miRTarBase - #MIRT206559


—
pre-miRNA Information
pre-miRNA hsa-mir-4793   
Genomic Coordinates chr3: 48644194 - 48644280
Description Homo sapiens miR-4793 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4793-3p
Sequence 58| UCUGCACUGUGAGUUGGCUGGCU |80
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSM5899925 14 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs779602935 6 dbSNP
rs757908486 7 dbSNP
rs1422853760 15 dbSNP
rs377721296 23 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol SOCS5   
Synonyms CIS6, CISH6, Cish5, SOCS-5
Description suppressor of cytokine signaling 5
Transcript NM_014011   
Other Transcripts NM_144949   
Expression
Putative miRNA Targets on SOCS5
3'UTR of SOCS5
(miRNA target sites are highlighted)		 
>SOCS5|NM_014011|3'UTR
   1 ACTCTCCGGTCCCCAAAGGTTGTTAACTAGGTCCGCTTTCATGTGCATCAGACAGTACACCTATAGCAAGCACACGTAGC
  81 AGTGTTAGGCTTTTTCATACAGTATGTAAGCTTAGTGTTAGTATCTGTCAGATGCTACCTGCTGTTACTTATTCAGATAA
 161 ACATGGTGCCTATTGGAACAATAGCGGATAGAGCTACAGGTGTTCAGTAAGACTACAAAAACATTTTGCCTATTTCGCTA
 241 ACAGTTTGGTTTTTAATGGCTGTGGTATTTGAGTGAGGCAACTCTGGGGCATTTGTTATGAAGAATTCTATTTCTTACTG
 321 AAGAACAAATTATTAATATTGGATGAGTATTTCAACAGTGTGACTAATGTTTGAAATTATTTTTTCTAAGAGTTTTTCTA
 401 TAACCTTCCAAAAGTCGTGATGTTTGTAGTTACTATAAATCAAGCTTTGGAAGTCCAAAAAGAATAAAAGACTGCCTTCC
 481 TTTTAGAAAAAAATGCAATTTTCTGGCCACAAGGGCATAGTGCAGTTCACTTACGTGTTGATGTAGTTTATAATCAGACG
 561 CCTTTTCTCTTCTGCAAAAGGTACTGTTAAGTAAACCAGATTTTCTAAATAGGCATTCTTAAAATTTCAGACTTACAAAG
 641 CTAGTAGTAGAATTTTATTGAAAGGCCTAGGTATTAATTTTTTAAATGAGTGCTTTAACTTAAAACAGGCGTTTGGAATA
 721 GCTGCTGCAATGTAGTCTTGTGTGTGATTTTTTTTTAAGTTGATGTGCAGTCTAATTGTTGTTTCATAAAAGTTGGATCT
 801 GTTCCTATGCCCAGGATGATTTTGTGAACCGTGAAGTACGTGAGACTAGAAGACGCCCAAACAAGTCAGATAATAGTAAC
 881 TACAATGGTTGCTGATGTTGAGATTATTGTTGAACTATAATTAATAATTTGGATGGCAGAATTTATCTCTTTTTTGTAAA
 961 CTCTCATAACTGAATTGCTTAAGTATAATTTATAGAATTTCAGTGCAGTTCATTCTTAATGGAAAATCTGAAACCTAAAT
1041 TGCAGATTTAAAAGGTACTGTACAACCATTATATCTGTAAATAACTTAGCACCTTTTTGTCACTTAGAATAATATGTACT
1121 ACTACTTGAGTGAGCGCTTTTGGAAGTTATATCAAGTTCTAGTGTTTGCTTCTTAGTAACTGAACTGAATTTACAGTTCT
1201 GTCCTAGACATTTTGCACTAAAGTAGCCGAATCCACTCTCATGTCTTTTCGTTAATGTGCTCTGTACCACTGGTGAGTGC
1281 TCCATAGTTTCCTTACCTGCTGCTACAGAATGTTATTTTACATCCCTATGGCTATTGCCAAGGCTACAAAAAAGGAAAGC
1361 TATATTTGTATGCAACACTAACCTTTTGACTGCTAATGTATGTTTCTGCTTGCTGTGCCTTGTTATGGCTGCTTTTTTTG
1441 TGCTAATAAAGTATGTTTGGTGTTCTCCTTGTATATCTGCTGTTTTATACATTTGCAACAATTTCTCTTGTAAATGGAAT
1521 GGTTTGGGGTTTTTAAATAAGCATTAACTAACAACCTTTCTATAGTTAATGCAGAGTTAATGAACAGTCTAATATTGACT
1601 TATCAGAATAAGCTAACTCTAAATTTAATGCTCTACATCTTATCAGTCATAATTATATATACTGTGGAACAGTATCTGTA
1681 GTTACTGCAAATTACTGTACAGTTTAGGTTATAACAGAAAACTGACAGAGAAGTAATAAACCTATTGATTTCTCTGCTTA
1761 TAAATGAAAGATTGAAACTATCCAATGACATATTATAGTAAATGAGTATCTGTAACCTCCCACTGCATCAGAAGCAGGTT
1841 AAATGAAGTCTTGTGAATTTGTAATAGATCAGTACCATTTATTGGTTTGGGGACCATCTTAATTAAAAATAAATGCCCAA
1921 AATGTAGAACTTTAACCAAAGACTTGTCCCTTTTAAAGCAAAATGGGGATTGAAGGGACTTATAATTTCTGTTGTTTCTA
2001 ATTAAAGTCCCTGAAGATCATATACCAAAGTGTTTGAGAACTTCATCCAAACCTACTTTAAAGCATTATGTGCAATTAAG
2081 TTGTTATGACATAATTATATTGCCTAATTGTTGGGTCTTTTTTCTTGAGCTTATAATGTACCTGGAAAATAAACCTCTTG
2161 AGAAAAAGAAAAGTTCATACTGATTATTGGAAAAGGACTATATATGTGAGCAAGATTGTGTTTTAGAGAGGAAACTTGAA
2241 ACTCCAAGAAAGCACTTGATGTTTTTATATGCTTGTAGCAAATTGATGTTCTAACTGTAGTTTTATAGAAAGTATTAATG
2321 CTTTTATGTATTTCAAAACTTTCATATGTTAAATGGAAATTGTTTTAAATGTGTTTGAGTTTATGTAAGCATGTATACAC
2401 TGTGCTAAAAGTCACATGTTTCAGTTTGTGTATAATATTAATATGCAATTTTTGGTTTAAATTTTTGTCTTAAAATATTA
2481 GTGGCTTACATTTTAAAAAAGAAAAATCACCAGCATGAACTTGCACCTAAGTCTATATTCACTGTGTCCTTTTCTGAATC
2561 CCATTGTAGCCTGTCAACTAAATTTGAGTGTTAACGGTCTTTTTAAAGTGCATTTAAATACAAACCAGGAATTTCTTTAG
2641 AAGTTGA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ucGGUCGG---UUGAGUGUCACGUCu 5'
            |::|||   |:  ||:||||||| 
Target 5' ttCTGGCCACAAGGGCATAGTGCAGt 3'
 501 - 526 161.00 -23.90
2 
miRNA  3' ucgGUCGGUUGAGUGUCACGUCu 5'
             :||  ||:|: |||||||| 
Target 5' ttaTAG--AATTT-CAGTGCAGt 3'
 990 - 1009 155.00 -14.80
3 
miRNA  3' ucgGUCGGUUGAGUGUCACGUcu 5'
             |:|:|  :|:| ||||||  
Target 5' taaCGGTCTTTTTAAAGTGCAtt 3'
 2592 - 2614 140.00 -15.20
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN26996322 8 COSMIC
COSN6183377 9 COSMIC
COSN30479615 12 COSMIC
COSN30457817 13 COSMIC
COSN30486216 14 COSMIC
COSN28654562 21 COSMIC
COSN24387604 35 COSMIC
COSN31524305 72 COSMIC
COSN26559401 121 COSMIC
COSN31492256 233 COSMIC
COSN31533021 237 COSMIC
COSN26585171 238 COSMIC
COSN30121162 309 COSMIC
COSN30158461 334 COSMIC
COSN30174773 471 COSMIC
COSN26582036 535 COSMIC
COSN15626342 568 COSMIC
COSN31588521 606 COSMIC
COSN30142662 692 COSMIC
COSN30531143 741 COSMIC
COSN31536632 757 COSMIC
COSN31491793 799 COSMIC
COSN22093002 854 COSMIC
COSN31553254 856 COSMIC
COSN15626343 950 COSMIC
COSN30113228 950 COSMIC
COSN28719130 996 COSMIC
COSN15626344 1102 COSMIC
