miRTarBase - #MIRT207395


—
pre-miRNA Information
pre-miRNA hsa-mir-3192   
Genomic Coordinates chr20: 18470615 - 18470691
Description Homo sapiens miR-3192 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-3192-5p
Sequence 10| UCUGGGAGGUUGUAGCAGUGGAA |32
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs906254403 3 dbSNP
rs554130490 4 dbSNP
rs773140898 6 dbSNP
rs376614009 11 dbSNP
rs899297329 12 dbSNP
rs1330418015 18 dbSNP
rs1402597660 21 dbSNP
rs995052311 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol MAT2A   
Synonyms MATA2, MATII, SAMS2
Description methionine adenosyltransferase 2A
Transcript NM_005911   
Expression
Putative miRNA Targets on MAT2A
3'UTR of MAT2A
(miRNA target sites are highlighted)		 
>MAT2A|NM_005911|3'UTR
   1 AAGTGTTAGCCTTTTTTCCCCAGACTTGTTGGCGTAGGCTACAGAGAAGCCTTCAAGCTCTGAGGGAAAGGGCCCTCCTT
  81 CCTAAATTTTCCTGTCCTCTTTCAGCTCCTGACCAGTTGCAGTCACTCTAGTCAATGACATGAATTTTAGCTTTTGTGGG
 161 GGACTGTAAGTTGGGCTTGCTATTCTGTCCCTAGGTGTTTTGTTCACCATTATAATGAATTTAGTGAGCATAGGTGATCC
 241 ATGTAACTGCCTAGAAACAACACTGTAGTAAATAATGCTTTGAAATTGAACCTTTGTGCCCTATCACCCAACGCTCCAAA
 321 GTCATAATTGCATTGACTTTCCCCACCAGATGCTGAAAATGTCCTTGTGATGTGCACGTAAAGTACTTGTAGTTCCACTT
 401 ATAGCCTCTGTCTGGCAATGCCACAGCCCTGTCAGCATGAATTTGTAATGTCTTGAGCTCTATTATGAATGTGAAGCCTT
 481 CCCCTTATCCTCCCTGTAACTTGATCCATTTCTAATTATGTAGCTCTTTGTCAGGGAGTGTTCCCTATCCAATCAATCTT
 561 GCATGTAACGCAAGTTCCCAGTTGGAGCTCCAGCCTGACATCAAAAAAGGCAGTTACCATTAAACCATCTCCCTGGTGCT
 641 TATGCTCTTAATTGCCACCTCTAACAGCACCAAATCAAAATCTCTCCACTTTCAGCTGTCTTTTGGAGGACGTACGTAAT
 721 AAGGTTTTAATTTAGTAAACCAATCCTATGCATGGTTTCAGCACTAGCCAAACCTCACCAACTCCTAGTTCTAGAAAAAC
 801 AGGCACTTGGCAGCCTTGTGATGTCATACAGAGAAGTCACAGGGCAGTACCTGAGGGTCTGTAGGTTGCACACTTTGGTA
 881 CCAGATAACTTTTTTTTTTCTTTATAAGAAAGCCTGAGTACTCCACACTGCACAATAACTCCTCCCAGGGTTTTAACTTT
 961 GTTTTATTTTCAAAACCAGGTCCAATGAGCTTTCTGAACAGCTGGTGTAGCTACAGAGAAACCAGCTTCCTTCAGAGAGC
1041 AGTGCTTTTGGCGGGGAGGAGGAAATCCCTTCATACTTGAACGTTTTCTAATTGCTTATTTATTGTATTCTGGGGTATGG
1121 CGTAAGTACAGAGAAGCCATCACCTCAGATGGCAGCTTTTAAAAGATTTTTTTTTTTTCTCTCAACACCATGATTCCTTT
1201 AACAACATGTTTCCAGCATTCCCAGGTAGGCCAAGGTGTCCTACAGAAAAACCTTGGGTTAGACCTACAGGGGGTCTGGC
1281 TGGTGTTAACAGAAGGGAGGGCAGAGCTGGTGCGGCTGGCCATGGAGAAAGCTGACTTGGCTGGTGTGGTACAGAGAAGC
1361 CAGCTTGTTTACATGCTTATTCCATGACTGCTTGCCCTAAGCAGAAAGTGCCTTTCAGGATCTATTTTTGGAGGTTTATT
1441 ACGTATGTCTGGTTCTCAATTCCAACAGTTTAATGAAGATCTAAATAAAATGCTAGGTTCTACCTTAAAAAAAAAAAAAA
1521 AAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' aagGUGACGAUGUU-----GGAGGGUCu 5'
             |||||| ||||     |||||||| 
