| pre-miRNA Information | |
|---|---|
| pre-miRNA | hsa-mir-451b |
| Genomic Coordinates | chr17: 28861371 - 28861438 |
| Description | Homo sapiens miR-451b stem-loop |
| Comment | None |
| RNA Secondary Structure |  |
| Associated Diseases |  |
| Mature miRNA Information | |||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Mature miRNA | hsa-miR-451b | ||||||||||||||
| Sequence | 7| UAGCAAGAGAACCAUUACCAUU |28 | ||||||||||||||
| Evidence | Experimental | ||||||||||||||
| Experiments | Illumina | ||||||||||||||
| Editing Events in miRNAs |
|
||||||||||||||
| SNPs in miRNA |
|
||||||||||||||
| Putative Targets | |||||||||||||||
| miRNA Expression profile | |
|---|---|
| Human miRNA Tissue Atlas | |
| Circulating MicroRNA Expression Profiling | |
| Gene Information | |||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Gene Symbol | BZW1 | ||||||||||||||||||||
| Synonyms | BZAP45, Nbla10236 | ||||||||||||||||||||
| Description | basic leucine zipper and W2 domains 1 | ||||||||||||||||||||
| Transcript | NM_014670 | ||||||||||||||||||||
| Expression | |||||||||||||||||||||
| Putative miRNA Targets on BZW1 | |||||||||||||||||||||
| 3'UTR of BZW1 (miRNA target sites are highlighted) |
>BZW1|NM_014670|3'UTR 1 ATTTTGAAACTACACCCTCAGTAAAGCAAACAGGAGTTGTAGATAAAATGTCATGTCTCATGTGTCCTGGTTCTTACATC 81 TTCCTACCTCCCTGTATCAAGCATGATATAAGGGCTTTCATGGCAAATTTTATTTTAACTGTTTCTATGGTTGCTGGAAA 161 TGTTGGGTTTAGTTTCTAAAACCATGTTTTAAGTAGCTACAGGAGCTATAGATTTGAATCTAATGTTGCATTAGTCTTTT 241 CAGTTATCTTCTACCTCCTGTATTTTCTACTGTAATAATGTAATTTAAGGCCTTCCACAATGAACAGTTCACTTTATTCC 321 CTGGGTTTTCTATAAACAGTTTTAAGGATATGATTTGGTTAAAAAATAATTTGTTATAAAAATTCTGTTTGCAAATTAAA 401 CTGGAAAAGTATCCAGAGTCTCAAAAGGCAATGATTTGTGAGATAATATGGCATGCCCGGAGCCCTGCTCATCAATGAAA 481 AACCCATATGTAATAATCGAATTCATTTAACATGAATCTTGAGTACGTGGACCATTGCTTGCATGTTAACTTTTTGTTTT 561 GTTTTGTTTTGTTTTGTTTTGCATTTTTAACTCCAGATATCCTAAAGCTCAATTGTTTGGTCTCTGGTTTTCATCCTTAG 641 AGAAGCCATGGAGAACAGACTTGAAAAGTTTAGGAAATCATAATGTGGCAGAGGTGGTGGGAAGAAGAAAGTTGAGCTTT 721 TTCCCCTTGAGAAACTTCTGCATTTAGTTTCTATCTTTCCAGGCAAAACAAATGGGTATTCTTTTCATACAACCATTTTC 801 AAATGAACCTTAGAAAAGTCTTAACATTTAAGGTATTTTATGCACAGAATACACTTAGATTGATAGGAAAGAACTCGTAA 881 TGGAGTTTGAGTAAAGAAAATGACTGATGTACTAAACCCAGTAAAAATTGTTGAAAATGTTAAAGGTCAGCATGTTCTAA 961 TTGGGAATCTAGATATAGCTTAGATTTCCTATTGGCTTAGAGTATTTGCTATAACAAATGAAGTGCAATGACAATTATAT 1041 ATTCCTACTCGGTCATACTGGACTGGCTTCGTTCTCTTAATATACTCAGTAATGACTCAAGCCTCTGGCTATTAACATAC 1121 CCTAGTTGCCGTTTTTTAATTGCCATGAGCCAAATACTTCTTGGTATACAATTGATCCATTTATTTTAATGGCTGCCTTT 1201 TCATTTTCATCTTTTCTTGCTGCTACCCATCTATGTATGTAGTCATTGGGGGGAAAATGTAGCCACATTTTTTATGGGAA 1281 GACTTTGTGTTAAAAGTGAACATTTTGAAGGTTTTTAACTGGTGAAACTAGCCTGGAATAATGCCACCAGAGACTGAGTG 1361 GAAATCGCCCCTTTTGAAGGTGCCATTCTTATGAGCCAAAAGTTTGTCATTTAAAAGTTCATTTTGAGGGAATAACATGT 1441 AATATAATTTGAAATAAAGGTATAGTAACCTTAAAAAGAACATTATAACTGATTGTTGTGAATGGGGTGAATTTGTTAAA 1521 ATGAGTAACTTTGATAAAGTTTTTCATGCACAGGCAAAATGTATTCACTAGATTTCTACGTAGTGATCTGCTTTTACTTT 1601 GTAATTTGTAGTTCTCAAAAGACTTTTTTTTAAAAAAATAAAGTCCATACTTACACTTAGGCTTTATAAAAAAAAAAA Target sites