COSN26578312 1137 COSMIC
COSN30131321 1137 COSMIC
COSN30530289 1157 COSMIC
COSN31529719 1166 COSMIC
COSN15626345 1251 COSMIC
COSN18887772 1292 COSMIC
COSN6183378 1316 COSMIC
COSN26560234 1385 COSMIC
COSN30529845 1402 COSMIC
COSN31513537 1419 COSMIC
COSN23012744 1440 COSMIC
COSN30510644 1487 COSMIC
COSN26958215 1573 COSMIC
COSN20844822 1605 COSMIC
COSN15626346 1627 COSMIC
COSN28201281 1698 COSMIC
COSN31519251 1753 COSMIC
COSN31568948 1753 COSMIC
COSN21365348 1951 COSMIC
COSN26678267 1995 COSMIC
COSN5504771 2046 COSMIC
COSN31567829 2118 COSMIC
COSN20878689 2141 COSMIC
COSN31572199 2161 COSMIC
COSN30113912 2173 COSMIC
COSN31607953 2177 COSMIC
COSN30141858 2323 COSMIC
COSN31516696 2325 COSMIC
COSN10001300 2368 COSMIC
COSN6183379 2371 COSMIC
COSN8609264 2419 COSMIC
COSN9375672 2549 COSMIC
COSN28801318 2590 COSMIC
COSN30159308 2597 COSMIC
COSN24848931 2748 COSMIC
COSN10001301 2824 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1312694016 2 dbSNP
rs1169397191 4 dbSNP
rs1353985826 5 dbSNP
rs371033916 6 dbSNP
rs1421610780 7 dbSNP
rs182123759 8 dbSNP
rs1307356159 9 dbSNP
rs754504759 10 dbSNP
rs1253132173 12 dbSNP
rs778354010 13 dbSNP
rs921459989 14 dbSNP
rs1255612685 18 dbSNP
rs752263009 19 dbSNP
rs368018361 20 dbSNP
rs3768720 21 dbSNP
rs891365866 27 dbSNP
rs1309726841 28 dbSNP
rs777279172 29 dbSNP
rs1228040362 30 dbSNP
rs746892330 31 dbSNP
rs1354677732 32 dbSNP
rs770568483 34 dbSNP
rs745756282 35 dbSNP
rs1465072057 40 dbSNP
rs1171385560 42 dbSNP
rs1376831548 46 dbSNP
rs769820415 48 dbSNP
rs1422706074 51 dbSNP
rs775757336 52 dbSNP
rs1393522614 54 dbSNP
rs1008572343 56 dbSNP
rs41379147 59 dbSNP
rs549776925 60 dbSNP
rs41432848 62 dbSNP
rs1295263556 64 dbSNP
rs1320121637 65 dbSNP
rs568613450 70 dbSNP
rs1027349100 72 dbSNP
rs1445420751 75 dbSNP
rs1379938417 76 dbSNP
rs1176791631 82 dbSNP
rs1481661452 102 dbSNP
rs969218587 105 dbSNP
rs1058153 112 dbSNP
rs1221452027 113 dbSNP
rs547759277 116 dbSNP
rs1207037052 127 dbSNP
rs565987127 133 dbSNP
rs530170062 136 dbSNP
rs1359650453 138 dbSNP
rs1482719305 149 dbSNP
rs1374872363 152 dbSNP
rs185674192 153 dbSNP
rs1348095816 171 dbSNP
rs960866262 171 dbSNP
rs570229445 173 dbSNP
rs547615073 174 dbSNP
rs190148407 176 dbSNP
rs1304676005 182 dbSNP
rs1425079757 189 dbSNP
rs1379845971 200 dbSNP
rs988175512 207 dbSNP
rs558915482 214 dbSNP
rs1163571526 219 dbSNP
rs1421163854 224 dbSNP
rs913873214 226 dbSNP
rs1373304322 230 dbSNP
rs1477302206 231 dbSNP
rs1271713079 232 dbSNP
rs1223615052 233 dbSNP
rs571111726 235 dbSNP
rs1284409460 238 dbSNP
rs1213195607 246 dbSNP
rs1318406543 252 dbSNP
rs1306640264 257 dbSNP
rs565737841 260 dbSNP
rs1343499952 263 dbSNP
rs150799974 264 dbSNP
rs41320947 265 dbSNP
rs1405552651 266 dbSNP
rs1314799724 272 dbSNP
rs1359644173 274 dbSNP
rs867611628 282 dbSNP
rs1051666444 285 dbSNP
rs1455511017 285 dbSNP
rs1346042542 288 dbSNP
rs1175391193 289 dbSNP
rs181482748 290 dbSNP
rs940242924 292 dbSNP
rs1200781919 299 dbSNP
rs1477813819 300 dbSNP
rs1395552018 304 dbSNP
rs1036002367 309 dbSNP
rs897526410 315 dbSNP
rs569527942 318 dbSNP
rs1320790754 327 dbSNP
rs1264521290 328 dbSNP
rs1224017539 334 dbSNP
rs1296475580 335 dbSNP
rs1293125210 343 dbSNP
rs1383726051 351 dbSNP
rs1362855207 365 dbSNP
rs41318648 367 dbSNP
rs1230318062 368 dbSNP
rs1048838306 373 dbSNP
rs904905944 380 dbSNP
rs368723751 391 dbSNP
rs1465538123 396 dbSNP
rs1422150451 399 dbSNP
rs1172913134 403 dbSNP
rs1429483252 412 dbSNP
rs764772689 418 dbSNP
rs1180906274 419 dbSNP
rs1035239729 436 dbSNP
rs1244411174 437 dbSNP
rs896413955 449 dbSNP
rs1317171042 463 dbSNP
rs185579264 468 dbSNP
rs1307856469 475 dbSNP
rs1239157396 479 dbSNP
rs1244685961 484 dbSNP
rs1009515890 487 dbSNP
rs1337429008 487 dbSNP
rs1481955835 487 dbSNP
rs10221923 488 dbSNP
rs1300408923 497 dbSNP
rs968078957 508 dbSNP
rs979418178 514 dbSNP
rs1429995192 517 dbSNP
rs1028420943 522 dbSNP
rs954232483 523 dbSNP
rs756760243 525 dbSNP
rs1442350984 530 dbSNP
rs1386729770 536 dbSNP
rs571025820 544 dbSNP
rs879363838 545 dbSNP
rs1389994106 546 dbSNP
rs200279817 551 dbSNP
rs1176028211 555 dbSNP
rs777631599 560 dbSNP
rs972985557 563 dbSNP
rs1361799496 572 dbSNP
rs1315996631 573 dbSNP
rs1239776178 577 dbSNP
rs1334039914 578 dbSNP
rs1331026713 581 dbSNP
rs1392449560 584 dbSNP
rs1390682477 587 dbSNP
rs145839990 593 dbSNP
rs1447378025 613 dbSNP
rs1289577298 620 dbSNP
rs1366981382 631 dbSNP
rs1364318672 633 dbSNP
rs1469362761 634 dbSNP
rs930347120 637 dbSNP
rs1419564102 650 dbSNP
rs3768719 656 dbSNP
rs1219907184 662 dbSNP
rs543586080 666 dbSNP
rs937727381 667 dbSNP
rs1056201679 668 dbSNP
rs1348856540 669 dbSNP
rs896333391 672 dbSNP
rs1281313573 678 dbSNP
rs564972383 682 dbSNP
rs781455468 687 dbSNP
rs1020916701 691 dbSNP
rs750910861 692 dbSNP
rs903739064 693 dbSNP
rs1346529574 699 dbSNP
rs11682181 700 dbSNP
rs1310439605 702 dbSNP
rs1028718635 710 dbSNP