Target 5' ccaCACTGC-ACAATAACTCCTCCCAGg 3'
 923 - 949 171.00 -27.60
2 
miRNA  3' aagGUGACGAU--GUUGGAGGGUCu 5'
             || ||: |  ||| :|||||| 
Target 5' ttgCA-TGTAACGCAAGTTCCCAGt 3'
 559 - 582 141.00 -16.80
3 
miRNA  3' aaGGUGACGA-UGUUGGAGGGUCu 5'
            |||   || || | ||||:|| 
Target 5' agCCAAACCTCACCAACTCCTAGt 3'
 766 - 789 141.00 -15.40
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
337171 1166 ClinVar
337172 1167 ClinVar
337173 1268 ClinVar
898899 1315 ClinVar
898900 1323 ClinVar
898901 1365 ClinVar
337174 1419 ClinVar
337175 1437 ClinVar
895937 1443 ClinVar
895938 1482 ClinVar
COSN31491713 2 COSMIC
COSN30569488 8 COSMIC
COSN31518289 17 COSMIC
COSN31482386 30 COSMIC
COSN14532144 93 COSMIC
COSN9391534 100 COSMIC
COSN20288801 186 COSMIC
COSN26556738 250 COSMIC
COSN20090570 279 COSMIC
COSN31601278 302 COSMIC
COSN26670157 313 COSMIC
COSN5865552 336 COSMIC
COSN31588545 347 COSMIC
COSN31559515 535 COSMIC
COSN31545991 562 COSMIC
COSN26601554 580 COSMIC
COSN6559526 605 COSMIC
COSN31563363 643 COSMIC
COSN31489295 662 COSMIC
COSN31518105 716 COSMIC
COSN22229193 749 COSMIC
COSN31959778 769 COSMIC
COSN16524245 775 COSMIC
COSN28669283 869 COSMIC
COSN28250198 914 COSMIC
COSN20090571 1017 COSMIC
COSN27886919 1152 COSMIC
COSN31529730 1180 COSMIC
COSN28249874 1182 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1171039097 1 dbSNP
rs776431969 8 dbSNP
rs1359092024 10 dbSNP
rs1412686279 11 dbSNP
rs1332323028 12 dbSNP
rs372099842 13 dbSNP
rs1448793530 17 dbSNP
rs1315047771 19 dbSNP
rs1338624920 21 dbSNP
rs749458057 23 dbSNP
rs769156900 30 dbSNP
rs774638304 31 dbSNP
rs1342163005 34 dbSNP
rs762233743 37 dbSNP
rs1277360846 39 dbSNP
rs1312288358 50 dbSNP
rs952350922 58 dbSNP
rs1180192001 70 dbSNP
rs1483002521 76 dbSNP
rs1236811167 86 dbSNP
rs1204174398 92 dbSNP
rs1233656160 98 dbSNP
rs1486508152 104 dbSNP
rs984413834 106 dbSNP
rs1484269551 109 dbSNP
rs148739699 112 dbSNP
rs1342436786 114 dbSNP
rs1297358338 120 dbSNP
rs1417541111 123 dbSNP
rs940192158 125 dbSNP
rs1417193735 126 dbSNP
rs1369041877 129 dbSNP
rs1475832951 136 dbSNP
rs1430875852 141 dbSNP
rs1165445622 143 dbSNP
rs530472867 149 dbSNP
rs1163012698 153 dbSNP
rs1423286919 155 dbSNP
rs1407707065 158 dbSNP
rs1414665222 163 dbSNP
rs1188510143 164 dbSNP
rs1476155208 165 dbSNP
rs1249259783 166 dbSNP
rs1480869596 167 dbSNP
rs992982477 167 dbSNP
rs1252678305 168 dbSNP
rs1218975506 174 dbSNP
rs1320547079 177 dbSNP
rs549048191 179 dbSNP
rs917340680 183 dbSNP
rs1235611950 184 dbSNP
rs1349174972 186 dbSNP
