0.022 4.6e-1 25 Click to see details
GSE17306 Multiple myeloma 0.08 2.9e-1 0.046 3.8e-1 49 Click to see details
GSE34608 Pulmonary tuberculosis and sarcoidosis 0.118 3.1e-1 -0.098 3.4e-1 20 Click to see details
GSE19783 ER- ER- breast cancer -0.043 3.5e-1 -0.092 2.1e-1 79 Click to see details
GSE14794 Lymphoblastoid cells -0.021 4.2e-1 -0.007 4.7e-1 90 Click to see details
GSE21687 Ependynoma primary tumors 0.003 4.9e-1 -0.002 4.9e-1 64 Click to see details
GSE17498 Multiple myeloma 0.002 5.0e-1 0.031 4.2e-1 40 Click to see details
GSE17498 Multiple myeloma 0.002 5.0e-1 0.031 4.2e-1 40 Click to see details
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
194 hsa-miR-640 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT097121 TNPO1 transportin 1 2 2
MIRT115090 ARIH1 ariadne RBR E3 ubiquitin protein ligase 1 2 4
MIRT204603 HSPE1-MOB4 HSPE1-MOB4 readthrough 2 8
MIRT204634 MOB4 MOB family member 4, phocein 2 8
MIRT344451 MTRNR2L1 MT-RNR2-like 1 2 2
MIRT405772 EIF5 eukaryotic translation initiation factor 5 2 2
MIRT445876 SENP6 SUMO1/sentrin specific peptidase 6 2 2
MIRT497418 FAM46A family with sequence similarity 46 member A 2 2
MIRT504394 HMX2 H6 family homeobox 2 2 4
MIRT504691 SLCO2B1 solute carrier organic anion transporter family member 2B1 2 8
MIRT512386 MTRNR2L3 MT-RNR2-like 3 2 6
MIRT513003 MAN1A2 mannosidase alpha class 1A member 2 2 2
MIRT513084 USP9X ubiquitin specific peptidase 9, X-linked 2 2
MIRT519122 ALDH2 aldehyde dehydrogenase 2 family (mitochondrial) 2 2
MIRT523836 F2RL1 F2R like trypsin receptor 1 2 2
MIRT565356 TMCC1 transmembrane and coiled-coil domain family 1 2 2
MIRT575895 Dis3 DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease 2 3
MIRT576894 Poteg POTE ankyrin domain family, member G 2 2
MIRT613780 RPS6 ribosomal protein S6 2 2
MIRT613934 POLR3A RNA polymerase III subunit A 2 2
MIRT614348 LOH12CR1 BLOC-1 related complex subunit 5 2 2
MIRT614534 NOA1 nitric oxide associated 1 2 2
MIRT617019 ZBTB8B zinc finger and BTB domain containing 8B 2 2
MIRT618247 MANEAL mannosidase endo-alpha like 2 2
MIRT619051 TTC4 tetratricopeptide repeat domain 4 2 2
MIRT619442 ZNF517 zinc finger protein 517 2 2
MIRT619723 FPR2 formyl peptide receptor 2 2 2
MIRT620179 TRIM72 tripartite motif containing 72 2 2
MIRT620370 ANKRD62 ankyrin repeat domain 62 2 2
MIRT621263 RTN2 reticulon 2 2 2
MIRT621463 APOH apolipoprotein H 2 2
MIRT621571 ZBTB43 zinc finger and BTB domain containing 43 2 2
MIRT621683 TSPYL1 TSPY like 1 2 2
MIRT622866 PDE7A phosphodiesterase 7A 2 2
MIRT624669 ARHGEF39 Rho guanine nucleotide exchange factor 39 2 2
MIRT625607 ZNF84 zinc finger protein 84 2 2
MIRT626111 IL23R interleukin 23 receptor 2 2
MIRT628380 CACNB2 calcium voltage-gated channel auxiliary subunit beta 2 2 2
MIRT628553 MELK maternal embryonic leucine zipper kinase 2 2
MIRT628671 C2orf72 chromosome 2 open reading frame 72 2 2
MIRT628747 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT628776 TMEM154 transmembrane protein 154 2 2
MIRT628918 ZNF430 zinc finger protein 430 2 2
MIRT629174 ALDOA aldolase, fructose-bisphosphate A 2 2
MIRT629209 C12orf66 chromosome 12 open reading frame 66 2 2
MIRT629267 SLC5A8 solute carrier family 5 member 8 2 2