rs1159748703 711 dbSNP
rs540970611 712 dbSNP
rs1260854942 725 dbSNP
rs1197170218 730 dbSNP
rs1465953108 742 dbSNP
rs1019678881 748 dbSNP
rs201491081 748 dbSNP
rs961886217 763 dbSNP
rs1286625329 764 dbSNP
rs1205720767 771 dbSNP
rs779834849 786 dbSNP
rs559744582 789 dbSNP
rs530133016 793 dbSNP
rs17823065 794 dbSNP
rs931540333 800 dbSNP
rs1423664532 802 dbSNP
rs570144975 806 dbSNP
rs984432431 808 dbSNP
rs1324264206 813 dbSNP
rs780216711 820 dbSNP
rs1319888163 823 dbSNP
rs926308247 827 dbSNP
rs1404688073 836 dbSNP
rs937673164 840 dbSNP
rs1159882550 841 dbSNP
rs1474305480 850 dbSNP
rs1243698568 855 dbSNP
rs1056655995 856 dbSNP
rs896227546 858 dbSNP
rs749266580 863 dbSNP
rs1241322536 876 dbSNP
rs1205685159 879 dbSNP
rs190171457 880 dbSNP
rs1324841490 886 dbSNP
rs1272945009 888 dbSNP
rs1213111907 892 dbSNP
rs945198426 894 dbSNP
rs1320071898 897 dbSNP
rs1271186192 900 dbSNP
rs1227656451 901 dbSNP
rs1381620403 903 dbSNP
rs1334061679 904 dbSNP
rs1454130685 912 dbSNP
rs1406641621 918 dbSNP
rs1395498730 929 dbSNP
rs1328094160 933 dbSNP
rs1441362106 950 dbSNP
rs1408196063 955 dbSNP
rs1421362909 966 dbSNP
rs1042206925 967 dbSNP
rs1444194499 969 dbSNP
rs903791548 979 dbSNP
rs1185436345 980 dbSNP
rs1000755853 981 dbSNP
rs1365381289 986 dbSNP
rs1058157 996 dbSNP
rs889810836 1003 dbSNP
rs1008228744 1004 dbSNP
rs1020152822 1009 dbSNP
rs571007033 1011 dbSNP
rs1307658484 1012 dbSNP
rs1330548968 1014 dbSNP
rs1222240389 1016 dbSNP
rs1206302871 1026 dbSNP
rs1312468763 1028 dbSNP
rs961410202 1035 dbSNP
rs994312465 1041 dbSNP
rs1267093802 1045 dbSNP
rs535280049 1059 dbSNP
rs1027079982 1061 dbSNP
rs572347333 1062 dbSNP
rs1423786994 1068 dbSNP
rs1363876700 1072 dbSNP
rs952866848 1076 dbSNP
rs1445519409 1079 dbSNP
rs1407305214 1082 dbSNP
rs1175583460 1087 dbSNP
rs980782644 1090 dbSNP
rs927565312 1103 dbSNP
rs959332654 1107 dbSNP
rs553402476 1116 dbSNP
rs1294476407 1117 dbSNP
rs1477922709 1122 dbSNP
rs1321993047 1125 dbSNP
rs1178230815 1126 dbSNP
rs1414855877 1130 dbSNP
rs1471612831 1136 dbSNP
rs917662284 1156 dbSNP
rs945085389 1160 dbSNP
rs368305281 1197 dbSNP
rs1425490949 1205 dbSNP
rs1407344514 1208 dbSNP
rs1325249027 1210 dbSNP
rs925137484 1216 dbSNP
rs1156934664 1218 dbSNP
rs1408892248 1220 dbSNP
rs144092501 1221 dbSNP
rs1271458793 1225 dbSNP
rs1050149587 1228 dbSNP
rs41449746 1230 dbSNP
rs1008654971 1237 dbSNP
rs1318198545 1243 dbSNP
rs1268279932 1245 dbSNP
rs1222805003 1246 dbSNP
rs1321360451 1251 dbSNP
rs1284901197 1256 dbSNP
rs1387146331 1258 dbSNP
rs1361451524 1262 dbSNP
rs542711226 1263 dbSNP
rs1352264799 1265 dbSNP
rs1345837868 1273 dbSNP
rs1175848582 1275 dbSNP
rs575720402 1278 dbSNP
rs1226020793 1281 dbSNP
rs181058888 1284 dbSNP
rs1428300348 1285 dbSNP
rs1260171098 1291 dbSNP
rs372239270 1294 dbSNP
rs1184394708 1297 dbSNP
rs1486672465 1298 dbSNP
rs994238976 1304 dbSNP
rs1202506135 1306 dbSNP
rs1459877560 1308 dbSNP
rs774990437 1312 dbSNP
rs769910708 1314 dbSNP
rs1229633464 1329 dbSNP
rs1287327597 1338 dbSNP
rs1451334091 1342 dbSNP
rs1205665674 1346 dbSNP
rs1306689982 1346 dbSNP
rs1027006478 1347 dbSNP
rs1216515700 1348 dbSNP
rs1254588023 1348 dbSNP
rs952920958 1349 dbSNP
rs558671937 1350 dbSNP
rs1035021876 1351 dbSNP
rs1408856885 1355 dbSNP
rs576973670 1356 dbSNP
rs1418718301 1361 dbSNP
rs185091771 1364 dbSNP
rs1173045143 1366 dbSNP
rs1161632952 1371 dbSNP
rs1390415823 1376 dbSNP
rs917561528 1381 dbSNP
rs1442234577 1388 dbSNP
rs1413366612 1397 dbSNP
rs1200941748 1413 dbSNP
rs1480291247 1418 dbSNP
rs1249363903 1423 dbSNP
rs1206390743 1426 dbSNP
rs1343070292 1427 dbSNP
rs1314639351 1432 dbSNP
rs1244147609 1433 dbSNP
rs1321176043 1433 dbSNP
rs966354096 1437 dbSNP
rs1391294652 1439 dbSNP
rs1394992139 1443 dbSNP
rs1404482001 1446 dbSNP
rs41483045 1447 dbSNP
rs1430806742 1465 dbSNP
rs1365416729 1470 dbSNP
rs1162517945 1474 dbSNP
rs1372301422 1477 dbSNP
rs925023269 1496 dbSNP
rs563575419 1505 dbSNP
rs936525169 1507 dbSNP
rs184073268 1511 dbSNP
rs374087214 1520 dbSNP
rs1178657786 1525 dbSNP
rs943939271 1526 dbSNP
rs41418645 1541 dbSNP
rs1220512531 1543 dbSNP
rs1361920028 1544 dbSNP
rs1266070870 1549 dbSNP
rs111672860 1551 dbSNP
rs1238434223 1555 dbSNP
rs1449601272 1556 dbSNP
rs1281997330 1558 dbSNP
rs748657651 1559 dbSNP
rs1411035798 1563 dbSNP
rs1345247593 1572 dbSNP
rs563715351 1573 dbSNP
rs531033768 1576 dbSNP
rs191708882 1577 dbSNP
rs1277276931 1588 dbSNP
rs888497325 1592 dbSNP
rs1002111059 1596 dbSNP
rs1034501571 1607 dbSNP
rs1161270383 1614 dbSNP
rs1267884824 1617 dbSNP
rs1472906815 1617 dbSNP
rs1197054511 1620 dbSNP
rs112267674 1622 dbSNP
rs764745339 1626 dbSNP
rs1268318444 1629 dbSNP
rs1014536554 1637 dbSNP
rs1348609632 1642 dbSNP
rs1262617146 1645 dbSNP
rs1020530762 1649 dbSNP
rs1185519656 1657 dbSNP
rs1323489979 1669 dbSNP
rs1281719293 1676 dbSNP
rs1407162837 1677 dbSNP
rs775081189 1679 dbSNP
rs1381362053 1685 dbSNP
rs1382117478 1700 dbSNP