rs948859314 192 dbSNP
rs1376036100 195 dbSNP
rs1291961810 201 dbSNP
rs1457616314 206 dbSNP
rs1044866892 220 dbSNP
rs1411469041 222 dbSNP
rs904570942 223 dbSNP
rs1354525598 233 dbSNP
rs1455769270 234 dbSNP
rs1409644134 236 dbSNP
rs1181427467 237 dbSNP
rs1419417499 239 dbSNP
rs1245439519 240 dbSNP
rs935963530 242 dbSNP
rs1337599363 243 dbSNP
rs1053637181 246 dbSNP
rs1487960386 251 dbSNP
rs1273503817 264 dbSNP
rs1215007075 266 dbSNP
rs142372744 277 dbSNP
rs15351 278 dbSNP
rs1268023991 288 dbSNP
rs1009830797 292 dbSNP
rs1319055395 295 dbSNP
rs1299662967 302 dbSNP
rs1386364304 304 dbSNP
rs371796804 305 dbSNP
rs1328239893 308 dbSNP
rs1432962922 311 dbSNP
rs1344621433 312 dbSNP
rs868266117 313 dbSNP
rs562646394 314 dbSNP
rs990394448 317 dbSNP
rs1486164948 320 dbSNP
rs796159921 322 dbSNP
rs534733325 325 dbSNP
rs996646224 332 dbSNP
rs1253219143 341 dbSNP
rs1195159153 343 dbSNP
rs1028075771 354 dbSNP
rs1246905898 357 dbSNP
rs952362235 361 dbSNP
rs983754653 364 dbSNP
rs1254828628 372 dbSNP
rs1166772986 378 dbSNP
rs1232969237 378 dbSNP
rs1390206551 379 dbSNP
rs1226499473 381 dbSNP
rs1431271658 382 dbSNP
rs1015867868 387 dbSNP
rs961626588 388 dbSNP
rs1382644226 390 dbSNP
rs546694561 392 dbSNP
rs571712952 396 dbSNP
rs539230166 398 dbSNP
rs867903069 399 dbSNP
rs1175075474 401 dbSNP
rs1447298989 401 dbSNP
rs6711750 403 dbSNP
rs1193273739 404 dbSNP
rs542611069 406 dbSNP
rs1254658584 407 dbSNP
rs926003757 410 dbSNP
rs936014197 419 dbSNP
rs1282935879 427 dbSNP
rs1429890230 430 dbSNP
rs1203210023 431 dbSNP
rs1298450528 432 dbSNP
rs1367371874 437 dbSNP
rs1271054365 438 dbSNP
rs1229679322 458 dbSNP
rs1053024782 464 dbSNP
rs1232376902 465 dbSNP
rs536237196 467 dbSNP
rs1279873920 471 dbSNP
rs866919338 473 dbSNP
rs1375773820 478 dbSNP
rs1314498025 479 dbSNP
rs1427660599 482 dbSNP
rs1346217852 485 dbSNP
rs1168185796 489 dbSNP
rs1476090835 490 dbSNP
rs1202519257 493 dbSNP
rs1282815268 494 dbSNP
rs913204821 506 dbSNP
rs184837848 508 dbSNP
rs1187391928 509 dbSNP
rs945343846 513 dbSNP
rs1259962509 515 dbSNP
rs572981137 516 dbSNP
rs1446960833 519 dbSNP
rs1482963105 520 dbSNP
rs1041354002 531 dbSNP
rs1197813121 540 dbSNP
rs1354284705 542 dbSNP
rs540302323 544 dbSNP
rs1264952628 549 dbSNP
rs901047641 550 dbSNP
rs144911618 553 dbSNP
rs189711755 557 dbSNP
rs1407740658 563 dbSNP
rs1329069013 564 dbSNP
rs1411323189 566 dbSNP
rs888167879 569 dbSNP
rs545194929 570 dbSNP
rs1394079550 571 dbSNP
rs1180702708 574 dbSNP
rs1466395839 575 dbSNP
rs1233843420 581 dbSNP
rs1174140129 582 dbSNP
rs1382451569 588 dbSNP