MIRT629498 AS3MT arsenite methyltransferase 2 2
MIRT629665 USP1 ubiquitin specific peptidase 1 2 2
MIRT629760 STK25 serine/threonine kinase 25 2 2
MIRT630899 GATAD1 GATA zinc finger domain containing 1 2 2
MIRT631105 SLC15A2 solute carrier family 15 member 2 2 2
MIRT631112 ATCAY ATCAY, caytaxin 2 2
MIRT631450 DLEU1 deleted in lymphocytic leukemia 1 (non-protein coding) 2 2
MIRT631505 FFAR4 free fatty acid receptor 4 2 2
MIRT631580 ITGAL integrin subunit alpha L 2 2
MIRT631836 CMBL carboxymethylenebutenolidase homolog 2 2
MIRT632342 SWSAP1 SWIM-type zinc finger 7 associated protein 1 2 2
MIRT633214 ZNF584 zinc finger protein 584 2 2
MIRT633223 ZNF43 zinc finger protein 43 2 2
MIRT633480 ARIH2OS ariadne RBR E3 ubiquitin protein ligase 2 opposite strand 2 2
MIRT633511 LRRC27 leucine rich repeat containing 27 2 2
MIRT633615 CWF19L1 CWF19 like 1, cell cycle control (S. pombe) 2 2
MIRT633652 SLC28A1 solute carrier family 28 member 1 2 2
MIRT633677 ZNF576 zinc finger protein 576 2 2
MIRT634196 TMOD2 tropomodulin 2 2 4
MIRT634388 PLSCR1 phospholipid scramblase 1 2 2
MIRT635817 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT635962 TTC31 tetratricopeptide repeat domain 31 2 2
MIRT636114 YPEL1 yippee like 1 2 2
MIRT636164 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT636768 CLUAP1 clusterin associated protein 1 2 2
MIRT637092 CXorf23 BCLAF1 and THRAP3 family member 3 2 2
MIRT637316 FAM9B family with sequence similarity 9 member B 2 2
MIRT637540 CHST6 carbohydrate sulfotransferase 6 2 2
MIRT637628 ZNF431 zinc finger protein 431 2 2
MIRT637826 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT637945 IVD isovaleryl-CoA dehydrogenase 2 2
MIRT637968 IRF1 interferon regulatory factor 1 2 2
MIRT638321 RNF11 ring finger protein 11 2 2
MIRT638386 RAB11FIP1 RAB11 family interacting protein 1 2 2
MIRT639244 CRK CRK proto-oncogene, adaptor protein 2 2
MIRT642608 APOPT1 apoptogenic 1, mitochondrial 2 2
MIRT642793 SLC1A5 solute carrier family 1 member 5 2 2
MIRT643847 LACTB lactamase beta 2 4
MIRT644705 ZNF321P zinc finger protein 321, pseudogene 2 2
MIRT645148 DIS3 DIS3 homolog, exosome endoribonuclease and 3'-5' exoribonuclease 2 3
MIRT646671 CCDC69 coiled-coil domain containing 69 2 2
MIRT647780 ASB8 ankyrin repeat and SOCS box containing 8 2 2
MIRT648554 WDR92 WD repeat domain 92 2 2
MIRT648990 MRPL49 mitochondrial ribosomal protein L49 2 2
MIRT649099 KCNMB1 potassium calcium-activated channel subfamily M regulatory beta subunit 1 2 2
MIRT650141 ZNF426 zinc finger protein 426 2 2
MIRT650791 GSR glutathione-disulfide reductase 2 2
MIRT654967 PLEKHA2 pleckstrin homology domain containing A2 2 2
MIRT655099 PHLDA3 pleckstrin homology like domain family A member 3 2 2
MIRT655516 PAG1 phosphoprotein membrane anchor with glycosphingolipid microdomains 1 2 2
MIRT656289 METTL14 methyltransferase like 14 2 2
MIRT656497 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 2
MIRT657074 JPH2 junctophilin 2 2 2
MIRT657314 HOOK3 hook microtubule tethering protein 3 2 2
MIRT657419 HIF1AN hypoxia inducible factor 1 alpha subunit inhibitor 2 4
MIRT659032 DHTKD1 dehydrogenase E1 and transketolase domain containing 1 2 2