rs1160799573 1701 dbSNP
rs1457671400 1706 dbSNP
rs1173901007 1716 dbSNP
rs977747622 1716 dbSNP
rs1032103459 1727 dbSNP
rs1378046954 1727 dbSNP
rs1192715609 1732 dbSNP
rs62134767 1734 dbSNP
rs957774124 1736 dbSNP
rs1249933951 1741 dbSNP
rs1209463793 1742 dbSNP
rs1168955246 1743 dbSNP
rs1391740734 1745 dbSNP
rs1261821350 1746 dbSNP
rs985708550 1753 dbSNP
rs1427601825 1758 dbSNP
rs1346136896 1761 dbSNP
rs1167820686 1766 dbSNP
rs1270035253 1767 dbSNP
rs911084813 1771 dbSNP
rs943848404 1781 dbSNP
rs564665156 1783 dbSNP
rs1402827221 1786 dbSNP
rs1404802233 1787 dbSNP
rs1334587484 1791 dbSNP
rs557452740 1792 dbSNP
rs1416149400 1797 dbSNP
rs976675104 1806 dbSNP
rs918495654 1811 dbSNP
rs1474520935 1815 dbSNP
rs528698409 1821 dbSNP
rs929986935 1826 dbSNP
rs1444081632 1830 dbSNP
rs546816851 1832 dbSNP
rs568397480 1839 dbSNP
rs1435415492 1863 dbSNP
rs762304268 1864 dbSNP
rs535785023 1868 dbSNP
rs1212833783 1871 dbSNP
rs1443542175 1877 dbSNP
rs1272697261 1878 dbSNP
rs1299406947 1880 dbSNP
rs547778322 1883 dbSNP
rs1228146462 1884 dbSNP
rs1281592071 1885 dbSNP
rs1336983534 1886 dbSNP
rs888547770 1895 dbSNP
rs879223186 1902 dbSNP
rs1228756054 1908 dbSNP
rs569313529 1915 dbSNP
rs764085673 1920 dbSNP
rs183103594 1923 dbSNP
rs937414428 1925 dbSNP
rs1359693803 1928 dbSNP
rs1056270488 1930 dbSNP
rs1408005627 1933 dbSNP
rs772627005 1938 dbSNP
rs896010102 1939 dbSNP
rs1014835008 1944 dbSNP
rs1424320235 1958 dbSNP
rs1383429547 1968 dbSNP
rs1183705740 1969 dbSNP
rs17771942 1983 dbSNP
rs755097834 1984 dbSNP
rs999195629 1992 dbSNP
rs765058436 2001 dbSNP
rs1031989301 2010 dbSNP
rs1358323371 2011 dbSNP
rs147300018 2014 dbSNP
rs985249903 2018 dbSNP
rs1190698322 2020 dbSNP
rs1379714493 2021 dbSNP
rs1246436643 2035 dbSNP
rs1278881842 2043 dbSNP
rs1447364002 2055 dbSNP
rs1352074543 2056 dbSNP
rs1308453727 2065 dbSNP
rs1404529116 2067 dbSNP
rs1187770892 2071 dbSNP
rs1363973898 2072 dbSNP
rs534497794 2074 dbSNP
rs1018435511 2092 dbSNP
rs1406035908 2095 dbSNP
rs1407419117 2104 dbSNP
rs553240553 2111 dbSNP
rs976519938 2114 dbSNP
rs1170264675 2117 dbSNP
rs72882824 2122 dbSNP
rs1457333584 2124 dbSNP
rs1223401718 2130 dbSNP
rs757097484 2133 dbSNP
rs951276041 2134 dbSNP
rs78047345 2151 dbSNP
rs1434804036 2162 dbSNP
rs984098585 2168 dbSNP
rs909914978 2169 dbSNP
rs937321528 2178 dbSNP
rs1333316273 2182 dbSNP
rs1231651605 2184 dbSNP
rs976938445 2197 dbSNP
rs1274812850 2199 dbSNP
rs1459239202 2202 dbSNP
rs1413359205 2210 dbSNP
rs922859482 2213 dbSNP
rs934991094 2217 dbSNP
rs191805297 2225 dbSNP
rs367894199 2226 dbSNP
rs1479658980 2237 dbSNP
rs917316192 2244 dbSNP
rs1192549481 2245 dbSNP
rs1488626889 2246 dbSNP
rs1052555973 2247 dbSNP
rs914986256 2250 dbSNP
rs41332745 2252 dbSNP
rs1206310601 2255 dbSNP
rs1466156166 2265 dbSNP
rs1041871317 2268 dbSNP
rs41478148 2274 dbSNP
rs1000476668 2290 dbSNP
rs1303183760 2304 dbSNP
rs1219991917 2314 dbSNP
rs1054693789 2320 dbSNP
rs1207845559 2323 dbSNP
rs1437372166 2336 dbSNP
rs1044836767 2339 dbSNP
rs1468747337 2340 dbSNP
rs1361230074 2345 dbSNP
rs1177290789 2347 dbSNP
rs1433361818 2348 dbSNP
rs1418370969 2356 dbSNP
rs904990598 2359 dbSNP
rs187769621 2372 dbSNP
rs1248155675 2376 dbSNP
rs1434708240 2380 dbSNP
rs1482250401 2382 dbSNP
rs1257501990 2383 dbSNP
rs1210566750 2392 dbSNP
rs1307079403 2394 dbSNP
rs543818683 2394 dbSNP
rs1403488932 2399 dbSNP
rs1230975319 2402 dbSNP
rs1365982623 2408 dbSNP
rs965460562 2415 dbSNP
rs774201354 2416 dbSNP
rs1382004186 2420 dbSNP
rs1303717683 2423 dbSNP
rs1461806237 2432 dbSNP
rs546248545 2444 dbSNP
rs1166322244 2449 dbSNP
rs1431307958 2462 dbSNP
rs897758412 2485 dbSNP
rs1025402397 2490 dbSNP
rs1182482927 2496 dbSNP
rs994167794 2499 dbSNP
rs1026099299 2503 dbSNP
rs1160814797 2506 dbSNP
rs1258200434 2520 dbSNP
rs1409302172 2526 dbSNP
rs1480185021 2527 dbSNP
rs1456411332 2531 dbSNP
rs1293777106 2536 dbSNP
rs1343165345 2540 dbSNP
rs951205885 2545 dbSNP
rs984026683 2547 dbSNP
rs1393281142 2553 dbSNP
rs952795508 2554 dbSNP
rs564399154 2560 dbSNP
rs149802888 2565 dbSNP
rs958769187 2567 dbSNP
rs1348998013 2578 dbSNP
rs546780000 2586 dbSNP
rs1018322790 2587 dbSNP
rs1411235119 2589 dbSNP
rs4953419 2590 dbSNP
rs199610690 2591 dbSNP
rs1245732807 2594 dbSNP
rs1041923852 2596 dbSNP
rs529497056 2597 dbSNP
rs1489300674 2601 dbSNP
rs1483465484 2608 dbSNP
rs1207852862 2610 dbSNP
rs1266568301 2627 dbSNP
rs1208342917 2646 dbSNP
rs1489501261 2669 dbSNP
rs1483377976 2674 dbSNP
rs922862438 2675 dbSNP
rs35367575 2686 dbSNP
rs1342125368 2691 dbSNP
rs957208200 2693 dbSNP
rs879001779 2696 dbSNP
rs878873359 2697 dbSNP
rs1248929336 2707 dbSNP
rs987819077 2716 dbSNP
rs1229414428 2722 dbSNP
rs1345342616 2724 dbSNP
rs1322470521 2726 dbSNP
rs550871667 2729 dbSNP
rs1225172148 2733 dbSNP
rs1392231943 2733 dbSNP
rs147266461 2733 dbSNP
rs762635324 2733 dbSNP
rs1409665202 2734 dbSNP
rs914850065 2748 dbSNP