rs1267022322 589 dbSNP
rs1214387799 590 dbSNP
rs1400054167 590 dbSNP
rs1337103806 591 dbSNP
rs1321062296 592 dbSNP
rs1226528403 593 dbSNP
rs1391009441 593 dbSNP
rs1438785764 595 dbSNP
rs1279932835 600 dbSNP
rs1302500481 604 dbSNP
rs1328990250 607 dbSNP
rs748649521 610 dbSNP
rs1331864210 614 dbSNP
rs1396076361 617 dbSNP
rs758737664 618 dbSNP
rs560991019 620 dbSNP
rs1278165339 625 dbSNP
rs1014546284 632 dbSNP
rs1024938276 641 dbSNP
rs1477278722 645 dbSNP
rs1377263991 647 dbSNP
rs1194545491 650 dbSNP
rs1469847286 654 dbSNP
rs1350329421 656 dbSNP
rs1206678255 662 dbSNP
rs535170379 672 dbSNP
rs771181010 679 dbSNP
rs1342668115 682 dbSNP
rs1302190722 683 dbSNP
rs970259542 685 dbSNP
rs1465902185 690 dbSNP
rs1867880 693 dbSNP
rs1211243117 694 dbSNP
rs1429503543 697 dbSNP
rs1346298077 701 dbSNP
rs980209264 712 dbSNP
rs1433435376 713 dbSNP
rs1394885634 715 dbSNP
rs1174440135 717 dbSNP
rs1455753618 725 dbSNP
rs528550929 726 dbSNP
rs1185999529 729 dbSNP
rs926054748 742 dbSNP
rs1242607591 744 dbSNP
rs957473607 753 dbSNP
rs1440434587 764 dbSNP
rs1472139632 773 dbSNP
rs191347244 775 dbSNP
rs1211074871 778 dbSNP
rs1349598237 782 dbSNP
rs1390710350 790 dbSNP
rs988841637 792 dbSNP
rs913267650 793 dbSNP
rs1362093910 794 dbSNP
rs1459975102 798 dbSNP
rs1446487539 802 dbSNP
rs1375156011 803 dbSNP
rs1313871355 805 dbSNP
rs1437043321 807 dbSNP
rs1325336696 809 dbSNP
rs1368931892 813 dbSNP
rs1170067959 814 dbSNP
rs944702983 816 dbSNP
rs1388750477 821 dbSNP
rs1474188092 825 dbSNP
rs1188379943 828 dbSNP
rs1256810184 828 dbSNP
rs1486559712 831 dbSNP
rs1249232250 838 dbSNP
rs1050108 845 dbSNP
rs1040972738 847 dbSNP
rs1189695949 848 dbSNP
rs1307513466 857 dbSNP
rs1274512537 858 dbSNP
rs563435482 866 dbSNP
rs922479891 874 dbSNP
rs1229375817 877 dbSNP
rs1290796235 879 dbSNP
rs1294499613 879 dbSNP
rs1333378698 882 dbSNP
rs1233158991 886 dbSNP
rs932486523 887 dbSNP
rs1005336170 890 dbSNP
rs1461045183 890 dbSNP
rs550275542 890 dbSNP
rs888264150 890 dbSNP
rs1417054644 892 dbSNP
rs11537669 901 dbSNP
rs1165619589 903 dbSNP
rs1488483037 905 dbSNP
rs1248174300 914 dbSNP
rs1176207786 915 dbSNP
rs1037185525 918 dbSNP
rs1211335116 922 dbSNP
rs1234315806 924 dbSNP
rs1211262858 926 dbSNP
rs778027496 927 dbSNP
rs1482634166 928 dbSNP
rs745453983 936 dbSNP
rs1024572825 937 dbSNP
rs1327454679 940 dbSNP
rs1306742962 945 dbSNP
rs1474196562 949 dbSNP
rs970689927 950 dbSNP
rs1001721327 958 dbSNP
rs1375788347 958 dbSNP
rs1440227577 969 dbSNP
rs1369199015 975 dbSNP
rs1395355837 978 dbSNP
rs1459501859 979 dbSNP