MIRT659535 CHCHD5 coiled-coil-helix-coiled-coil-helix domain containing 5 2 2
MIRT661532 NWD1 NACHT and WD repeat domain containing 1 2 2
MIRT662029 FUT2 fucosyltransferase 2 2 2
MIRT663206 DARS2 aspartyl-tRNA synthetase 2, mitochondrial 2 2
MIRT663357 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT663557 CCR6 C-C motif chemokine receptor 6 2 2
MIRT663650 POLM DNA polymerase mu 2 2
MIRT663694 ABHD17B abhydrolase domain containing 17B 2 2
MIRT664370 CYB5A cytochrome b5 type A 2 2
MIRT664783 LIAS lipoic acid synthetase 2 4
MIRT665561 TXNL1 thioredoxin like 1 2 2
MIRT665950 TAOK1 TAO kinase 1 2 2
MIRT667338 MSANTD3 Myb/SANT DNA binding domain containing 3 2 2
MIRT667804 ITIH5 inter-alpha-trypsin inhibitor heavy chain family member 5 2 2
MIRT668804 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT669470 ARPC2 actin related protein 2/3 complex subunit 2 2 2
MIRT669599 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT669806 STOML1 stomatin like 1 2 2
MIRT669944 FBXL2 F-box and leucine rich repeat protein 2 2 2
MIRT670292 RBBP4 RB binding protein 4, chromatin remodeling factor 2 2
MIRT670381 EMP2 epithelial membrane protein 2 2 2
MIRT670481 DCUN1D2 defective in cullin neddylation 1 domain containing 2 2 2
MIRT670531 KIF1C kinesin family member 1C 2 4
MIRT670565 GLTP glycolipid transfer protein 2 2
MIRT670603 NPHP1 nephrocystin 1 2 2
MIRT670880 CYTIP cytohesin 1 interacting protein 2 2
MIRT670931 LIPG lipase G, endothelial type 2 2
MIRT671261 MTRNR2L5 MT-RNR2-like 5 2 2
MIRT671794 FLVCR1 feline leukemia virus subgroup C cellular receptor 1 2 2
MIRT671897 GBP4 guanylate binding protein 4 2 2
MIRT672000 SLC35F6 solute carrier family 35 member F6 2 4
MIRT672074 KIR3DX1 killer cell immunoglobulin like receptor, three Ig domains X1 2 2
MIRT672319 C9orf3 chromosome 9 open reading frame 3 2 2
MIRT672853 C22orf29 retrotransposon Gag like 10 2 2
MIRT673395 WNT7B Wnt family member 7B 2 2
MIRT673537 DEGS1 delta 4-desaturase, sphingolipid 1 2 2
MIRT674285 ZNF724P zinc finger protein 724 2 2
MIRT674494 TIRAP TIR domain containing adaptor protein 2 2
MIRT675460 NUBPL nucleotide binding protein like 2 2
MIRT675569 TRIP11 thyroid hormone receptor interactor 11 2 2
MIRT676068 TIMM50 translocase of inner mitochondrial membrane 50 2 2
MIRT676254 PBOV1 prostate and breast cancer overexpressed 1 2 2
MIRT676377 SEC24D SEC24 homolog D, COPII coat complex component 2 2
MIRT676758 SNX2 sorting nexin 2 2 2
MIRT676773 NPHS1 NPHS1, nephrin 2 2
MIRT676874 ENSA endosulfine alpha 2 2
MIRT676918 KLHDC8A kelch domain containing 8A 2 2
MIRT676944 S1PR3 sphingosine-1-phosphate receptor 3 2 2
MIRT676957 HFE hemochromatosis 2 2
MIRT676967 RNF19B ring finger protein 19B 2 2
MIRT676972 ZNF708 zinc finger protein 708 2 2
MIRT677042 ZNF34 zinc finger protein 34 2 2
MIRT677070 VMAC vimentin type intermediate filament associated coiled-coil protein 2 2
MIRT677093 MFSD11 major facilitator superfamily domain containing 11 2 4
MIRT677134 P2RX7 purinergic receptor P2X 7 2 2
MIRT677179 ZNF786 zinc finger protein 786 2 2
MIRT677228 C15orf40 chromosome 15 open reading frame 40 2 2
MIRT677320 PIGO phosphatidylinositol glycan anchor biosynthesis class O 2 2
MIRT677455 PDLIM3 PDZ and LIM domain 3 2 2