rs1164960516 2754 dbSNP
rs1472786533 2754 dbSNP
rs1376920703 2759 dbSNP
rs748447521 2760 dbSNP
rs889330651 2769 dbSNP
rs751699790 2770 dbSNP
rs1163109522 2773 dbSNP
rs1371679991 2775 dbSNP
rs1463891054 2778 dbSNP
rs375839524 2779 dbSNP
rs1270562249 2784 dbSNP
rs1412279667 2786 dbSNP
rs1323240696 2794 dbSNP
rs1044807220 2796 dbSNP
rs1230551331 2797 dbSNP
rs1306743324 2800 dbSNP
rs926377275 2805 dbSNP
rs1301274578 2806 dbSNP
rs1433727550 2809 dbSNP
rs1385876299 2812 dbSNP
rs939148241 2814 dbSNP
rs1457738826 2822 dbSNP
rs1401203076 2824 dbSNP
rs1396680209 2825 dbSNP
rs1170631832 2835 dbSNP
rs1378443864 2847 dbSNP
rs1188235496 2858 dbSNP
rs1447730627 2861 dbSNP
rs1056728964 2862 dbSNP
rs897733381 2866 dbSNP
rs993861189 2875 dbSNP
rs144718981 2877 dbSNP
rs1189752871 2884 dbSNP
rs1442372842 2886 dbSNP
rs1025330580 2908 dbSNP
rs192690339 2912 dbSNP
rs1362355803 2914 dbSNP
rs1299231511 2922 dbSNP
rs41409850 2931 dbSNP
rs1339814602 2932 dbSNP
rs991526594 2935 dbSNP
rs1415951857 2938 dbSNP
rs1402731396 2940 dbSNP
rs570439052 2941 dbSNP
rs1024700249 2944 dbSNP
rs1428117852 2952 dbSNP
rs534750938 2959 dbSNP
rs1189331295 2963 dbSNP
rs1342754229 2963 dbSNP
rs553203800 2965 dbSNP
rs1207169144 2980 dbSNP
rs1236242588 2982 dbSNP
rs1190287755 2986 dbSNP
rs537901183 2988 dbSNP
rs756563046 2989 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 9655.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 9655.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 9655.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065668. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
CLIP-seq Support 1 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000306503.5 | 3UTR | CCACAAGGGCAUAGUGCAGUUCACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000306503.5 | 3UTR | CAAUUUUCUGGCCACAAGGGCAUAGUGCAGUUCACUUACG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000306503.5 | 3UTR | CCACAAGGGCAUAGUGCAGUUCACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000306503.5 | 3UTR | CAAUUUUCUGGCCACAAGGGCAUAGUGCAGUUCACUUACG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000306503.5 | 3UTR | CAAUUUUCUGGCCACAAGGGCAUAGUGCAGUUCACUUACG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000306503.5 | 3UTR | CAAUUUUCUGGCCACAAGGGCAUAGUGCAGUUCACUUACG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM1065668
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_7
Location of target site ENST00000306503.5 | 3UTR | CCACAAGGGCAUAGUGCAGUUCA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
296 hsa-miR-4793-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT092332 EDEM1 ER degradation enhancing alpha-mannosidase like protein 1 2 6
MIRT131237 ATG2A autophagy related 2A 2 2
MIRT145926 ANKFY1 ankyrin repeat and FYVE domain containing 1 2 2
MIRT206559 SOCS5 suppressor of cytokine signaling 5 2 8
MIRT226455 TP53INP1 tumor protein p53 inducible nuclear protein 1 2 2
MIRT337662 ZNF695 zinc finger protein 695 2 2
MIRT405828 SIX4 SIX homeobox 4 2 2
MIRT455113 RILPL1 Rab interacting lysosomal protein like 1 2 2
MIRT456756 TMEM239 transmembrane protein 239 2 4
MIRT457974 RGS9BP regulator of G protein signaling 9 binding protein 2 2
MIRT458173 LYRM4 LYR motif containing 4 2 4
MIRT458245 SLC9A7 solute carrier family 9 member A7 2 2
MIRT466145 TMEM120B transmembrane protein 120B 2 2
MIRT474981 KATNAL1 katanin catalytic subunit A1 like 1 2 2
MIRT475601 HMGB2 high mobility group box 2 2 4
MIRT480759 BMP3 bone morphogenetic protein 3 2 4
MIRT481156 AVL9 AVL9 cell migration associated 2 2
MIRT482155 AK2 adenylate kinase 2 2 2
MIRT488386 VAV3 vav guanine nucleotide exchange factor 3 2 6
MIRT496575 KIF18B kinesin family member 18B 2 2
MIRT498411 TXNDC16 thioredoxin domain containing 16 2 4
MIRT504547 ZNF417 zinc finger protein 417 2 6
MIRT505417 TCF7L2 transcription factor 7 like 2 2 2
MIRT509349 ALDH9A1 aldehyde dehydrogenase 9 family member A1 2 6
MIRT512164 CD164 CD164 molecule 2 6
MIRT517238 PRIM1 DNA primase subunit 1 2 2
MIRT518671 KCNMB1 potassium calcium-activated channel subfamily M regulatory beta subunit 1 2 2
MIRT519298 MLH1 mutL homolog 1 2 2
MIRT523662 FOSL2 FOS like 2, AP-1 transcription factor subunit 2 2
MIRT525452 GPATCH2L G-patch domain containing 2 like 2 2
MIRT539847 ZNF766 zinc finger protein 766 2 2
MIRT540076 SSH3 slingshot protein phosphatase 3 2 2
MIRT540320 PIGR polymeric immunoglobulin receptor 2 2
MIRT540548 MAGI3 membrane associated guanylate kinase, WW and PDZ domain containing 3 2 2
MIRT540759 UTP6 UTP6, small subunit processome component 2 2
MIRT541545 HIATL2 major facilitator superfamily domain containing 14C 2 2
MIRT541553 SLC35E1 solute carrier family 35 member E1 2 2
MIRT541666 ATP8B3 ATPase phospholipid transporting 8B3 2 4
MIRT541722 TFDP2 transcription factor Dp-2 2 2
MIRT541800 DUSP28 dual specificity phosphatase 28 2 2