Provided by authors
Predicted by miRanda
DRVs
SNPs
DRVs & SNPs
|
||||||||||||||||||||
| miRNA-target interactions (Predicted by miRanda) |
|
||||||||||||||||||||
| DRVs in gene 3'UTRs | |||||||||||||||||||||
| SNPs in gene 3'UTRs | |||||||||||||||||||||
| Experimental Support 1 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control
PAR-CLIP data was present in GSM545213. RNA binding protein: AGO2. Condition:Control
PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control
PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection
PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection
... - Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell. |
| Article |
- Hafner M; Landthaler M; Burger L; Khorshid et al. - Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
|
| Experimental Support 2 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 9689.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1
"PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1
... - Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods. |
| Article |
- Kishore S; Jaskiewicz L; Burger L; Hausser et al. - Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
|
| Experimental Support 3 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | hESCs (WA-09) |
| Disease | 9689.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine
... - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development. |
| Article |
- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al. - Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
|
| Experimental Support 4 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | HEK293 |
| Disease | 9689.0 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
"PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine
"PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine
... - Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature. |
| Article |
- Memczak S; Jens M; Elefsinioti A; Torti F; et al. - Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
|
| Experimental Support 5 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | C8166 , TZM-bl |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in GSM1462572. RNA binding protein: AGO2. Condition:C8166 NL4-3
PAR-CLIP data was present in GSM1462573. RNA binding protein: AGO2. Condition:TZM-bl BaL
PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL
... - Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio. |
| Article |
- Whisnant AW; Bogerd HP; Flores O; Ho P; et al. - mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
|
| Experimental Support 6 for Functional miRNA-Target Interaction | |
|---|---|
| miRNA:Target | ---- |
| Validation Method |
|
| Conditions | MCF7 |
| Location of target site | 3'UTR |
| Tools used in this research | TargetScan , miRTarCLIP , Piranha |
| Original Description (Extracted from the article) |
...
PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated
... - Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology. |
| Article |
- Farazi TA; Ten Hoeve JJ; Brown M; et al. - Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
|
| CLIP-seq Support 1 for dataset GSM4903833 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | Dermal fibroblasts / CTL_TD_21_a |
| Location of target site | NM_014670 | 3UTR | UCUUGGUAUACAAUUGAUCCAUUUAUUUUAAUGGCUGCCUUUUCAUUUUCAUCUUUUCUUGCUGCUACCCAUCUAUGUAUGUAGUCAUUGGGGGGAAAAUGUAGCCACAUUUUUUAUGGGAAGACUUUGUGUUAAAAGUGAACAUUUUGAAGGUUUUUAACUGGUGAAACUAGCCUGGAAUAAUGCCACCAGAGACUGAGUGGAAAUCGCCCCUUUUGAAG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Accession Series | GSE161239 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 2 for dataset GSM4903834 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | Dermal fibroblasts / CTL_TD_21_b |
| Location of target site | NM_014670 | 3UTR | UGAUCCAUUUAUUUUAAUGGCUGCCUUUUCAUUUUCAUCUUUUCUUGCUGCUACCCAUCUAUGU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Accession Series | GSE161239 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 3 for dataset GSM4903835 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | Dermal fibroblasts / CTL_TD_21_c |
| Location of target site | NM_014670 | 3UTR | AUUUAUUUUAAUGGCUGCCUUUUCAUUUUCAUCUUUUCUUGCUGCUACCCAUCUAUGUAUGUAGUCAUUGGGGGGAAAAUGUAGCCACAUUUUUUAUGGGAAGACUUUGUGUUAAAAGUGAACAUUUUGAAGGUUUUUAACUGGUGAAACUAGCCUGGAAUAAUGCCACCAGAGACUGAGUGGAAAUCGCCCCUUUUGAAG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Accession Series | GSE161239 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 4 for dataset GSM4903836 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | Dermal fibroblasts / 124_TD_21_a |
| Location of target site | NM_014670 | 3UTR | UCAUCUUUUCUUGCUGCUACCCAUCUAUGUAUGUAGUCAUUGGGGGGAAAAUGUAGCCACAUUUUUUAUGGGAAGACUUUGUGUUAAAAGUGAACAUUUUGAAGGUUUUUAACUGGUGAAACUAGCCUGGAAUAAUGCCACCAGAGACUGAGUGGAAAUCGCCCCUUUUGAAG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Accession Series | GSE161239 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 5 for dataset GSM4903837 | |
|---|---|
| Method / RBP | HITS-CLIP / AGO |
| Cell line / Condition | Dermal fibroblasts / 124_TD_21_b |
| Location of target site | NM_014670 | 3UTR | UUUAAUGGCUGCCUUUUCAUUUUCAUCUUUUCUUGCUGCUACCCAUCUAUGUAUGUAGUCAUUGGGGGGAAAAUGUAGCCACAUUUUUUAUGGGAAGACUUUGUGUUAAAAGUGAACAUUUUGAAGGUUUUUAACUGGUGAAACUAGCCUGGAAUAAUGCCACCAGAGACUGAGUGGAAAUCGCCCCUUUUGAAG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Accession Series | GSE161239 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 6 for dataset GSM545212 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000409600.1 | 3UTR | CCUUUUCAUUUUCAUCUUUUCUUGCUGCUACCCAUCUAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 7 for dataset GSM545213 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000409600.1 | 3UTR | CCUUUUCAUUUUCAUCUUUUCUUGCUGCUACCCAUC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 8 for dataset GSM545214 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO3 |
| Cell line / Condition | HEK293 / Control |
| Location of target site | ENST00000409600.1 | 3UTR | CCUUUUCAUUUUCAUCUUUUCUUGCUGCUACCCAUCUA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 9 for dataset GSM545216 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / miR-124 transfection |