rs780961774 979 dbSNP
rs1033168197 981 dbSNP
rs1166426235 984 dbSNP
rs957528509 995 dbSNP
rs1361776737 1001 dbSNP
rs1410624452 1022 dbSNP
rs530858793 1031 dbSNP
rs1310265555 1033 dbSNP
rs193153527 1034 dbSNP
rs1409676015 1045 dbSNP
rs1353893910 1046 dbSNP
rs1191402246 1053 dbSNP
rs1414711596 1054 dbSNP
rs1253100585 1058 dbSNP
rs1020750494 1062 dbSNP
rs377450065 1063 dbSNP
rs1260713803 1066 dbSNP
rs1240186938 1068 dbSNP
rs769445498 1069 dbSNP
rs1246324876 1074 dbSNP
rs1301478989 1081 dbSNP
rs528107494 1083 dbSNP
rs371101314 1084 dbSNP
rs1371743567 1087 dbSNP
rs1205363146 1091 dbSNP
rs1382671421 1096 dbSNP
rs976460747 1096 dbSNP
rs922563709 1108 dbSNP
rs1484566600 1115 dbSNP
rs1454093295 1117 dbSNP
rs1346775237 1122 dbSNP
rs1171306013 1123 dbSNP
rs1453427925 1123 dbSNP
rs932581248 1141 dbSNP
rs1194943870 1144 dbSNP
rs985362499 1155 dbSNP
rs370014861 1166 dbSNP
rs909754447 1166 dbSNP
rs1036790776 1167 dbSNP
rs1348859473 1167 dbSNP
rs886056355 1167 dbSNP
rs1305968246 1169 dbSNP
rs896867660 1170 dbSNP
rs1325970199 1172 dbSNP
rs1382731073 1178 dbSNP
rs571321000 1178 dbSNP
rs1363731984 1179 dbSNP
rs1181271111 1180 dbSNP
rs1256752195 1182 dbSNP
rs1425680790 1184 dbSNP
rs1168466588 1185 dbSNP
rs1459993932 1190 dbSNP
rs1372026232 1191 dbSNP
rs1194450449 1192 dbSNP
rs1430810005 1200 dbSNP
rs749255803 1201 dbSNP
rs1437425988 1207 dbSNP
rs1430661455 1210 dbSNP
rs1486229480 1213 dbSNP
rs538854890 1218 dbSNP
rs1282699198 1233 dbSNP
rs1194325563 1234 dbSNP
rs905521973 1235 dbSNP
rs15352 1248 dbSNP
rs1001773700 1252 dbSNP
rs1033223988 1253 dbSNP
rs759788569 1268 dbSNP
rs1465842371 1270 dbSNP
rs1303982107 1275 dbSNP
rs1010329050 1283 dbSNP
rs1020382748 1290 dbSNP
rs1355892117 1295 dbSNP
rs1335730437 1302 dbSNP
rs1063503 1304 dbSNP
rs1389337847 1308 dbSNP
rs551196531 1314 dbSNP
rs867667606 1315 dbSNP
rs149495444 1323 dbSNP
rs1164880630 1327 dbSNP
rs1260077362 1345 dbSNP
rs976174967 1345 dbSNP
rs914377375 1346 dbSNP
rs1179848329 1350 dbSNP
rs1029437962 1351 dbSNP
rs3209936 1357 dbSNP
rs953351844 1365 dbSNP
rs3209940 1367 dbSNP
rs1332821220 1373 dbSNP
rs1276321340 1384 dbSNP
rs985377047 1386 dbSNP
rs909765667 1389 dbSNP
rs1335176210 1393 dbSNP
rs1285740639 1395 dbSNP
rs1236696498 1402 dbSNP
rs1334790056 1418 dbSNP
rs886056356 1419 dbSNP
rs1345531861 1420 dbSNP
rs1448306589 1425 dbSNP
rs1391688425 1430 dbSNP
rs377381751 1437 dbSNP
rs972954833 1440 dbSNP
rs1484208583 1443 dbSNP
rs1157180478 1444 dbSNP
rs1469993083 1452 dbSNP
rs1364569447 1466 dbSNP
rs554866641 1474 dbSNP
rs949866556 1482 dbSNP