MIRT541816 SMU1 DNA replication regulator and spliceosomal factor 2 2
MIRT541907 VWA7 von Willebrand factor A domain containing 7 2 2
MIRT542154 UGDH UDP-glucose 6-dehydrogenase 2 2
MIRT542207 C14orf142 GON7, KEOPS complex subunit homolog 2 2
MIRT542233 FUT9 fucosyltransferase 9 2 2
MIRT542320 SERPING1 serpin family G member 1 2 2
MIRT542369 PAICS phosphoribosylaminoimidazole carboxylase and phosphoribosylaminoimidazolesuccinocarboxamide synthase 2 2
MIRT542476 APOC3 apolipoprotein C3 2 2
MIRT542641 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT542660 TAF11 TATA-box binding protein associated factor 11 2 2
MIRT542749 PRRG4 proline rich and Gla domain 4 2 4
MIRT542789 PLEKHA3 pleckstrin homology domain containing A3 2 2
MIRT545442 FGFRL1 fibroblast growth factor receptor like 1 2 2
MIRT546206 TOR1AIP2 torsin 1A interacting protein 2 2 2
MIRT552270 RAB3D RAB3D, member RAS oncogene family 2 2
MIRT552655 ZADH2 zinc binding alcohol dehydrogenase domain containing 2 2 2
MIRT554134 SMARCA5 SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 5 2 2
MIRT556795 KIAA1958 KIAA1958 2 2
MIRT564762 ZHX3 zinc fingers and homeoboxes 3 2 2
MIRT569428 STX7 syntaxin 7 2 2
MIRT573245 ZBTB46 zinc finger and BTB domain containing 46 2 2
MIRT607390 LANCL3 LanC like 3 2 2
MIRT607430 NOTCH2NL notch 2 N-terminal like 2 2
MIRT607452 ZNF543 zinc finger protein 543 2 2
MIRT607580 TANGO2 transport and golgi organization 2 homolog 2 2
MIRT607748 ANGPT4 angiopoietin 4 2 2
MIRT607907 SPRYD4 SPRY domain containing 4 2 2
MIRT608703 GMPR guanosine monophosphate reductase 2 2
MIRT612127 NDUFA10 NADH:ubiquinone oxidoreductase subunit A10 2 2
MIRT612786 MAP3K9 mitogen-activated protein kinase kinase kinase 9 2 4
MIRT616692 LPL lipoprotein lipase 2 2
MIRT617045 ZNF610 zinc finger protein 610 2 2
MIRT617091 ZNF43 zinc finger protein 43 2 2
MIRT617314 MBOAT1 membrane bound O-acyltransferase domain containing 1 2 2
MIRT617355 MELK maternal embryonic leucine zipper kinase 2 2
MIRT617486 ALG9 ALG9, alpha-1,2-mannosyltransferase 2 2
MIRT617579 NDUFB5 NADH:ubiquinone oxidoreductase subunit B5 2 2
MIRT617669 RSRC1 arginine and serine rich coiled-coil 1 2 2
MIRT617722 TRAPPC2 trafficking protein particle complex 2 2 4
MIRT617893 PTCHD3 patched domain containing 3 2 2
MIRT617982 ZNF234 zinc finger protein 234 2 4
MIRT618434 MYLK3 myosin light chain kinase 3 2 4
MIRT618732 HIST1H2AH histone cluster 1 H2A family member h 2 2
MIRT619045 CASS4 Cas scaffolding protein family member 4 2 2
MIRT619573 ATAT1 alpha tubulin acetyltransferase 1 2 4
MIRT619671 CYP1A2 cytochrome P450 family 1 subfamily A member 2 2 2
MIRT619887 ABHD17B abhydrolase domain containing 17B 2 2
MIRT620519 SNRPD1 small nuclear ribonucleoprotein D1 polypeptide 2 4
MIRT620535 AVPR1A arginine vasopressin receptor 1A 2 2
MIRT620996 C19orf52 translocase of inner mitochondrial membrane 29 2 2
MIRT621304 YIPF4 Yip1 domain family member 4 2 2
MIRT622086 SRPX2 sushi repeat containing protein, X-linked 2 2 2
MIRT622168 SMYD1 SET and MYND domain containing 1 2 2
MIRT622543 PXMP4 peroxisomal membrane protein 4 2 2
MIRT622761 PGM3 phosphoglucomutase 3 2 2
MIRT622885 PDCL3 phosducin like 3 2 4
MIRT623130 NDUFC2 NADH:ubiquinone oxidoreductase subunit C2 2 2
MIRT624840 ACAP2 ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 2 2
MIRT625047 MBD3 methyl-CpG binding domain protein 3 2 2
MIRT625059 ZNF556 zinc finger protein 556 2 2
MIRT625508 PPAPDC1A phospholipid phosphatase 4 2 2
MIRT625573 ANKRD42 ankyrin repeat domain 42 2 2
MIRT626133 SNRNP48 small nuclear ribonucleoprotein U11/U12 subunit 48 2 2
MIRT626327 LRTOMT leucine rich transmembrane and O-methyltransferase domain containing 2 2
MIRT626765 CDC14B cell division cycle 14B 2 2
MIRT626798 CSE1L chromosome segregation 1 like 2 2
MIRT627212 ZC3H12B zinc finger CCCH-type containing 12B 2 2
MIRT627225 ZBTB8B zinc finger and BTB domain containing 8B 2 4
MIRT627256 XKR4 XK related 4 2 2
MIRT628190 GATSL2 cytosolic arginine sensor for mTORC1 subunit 2 2 2
MIRT628466 AHSA2 activator of HSP90 ATPase homolog 2 2 2
MIRT628627 CCT4 chaperonin containing TCP1 subunit 4 2 2
MIRT629040 KLLN killin, p53-regulated DNA replication inhibitor 2 2
MIRT630847 ACACB acetyl-CoA carboxylase beta 2 2
MIRT631721 RNASEH2B ribonuclease H2 subunit B 2 2
MIRT632264 USP1 ubiquitin specific peptidase 1 2 4
MIRT632571 POLQ DNA polymerase theta 2 2
MIRT633992 SLC35E2 solute carrier family 35 member E2 2 2
MIRT635211 ZNF286A zinc finger protein 286A 2 4
MIRT635249 ELOVL6 ELOVL fatty acid elongase 6 2 4
MIRT635261 FBXL20 F-box and leucine rich repeat protein 20 2 2
MIRT635283 GK5 glycerol kinase 5 (putative) 2 2
MIRT635663 DTX3L deltex E3 ubiquitin ligase 3L 2 2
MIRT636251 SEC63 SEC63 homolog, protein translocation regulator 2 2
MIRT636564 EPB41 erythrocyte membrane protein band 4.1 2 2