| Location of target site | ENST00000409600.1 | 3UTR | CCUUUUCAUUUUCAUCUUUUCUUGCUGCUACCCAUCUAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 10 for dataset GSM545217 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / miR-7 transfection |
| Location of target site | ENST00000409600.1 | 3UTR | CCUUUUCAUUUUCAUCUUUUCUUGCUGCUACCCA |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 20371350 / GSE21578 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 11 for dataset GSM714644 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repA |
| Location of target site | ENST00000409600.1 | 3UTR | AUCCAUUUAUUUUAAUGGCUGCCUUUUCAUUUUCAUCUUUUCUUGCUGCUACCCAUCUAUGUAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 12 for dataset GSM714645 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / completeT1, repB |
| Location of target site | ENST00000409600.1 | 3UTR | CCUUUUCAUUUUCAUCUUUUCUUGCUGCUACCCAUCUAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 21572407 / GSE28865 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 13 for dataset SRR359787 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | hESCs (WA-09) / 4-thiouridine, RNase T1 |
| Location of target site | ENST00000409600.1 | 3UTR | CCUUUUCAUUUUCAUCUUUUCUUGCUGCUACCCAUCUAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 22012620 / SRX103431 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 14 for dataset GSM1065668 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO1 |
| Cell line / Condition | HEK293 / 4-thiouridine, ML_MM_7 |
| Location of target site | ENST00000409600.1 | 3UTR | CCUUUUCAUUUUCAUCUUUUCUUGCUGCUACCC |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 15 for dataset GSM1065670 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | HEK293 / 4-thiouridine, 3_ML_LG |
| Location of target site | ENST00000409600.1 | 3UTR | CCUUUUCAUUUUCAUCUUUUCUUGCUGCUACCCAUCUAU |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23446348 / GSE43573 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 16 for dataset SRR1045082 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | MCF7 / Untreated |
| Location of target site | ENST00000409600.1 | 3UTR | CCUUUUCAUUUUCAUCUUUUCUUGCUGCUACCCAUCUAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 24398324 / SRX388831 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 17 for dataset GSM1462572 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | C8166 / C8166 NL4-3 |
| Location of target site | ENST00000409600.1 | 3UTR | CCUUUUCAUUUUCAUCUUUUCUUGCUGCUACCCAUCUAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 18 for dataset GSM1462573 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | TZM-bl / TZM-bl BaL |
| Location of target site | ENST00000409600.1 | 3UTR | CUGCCUUUUCAUUUUCAUCUUUUCUUGCUGCUACCCAUCUAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| CLIP-seq Support 19 for dataset GSM1462574 | |
|---|---|
| Method / RBP | PAR-CLIP / AGO2 |
| Cell line / Condition | TZM-bl / TZM-bl ami BaL |
| Location of target site | ENST00000409600.1 | 3UTR | CCUUUUCAUUUUCAUCUUUUCUUGCUGCUACCCAUCUAUG |
| Tools used in this analysis | TargetScan, miRTarCLIP, and Piranha |
| Article / Accession Series | PMID: 23592263 / GSE59944 |
| CLIP-seq Viewer | Link |
| MiRNA-Target Expression Profile | |||||||
|---|---|---|---|---|---|---|---|