MIRT677809 MRPS10 mitochondrial ribosomal protein S10 2 2
MIRT677937 ZNF519 zinc finger protein 519 2 2
MIRT678063 UBN2 ubinuclein 2 2 4
MIRT678072 EIF2A eukaryotic translation initiation factor 2A 2 2
MIRT678252 FXN frataxin 2 2
MIRT678315 FBLIM1 filamin binding LIM protein 1 2 2
MIRT678367 XIAP X-linked inhibitor of apoptosis 2 4
MIRT678372 RNF115 ring finger protein 115 2 2
MIRT678410 ANKRD36 ankyrin repeat domain 36 2 2
MIRT678518 ZNF347 zinc finger protein 347 2 2
MIRT678566 CDK4 cyclin dependent kinase 4 2 2
MIRT678580 PPP1R3B protein phosphatase 1 regulatory subunit 3B 2 2
MIRT678820 PDE6A phosphodiesterase 6A 2 2
MIRT678917 XPOT exportin for tRNA 2 2
MIRT679217 MAN2A2 mannosidase alpha class 2A member 2 2 2
MIRT679437 C19orf52 translocase of inner mitochondrial membrane 29 2 2
MIRT679595 HILPDA hypoxia inducible lipid droplet associated 2 2
MIRT679755 TLR6 toll like receptor 6 2 2
MIRT679800 APOBEC3A apolipoprotein B mRNA editing enzyme catalytic subunit 3A 2 2
MIRT680057 CD96 CD96 molecule 2 2
MIRT680116 CCDC30 coiled-coil domain containing 30 2 4
MIRT680181 ZNF554 zinc finger protein 554 2 2
MIRT680439 WDR12 WD repeat domain 12 2 2
MIRT680789 ZNF578 zinc finger protein 578 2 2
MIRT692464 APEX2 apurinic/apyrimidinic endodeoxyribonuclease 2 2 2
MIRT702952 HIP1 huntingtin interacting protein 1 2 2
MIRT706016 ZSCAN2 zinc finger and SCAN domain containing 2 2 2
MIRT706032 F2R coagulation factor II thrombin receptor 2 2
MIRT706135 MTRNR2L10 MT-RNR2-like 10 2 2
MIRT706394 HAS2 hyaluronan synthase 2 2 2
MIRT713293 DCP2 decapping mRNA 2 2 2
MIRT716583 BRAP BRCA1 associated protein 2 2
MIRT720433 C19orf47 chromosome 19 open reading frame 47 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-640 Paclitaxel 36314 NSC125973 approved resistant High Ovarian Cancer tissue and cell line (SKOV3)
hsa-miR-640 Cetuximab resistant High Colon Cancer cell line
hsa-miR-640 Trametinib 11707110 NSC758246 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-640 Vemurafenib 42611257 NSC761431 approved resistant High Melanoma cell line (WM266) (1uM)
hsa-miR-640 Mitoxantrone 4212 NSC279836 approved resistant High Breast Cancer cell line (BT-20, BT-474, BT-549, CAMA-1, HCC1143, HCC1395, HCC1569, HCC1806, HCC-1937, HCC1954, HCC202, HCC38, HCC70, Hs578T, MCF-7, MDA-MB-175VII, MDA-MB-231, MDA-MB-361, MDA-MB-415, MDA-MB-436, MDA-MB-468, SKBR3, T47D, UACC812, EVSA-T, MPE-600 , SK-BR-
hsa-miR-640 Sorafenib 216239 NSC747971 approved sensitive Low Clear Cell Renal Cell Carcinoma cell line (786-O)
hsa-mir-640 Paclitaxel 36314 NSC125973 approved sensitive cell line (A2780)
hsa-mir-640 Cisplatin 5460033 NSC119875 approved sensitive cell line (A2780)
hsa-mir-640 Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-640 Sunitinib 5329102 NSC750690 approved resistant tissue (CardB)
hsa-miR-640 Paclitaxel 36314 NSC125973 approved sensitive cell line (SKOV3)
hsa-miR-640 Tamoxifen 2733525 NSC180973 approved sensitive cell line (TamR8)
hsa-miR-640 Oxaliplatin 6857599 NSC266046 approved sensitive cell line (IGROV-1)
hsa-miR-640 Cisplatin 5460033 NSC119875 approved sensitive cell line (IGROV-1)
hsa-miR-640 Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)

Error report submission