MIRT636814 TBC1D24 TBC1 domain family member 24 2 2
MIRT637358 ZNF460 zinc finger protein 460 2 2
MIRT637473 DEFB105B defensin beta 105B 2 4
MIRT637505 DEFB105A defensin beta 105A 2 4
MIRT637861 SC5D sterol-C5-desaturase 2 2
MIRT638080 ZNF652 zinc finger protein 652 2 2
MIRT638096 ZBTB8A zinc finger and BTB domain containing 8A 2 2
MIRT638174 TMED4 transmembrane p24 trafficking protein 4 2 2
MIRT638201 TAF13 TATA-box binding protein associated factor 13 2 2
MIRT638278 SH2B3 SH2B adaptor protein 3 2 2
MIRT638714 FUT11 fucosyltransferase 11 2 2
MIRT638852 CLMP CXADR like membrane protein 2 2
MIRT639815 TMED8 transmembrane p24 trafficking protein family member 8 2 2
MIRT640879 ENTPD1 ectonucleoside triphosphate diphosphohydrolase 1 2 2
MIRT640937 FAM129A family with sequence similarity 129 member A 2 2
MIRT640971 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT641642 GNAZ G protein subunit alpha z 2 2
MIRT641931 SLC25A16 solute carrier family 25 member 16 2 2
MIRT642136 CRY2 cryptochrome circadian clock 2 2 2
MIRT643199 JAK3 Janus kinase 3 2 2
MIRT643256 ZNF566 zinc finger protein 566 2 2
MIRT643378 TRIM16L tripartite motif containing 16 like 2 2
MIRT643683 AMER3 APC membrane recruitment protein 3 2 2
MIRT643728 MCMDC2 minichromosome maintenance domain containing 2 2 2
MIRT643949 CCDC141 coiled-coil domain containing 141 2 2
MIRT644915 SERF1B small EDRK-rich factor 1B 2 2
MIRT645163 NOL9 nucleolar protein 9 2 2
MIRT645547 PABPC1L2B poly(A) binding protein cytoplasmic 1 like 2B 2 2
MIRT645550 PABPC1L2A poly(A) binding protein cytoplasmic 1 like 2A 2 2
MIRT645572 TACR2 tachykinin receptor 2 2 2
MIRT646697 SERF1A small EDRK-rich factor 1A 2 2
MIRT647806 FRMD8 FERM domain containing 8 2 2
MIRT647903 CIRH1A UTP4, small subunit processome component 2 2
MIRT648978 ACAD8 acyl-CoA dehydrogenase family member 8 2 2
MIRT649907 SLFN12L schlafen family member 12 like 2 2
MIRT650224 SIGLEC9 sialic acid binding Ig like lectin 9 2 4
MIRT651880 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 2 2
MIRT651935 UBN1 ubinuclein 1 2 2
MIRT652839 TACO1 translational activator of cytochrome c oxidase I 2 2
MIRT652994 SUGT1 SGT1 homolog, MIS12 kinetochore complex assembly cochaperone 2 2
MIRT654800 PRICKLE1 prickle planar cell polarity protein 1 2 2
MIRT655591 OTUD7B OTU deubiquitinase 7B 2 2
MIRT658760 EIF4EBP2 eukaryotic translation initiation factor 4E binding protein 2 2 2
MIRT659358 CRKL CRK like proto-oncogene, adaptor protein 2 2
MIRT660717 AMER1 APC membrane recruitment protein 1 2 2
MIRT660737 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT661088 TMEM145 transmembrane protein 145 2 2
MIRT661176 S1PR2 sphingosine-1-phosphate receptor 2 2 2
MIRT662005 ZNF445 zinc finger protein 445 2 2
MIRT662178 KIAA1210 KIAA1210 2 2
MIRT662270 OR51E2 olfactory receptor family 51 subfamily E member 2 2 2
MIRT663046 SLC16A4 solute carrier family 16 member 4 2 2
MIRT663476 POFUT2 protein O-fucosyltransferase 2 2 2
MIRT664039 RPL27A ribosomal protein L27a 2 2
MIRT664096 ZDHHC24 zinc finger DHHC-type containing 24 2 2
MIRT664109 FUT1 fucosyltransferase 1 (H blood group) 2 2
MIRT664317 CD209 CD209 molecule 2 2
MIRT664455 BBS5 Bardet-Biedl syndrome 5 2 2
MIRT664595 HSD17B12 hydroxysteroid 17-beta dehydrogenase 12 2 4
MIRT664694 DBF4 DBF4 zinc finger 2 2
MIRT665162 SF3A1 splicing factor 3a subunit 1 2 2
MIRT665214 RBM22 RNA binding motif protein 22 2 2
MIRT665254 ZNF286B zinc finger protein 286B 2 2
MIRT665268 ZFP69B ZFP69 zinc finger protein B 2 2
MIRT665606 TTC39A tetratricopeptide repeat domain 39A 2 2
MIRT665830 TIMELESS timeless circadian clock 2 2
MIRT666201 SMARCC1 SWI/SNF related, matrix associated, actin dependent regulator of chromatin subfamily c member 1 2 2
MIRT666546 RNF115 ring finger protein 115 2 2
MIRT666602 REEP3 receptor accessory protein 3 2 2
MIRT666862 POU2F3 POU class 2 homeobox 3 2 4
MIRT666886 POLA2 DNA polymerase alpha 2, accessory subunit 2 2
MIRT667158 NRXN3 neurexin 3 2 2
MIRT667252 NEK9 NIMA related kinase 9 2 2
MIRT667419 MFSD2A major facilitator superfamily domain containing 2A 2 2
MIRT667434 METTL8 methyltransferase like 8 2 2
MIRT668023 HAUS3 HAUS augmin like complex subunit 3 2 2
MIRT668062 GPR75 G protein-coupled receptor 75 2 2
MIRT668070 GOSR1 golgi SNAP receptor complex member 1 2 2
MIRT668607 EHD4 EH domain containing 4 2 4
MIRT668694 DNAL1 dynein axonemal light chain 1 2 2
MIRT668782 DAAM1 dishevelled associated activator of morphogenesis 1 2 2
MIRT669037 CHEK1 checkpoint kinase 1 2 2
MIRT669044 CHAF1B chromatin assembly factor 1 subunit B 2 4
MIRT669156 CCNG1 cyclin G1 2 2
MIRT670090 ABCF3 ATP binding cassette subfamily F member 3 2 4
MIRT670206 SLC24A4 solute carrier family 24 member 4 2 2
MIRT672488 FUS FUS RNA binding protein 2 2
MIRT673830 SLC11A2 solute carrier family 11 member 2 2 2