|
| MiRNA-Target Expression Profile (TCGA) | |||||||
|---|---|---|---|---|---|---|---|
|
124 hsa-miR-451b Target Genes:
Functional analysis:
ID |
Target | Description | Validation methods |
 |
 |
|||||||
| Strong evidence | Less strong evidence | |||||||||||
 |
 |
 |
 |
 |
 |
 |
 |
|||||
| MIRT060018 | VANGL2 | VANGL planar cell polarity protein 2 |  |
|
2 | 4 | ||||||
| MIRT069874 | SRP54 | signal recognition particle 54 | |
|
2 | 2 | ||||||
| MIRT088316 | RAB10 | RAB10, member RAS oncogene family | |
|
2 | 4 | ||||||
| MIRT100747 | VEGFA | vascular endothelial growth factor A | |
|
|
|
|
5 | 12 | |||
| MIRT152236 | ZNF460 | zinc finger protein 460 | |
|
2 | 2 | ||||||
| MIRT198492 | USP14 | ubiquitin specific peptidase 14 | |
|
2 | 6 | ||||||
| MIRT204750 | BZW1 | basic leucine zipper and W2 domains 1 | |
|
2 | 12 | ||||||
| MIRT211209 | FGF2 | fibroblast growth factor 2 | |
|
2 | 2 | ||||||
| MIRT234352 | MSL1 | male specific lethal 1 homolog | |
|
2 | 8 | ||||||
| MIRT281810 | MAP2K1 | mitogen-activated protein kinase kinase 1 | |
|
2 | 2 | ||||||
| MIRT369113 | CKMT1A | creatine kinase, mitochondrial 1A | |
|
2 | 2 | ||||||
| MIRT401349 | C5ORF51 | chromosome 5 open reading frame 51 | |
|
2 | 4 | ||||||
| MIRT441509 | ERN1 | endoplasmic reticulum to nucleus signaling 1 | |
|
2 | 2 | ||||||
| MIRT441888 | RD3 | retinal degeneration 3 | |
|
2 | 4 | ||||||
| MIRT443549 | GPR35 | G protein-coupled receptor 35 | |
|
2 | 2 | ||||||
| MIRT444959 | ADAM22 | ADAM metallopeptidase domain 22 | |
|
2 | 2 | ||||||
| MIRT445808 | NFATC2 | nuclear factor of activated T-cells 2 | |
|
2 | 2 | ||||||
| MIRT446509 | ASCC1 | activating signal cointegrator 1 complex subunit 1 | |
|
2 | 2 | ||||||
| MIRT447457 | ST18 | ST18, C2H2C-type zinc finger | |
|
2 | 2 | ||||||
| MIRT448296 | ZDHHC3 | zinc finger DHHC-type containing 3 | |
|
2 | 2 | ||||||
| MIRT463178 | ZNF281 | zinc finger protein 281 | |
|
2 | 2 | ||||||
| MIRT466606 | TBC1D13 | TBC1 domain family member 13 | |
|
2 | 2 | ||||||
| MIRT467235 | SPRED1 | sprouty related EVH1 domain containing 1 | |
|
2 | 2 | ||||||
| MIRT471039 | PISD | phosphatidylserine decarboxylase | |
|
2 | 10 | ||||||
| MIRT471892 | NUAK2 | NUAK family kinase 2 | |
|
2 | 2 | ||||||
| MIRT474151 | LIMA1 | LIM domain and actin binding 1 | |
|
2 | 6 | ||||||
| MIRT474155 | LIFR | LIF receptor alpha | |
|
2 | 2 | ||||||
| MIRT481037 | BAZ2A | bromodomain adjacent to zinc finger domain 2A | |
|
2 | 2 | ||||||
| MIRT483083 | GPR75 | G protein-coupled receptor 75 | |
|
2 | 4 | ||||||
| MIRT485208 | PRKAR2A | protein kinase cAMP-dependent type II regulatory subunit alpha | |
|
2 | 8 | ||||||
| MIRT495187 | ST3GAL1 | ST3 beta-galactoside alpha-2,3-sialyltransferase 1 | |
|
2 | 2 | ||||||
| MIRT495431 | ATG7 | autophagy related 7 | |
|
2 | 2 | ||||||
| MIRT499160 | FAM83C | family with sequence similarity 83 member C | |
|
2 | 6 | ||||||
| MIRT499505 | GGA3 | golgi associated, gamma adaptin ear containing, ARF binding protein 3 | |
|
2 | 2 | ||||||
| MIRT500400 | ZMAT3 | zinc finger matrin-type 3 | |
|
2 | 10 | ||||||
| MIRT500684 | TRIM37 | tripartite motif containing 37 | |
|
2 | 2 | ||||||
| MIRT501301 | RPS6KB1 | ribosomal protein S6 kinase B1 | |
|
2 | 2 | ||||||
| MIRT504339 | ASGR2 | asialoglycoprotein receptor 2 | |
|
2 | 6 | ||||||