MIRT675481 VEGFC vascular endothelial growth factor C 2 2
MIRT675634 HACE1 HECT domain and ankyrin repeat containing E3 ubiquitin protein ligase 1 2 2
MIRT677913 HIST1H2BN histone cluster 1 H2B family member n 2 2
MIRT678420 ANKRD36 ankyrin repeat domain 36 2 2
MIRT678626 OLFML2A olfactomedin like 2A 2 2
MIRT678791 NUPL2 nucleoporin like 2 2 2
MIRT679561 LIN9 lin-9 DREAM MuvB core complex component 2 2
MIRT680743 CA5B carbonic anhydrase 5B 2 2
MIRT682481 LIX1L limb and CNS expressed 1 like 2 4
MIRT682701 PSMD9 proteasome 26S subunit, non-ATPase 9 2 2
MIRT682759 MDM2 MDM2 proto-oncogene 2 2
MIRT682811 TMCO1 transmembrane and coiled-coil domains 1 2 2
MIRT682847 DNAJC28 DnaJ heat shock protein family (Hsp40) member C28 2 2
MIRT682896 XIAP X-linked inhibitor of apoptosis 2 2
MIRT682916 FAM73A mitoguardin 1 2 2
MIRT682935 ZNF292 zinc finger protein 292 2 2
MIRT682953 RPL12 ribosomal protein L12 2 2
MIRT682972 NF2 neurofibromin 2 2 2
MIRT683033 SUSD5 sushi domain containing 5 2 2
MIRT683081 A1BG alpha-1-B glycoprotein 2 2
MIRT683105 TIMM10B translocase of inner mitochondrial membrane 10B 2 2
MIRT686640 TMEM184C transmembrane protein 184C 2 2
MIRT687444 NR3C1 nuclear receptor subfamily 3 group C member 1 2 2
MIRT688401 EMC8 ER membrane protein complex subunit 8 2 2
MIRT688886 C3orf70 chromosome 3 open reading frame 70 2 2
MIRT689148 IRAK1BP1 interleukin 1 receptor associated kinase 1 binding protein 1 2 2
MIRT689234 RPS19 ribosomal protein S19 2 2
MIRT689306 C5AR2 complement component 5a receptor 2 2 2
MIRT689364 ZNF101 zinc finger protein 101 2 2
MIRT689498 SCARF1 scavenger receptor class F member 1 2 2
MIRT689655 RBM23 RNA binding motif protein 23 2 2
MIRT689897 SOD2 superoxide dismutase 2 2 2
MIRT690150 PPIL6 peptidylprolyl isomerase like 6 2 2
MIRT690601 C17orf105 chromosome 17 open reading frame 105 2 2
MIRT690805 FAHD1 fumarylacetoacetate hydrolase domain containing 1 2 2
MIRT690946 GLG1 golgi glycoprotein 1 2 2
MIRT691388 ATP13A4 ATPase 13A4 2 2
MIRT691408 DNA2 DNA replication helicase/nuclease 2 2 2
MIRT692175 LRRC3C leucine rich repeat containing 3C 2 2
MIRT692235 ALDH1B1 aldehyde dehydrogenase 1 family member B1 2 2
MIRT693283 GINM1 glycoprotein integral membrane 1 2 2
MIRT693439 TPGS1 tubulin polyglutamylase complex subunit 1 2 2
MIRT693460 HIST1H2AG histone cluster 1 H2A family member g 2 2
MIRT693768 ZNF383 zinc finger protein 383 2 2
MIRT694018 PPIL4 peptidylprolyl isomerase like 4 2 2
MIRT694236 ZNF749 zinc finger protein 749 2 2
MIRT694321 NLRP9 NLR family pyrin domain containing 9 2 2
MIRT694347 CHST6 carbohydrate sulfotransferase 6 2 2
MIRT694430 MCF2L2 MCF.2 cell line derived transforming sequence-like 2 2 2
MIRT695763 WDR35 WD repeat domain 35 2 2
MIRT696167 TIPIN TIMELESS interacting protein 2 2
MIRT696417 DOCK7 dedicator of cytokinesis 7 2 2
MIRT696543 C3 complement C3 2 2
MIRT696998 CCDC80 coiled-coil domain containing 80 2 2
MIRT697232 ZYG11A zyg-11 family member A, cell cycle regulator 2 2
MIRT697806 UBXN2A UBX domain protein 2A 2 2
MIRT697944 TVP23C trans-golgi network vesicle protein 23 homolog C 2 2
MIRT698161 TNFRSF13C TNF receptor superfamily member 13C 2 2
MIRT698778 STK4 serine/threonine kinase 4 2 2
MIRT700259 RBM12B RNA binding motif protein 12B 2 2
MIRT700970 PDK3 pyruvate dehydrogenase kinase 3 2 2
MIRT701251 NUP35 nucleoporin 35 2 2
MIRT701607 MYPN myopalladin 2 2
MIRT702457 KIAA1467 family with sequence similarity 234 member B 2 2
MIRT702613 ITPRIPL2 inositol 1,4,5-trisphosphate receptor interacting protein like 2 2 2
MIRT702691 IRGQ immunity related GTPase Q 2 2
MIRT702934 HMX3 H6 family homeobox 3 2 2
MIRT702991 HERPUD2 HERPUD family member 2 2 2
MIRT703148 GPR137C G protein-coupled receptor 137C 2 2
MIRT703980 EMC1 ER membrane protein complex subunit 1 2 2
MIRT704569 CLPX caseinolytic mitochondrial matrix peptidase chaperone subunit 2 2
MIRT705065 C4orf32 family with sequence similarity 241 member A 2 2
MIRT705447 ATL2 atlastin GTPase 2 2 2
MIRT705856 AFF3 AF4/FMR2 family member 3 2 2
MIRT705886 ADIPOR2 adiponectin receptor 2 2 2
MIRT714370 HP1BP3 heterochromatin protein 1 binding protein 3 2 2
MIRT715784 PHF12 PHD finger protein 12 2 2
MIRT715864 KIAA0101 PCNA clamp associated factor 2 2
MIRT715947 NUP93 nucleoporin 93 2 2
MIRT716132 THOC5 THO complex 5 2 2
MIRT717084 EBF4 early B-cell factor 4 2 2
MIRT725424 HNRNPA3 heterogeneous nuclear ribonucleoprotein A3 2 2
MIRT736091 GREM1 gremlin 1, DAN family BMP antagonist 3 0
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4793 Dabrafenib 44462760 NSC764134 approved sensitive cell line (A375)
hsa-miR-4793-3p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-4793-3p Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-4793-3p Osimertinib 71496458 NSC779217 approved sensitive cell line (H1975)

Error report submission