| MIRT505931 | RCAN3 | RCAN family member 3 | |
|
2 | 4 | ||||||
| MIRT513196 | SLU7 | SLU7 homolog, splicing factor | |
|
2 | 2 | ||||||
| MIRT521807 | POM121C | POM121 transmembrane nucleoporin C | |
|
2 | 2 | ||||||
| MIRT522779 | LAMP2 | lysosomal associated membrane protein 2 | |
|
2 | 6 | ||||||
| MIRT530179 | ZBED2 | zinc finger BED-type containing 2 | |
|
2 | 2 | ||||||
| MIRT532397 | SNX3 | sorting nexin 3 | |
|
2 | 2 | ||||||
| MIRT532482 | HOXA13 | homeobox A13 | |
|
2 | 2 | ||||||
| MIRT532538 | WDR13 | WD repeat domain 13 | |
|
2 | 2 | ||||||
| MIRT534779 | RAN | RAN, member RAS oncogene family | |
|
2 | 2 | ||||||
| MIRT535719 | N4BP1 | NEDD4 binding protein 1 | |
|
2 | 2 | ||||||
| MIRT539310 | AKAP12 | A-kinase anchoring protein 12 | |
|
2 | 4 | ||||||
| MIRT539877 | RPL32 | ribosomal protein L32 | |
|
2 | 2 | ||||||
| MIRT539891 | IRGQ | immunity related GTPase Q | |
|
2 | 2 | ||||||
| MIRT540063 | CEP104 | centrosomal protein 104 | |
|
2 | 2 | ||||||
| MIRT540154 | GTF2B | general transcription factor IIB | |
|
2 | 4 | ||||||
| MIRT540206 | ARHGAP18 | Rho GTPase activating protein 18 | |
|
2 | 2 | ||||||
| MIRT540391 | CRTC1 | CREB regulated transcription coactivator 1 | |
|
2 | 2 | ||||||
| MIRT540595 | ERCC1 | ERCC excision repair 1, endonuclease non-catalytic subunit | |
|
2 | 4 | ||||||
| MIRT540733 | FABP2 | fatty acid binding protein 2 | |
|
2 | 2 | ||||||
| MIRT540949 | SLC25A43 | solute carrier family 25 member 43 | |
|
2 | 2 | ||||||
| MIRT541444 | C18orf32 | chromosome 18 open reading frame 32 | |
|
2 | 4 | ||||||
| MIRT541571 | ZNF43 | zinc finger protein 43 | |
|
2 | 4 | ||||||
| MIRT541601 | ALOX15 | arachidonate 15-lipoxygenase | |
|
2 | 2 | ||||||
| MIRT541933 | ORC1 | origin recognition complex subunit 1 | |
|
2 | 4 | ||||||
| MIRT542394 | WDR12 | WD repeat domain 12 | |
|
2 | 2 | ||||||
| MIRT542414 | SYNJ2BP | synaptojanin 2 binding protein | |
|
2 | 2 | ||||||
| MIRT542481 | APOC3 | apolipoprotein C3 | |
|
2 | 2 | ||||||
| MIRT542621 | XIAP | X-linked inhibitor of apoptosis | |
|
2 | 2 | ||||||
| MIRT542976 | FAM83F | family with sequence similarity 83 member F | |
|
2 | 2 | ||||||
| MIRT543741 | DHCR7 | 7-dehydrocholesterol reductase | |
|
2 | 2 | ||||||
| MIRT544594 | AP5Z1 | adaptor related protein complex 5 zeta 1 subunit | |
|
2 | 4 | ||||||
| MIRT546441 | SNX5 | sorting nexin 5 | |
|
2 | 2 | ||||||
| MIRT548213 | FKBP1A | FK506 binding protein 1A | |
|
2 | 2 | ||||||
| MIRT550471 | OSCAR | osteoclast associated, immunoglobulin-like receptor | |
|
2 | 4 | ||||||
| MIRT555230 | PRKAA1 | protein kinase AMP-activated catalytic subunit alpha 1 | |
|
2 | 4 | ||||||
| MIRT555428 | PPAP2B | phospholipid phosphatase 3 | |
|
2 | 2 | ||||||
| MIRT556368 | MAF | MAF bZIP transcription factor | |
|
2 | 2 | ||||||
| MIRT558149 | ELK4 | ELK4, ETS transcription factor | |
|
2 | 2 | ||||||
| MIRT566181 | PTPN14 | protein tyrosine phosphatase, non-receptor type 14 | |
|
2 | 2 | ||||||
| MIRT568468 | ARMC12 | armadillo repeat containing 12 | |
|
2 | 2 | ||||||
| MIRT607594 | TANGO2 | transport and golgi organization 2 homolog | |
|
2 | 2 | ||||||
| MIRT617588 | NDUFB5 | NADH:ubiquinone oxidoreductase subunit B5 | |
|
2 | 2 | ||||||
| MIRT621244 | SIGLEC9 | sialic acid binding Ig like lectin 9 | |
|
2 | 4 | ||||||
| MIRT623679 | HOXD4 | homeobox D4 | |
|
2 | 2 | ||||||
| MIRT625989 | FGFR1OP | FGFR1 oncogene partner | |
|
2 | 4 | ||||||
| MIRT627244 | ZBTB3 | zinc finger and BTB domain containing 3 | |
|
2 | 2 | ||||||
| MIRT632946 | ELOVL6 | ELOVL fatty acid elongase 6 | |
|
2 | 4 | ||||||
| MIRT635872 | SLC11A2 | solute carrier family 11 member 2 | |
|
2 | 2 | ||||||
| MIRT636638 | CHAF1B | chromatin assembly factor 1 subunit B | |
|
2 | 2 | ||||||
| MIRT643563 | WDR73 | WD repeat domain 73 | |
|
2 | 2 | ||||||
| MIRT647907 | CIRH1A | UTP4, small subunit processome component | |
|
2 | 2 | ||||||
| MIRT652503 | TMEM170A | transmembrane protein 170A | |
|
2 | 2 | ||||||
| MIRT652843 | TACO1 | translational activator of cytochrome c oxidase I | |
|
2 | 2 | ||||||
| MIRT653299 | SMUG1 | single-strand-selective monofunctional uracil-DNA glycosylase 1 | |
|
2 | 2 | ||||||
| MIRT659383 | CREG2 | cellular repressor of E1A stimulated genes 2 | |
|
2 | 2 | ||||||
| MIRT661339 | TBC1D15 | TBC1 domain family member 15 | |
|
2 | 2 | ||||||
| MIRT662372 | ANKRD42 | ankyrin repeat domain 42 | |
|
2 | 2 | ||||||
| MIRT664322 | CD209 | CD209 molecule | |
|
2 | 2 | ||||||
| MIRT671759 | F11R | F11 receptor | |
|
2 | 2 | ||||||
| MIRT673240 | KLHDC8A | kelch domain containing 8A | |
|
2 | 2 | ||||||
| MIRT682871 | C9orf156 | tRNA methyltransferase O | |
|
2 | 2 | ||||||
| MIRT683171 | SF3A1 | splicing factor 3a subunit 1 | |
|
2 | 2 | ||||||
| MIRT684262 | TBXA2R | thromboxane A2 receptor | |
|
2 | 2 | ||||||
| MIRT684395 | MCTS1 | MCTS1, re-initiation and release factor | |
|
2 | 2 | ||||||
| MIRT684883 | P4HB | prolyl 4-hydroxylase subunit beta | |
|
2 | 2 | ||||||
| MIRT686650 | TMEM184C | transmembrane protein 184C | |
|
2 | 2 | ||||||
| MIRT687771 | KIAA0355 | KIAA0355 | |
|
2 | 2 | ||||||
| MIRT694352 | CHST6 | carbohydrate sulfotransferase 6 | |
|
2 | 2 | ||||||
| MIRT696347 | SLC35D2 | solute carrier family 35 member D2 | |
|
2 | 2 | ||||||
| MIRT700480 | PUM1 | pumilio RNA binding family member 1 | |
|
2 | 2 | ||||||
| MIRT705909 | ADAM9 | ADAM metallopeptidase domain 9 | |
|
2 | 2 | ||||||
| MIRT714076 | FNDC3B | fibronectin type III domain containing 3B | |
|
2 | 2 | ||||||
| MIRT714401 | FBXO31 | F-box protein 31 | |
|
2 | 2 | ||||||
| MIRT716442 | RPS24 | ribosomal protein S24 | |
|
2 | 2 | ||||||
| MIRT718204 | PSMF1 | proteasome inhibitor subunit 1 | |
|
2 | 2 | ||||||
| MIRT721238 | CRCP | CGRP receptor component | |
|
2 | 2 | ||||||
| MIRT721271 | SH3D19 | SH3 domain containing 19 | |
|
2 | 2 | ||||||
| MIRT721603 | ZNF484 | zinc finger protein 484 | |
|
2 | 2 | ||||||
| MIRT722916 | COA4 | cytochrome c oxidase assembly factor 4 homolog | |
|
2 | 2 | ||||||
| MIRT723457 | CUL4A | cullin 4A | |
|
2 | 2 | ||||||
| MIRT733813 | KREMEN1 | kringle containing transmembrane protein 1 | |
|
2 | 0 | ||||||
| MIRT733814 | CASK | calcium/calmodulin dependent serine protein kinase | |
|
2 | 0 | ||||||
| MIRT733815 | KLF4 | Kruppel like factor 4 | |
|
2 | 0 | ||||||
| MIRT733816 | BCL2 | BCL2, apoptosis regulator | |
|
2 | 0 | ||||||
| MIRT733817 | PCNA | proliferating cell nuclear antigen | |
|
2 | 0 | ||||||
| MIRT733818 | BAX | BCL2 associated X, apoptosis regulator | |
|
2 | 0 | ||||||
| miRNA-Drug Associations | ||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
| miRNA-Drug Resistance Associations | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|