rs1252467856 1497 dbSNP
rs1450161562 1499 dbSNP
rs1190813876 1503 dbSNP
rs1468853701 1507 dbSNP
rs1292008040 1509 dbSNP
rs1203132381 1510 dbSNP
rs772325888 1510 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 4144.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065670. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000306434.3 | 3UTR | AUAACUUUUUUUUUUCUUUAUAAGAAAGCCUGAGUACUCCACACUGCACAAUAACUCCUCCCAGGGUUUUAACUUUGUUUUAUUUUCAAAACCAGGUCCAAUGAGCUUUC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000306434.3 | 3UTR | CCUGAGUACUCCACACUGCACAAUAACUCCUCCCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM1065670
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / 4-thiouridine, 3_ML_LG
Location of target site ENST00000306434.3 | 3UTR | UACUCCACACUGCACAAUAACUCCUCCCAGGGUUUU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000306434.3 | 3UTR | UACUCCACACUGCACAAUAACUCCUCCCAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
HNSC 0.211 0.43 0.500 0.33 3 Click to see details
HNSC 0.211 0.43 0.500 0.33 3 Click to see details
HNSC 0.211 0.43 0.500 0.33 3 Click to see details
HNSC 0.211 0.43 0.500 0.33 3 Click to see details
HNSC 0.211 0.43 0.500 0.33 3 Click to see details
HNSC 0.211 0.43 0.500 0.33 3 Click to see details
HNSC 0.211 0.43 0.500 0.33 3 Click to see details
HNSC 0.211 0.43 0.500 0.33 3 Click to see details
HNSC 0.211 0.43 0.500 0.33 3 Click to see details
167 hsa-miR-3192-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT058548 CTTNBP2NL CTTNBP2 N-terminal like 2 2
MIRT139892 BTF3L4 basic transcription factor 3 like 4 2 6
MIRT207395 MAT2A methionine adenosyltransferase 2A 2 6
MIRT294640 ZNF548 zinc finger protein 548 2 2
MIRT324251 GAPVD1 GTPase activating protein and VPS9 domains 1 2 2
MIRT441475 BEST3 bestrophin 3 2 2
MIRT445233 SRGAP2 SLIT-ROBO Rho GTPase activating protein 2 2 2
MIRT446763 ZNF491 zinc finger protein 491 2 2
MIRT451003 EPS15L1 epidermal growth factor receptor pathway substrate 15 like 1 2 2
MIRT452436 QDPR quinoid dihydropteridine reductase 2 2
MIRT452582 ZFP69B ZFP69 zinc finger protein B 2 2
MIRT452950 DISC1 disrupted in schizophrenia 1 2 2
MIRT453309 ZNF394 zinc finger protein 394 2 2
MIRT453810 KBTBD12 kelch repeat and BTB domain containing 12 2 2
MIRT454101 TMEM209 transmembrane protein 209 2 2
MIRT456228 LIX1L limb and CNS expressed 1 like 2 4
MIRT456738 TMEM239 transmembrane protein 239 2 2
MIRT456806 SIGLEC14 sialic acid binding Ig like lectin 14 2 4
MIRT457499 SLC35F6 solute carrier family 35 member F6 2 2
MIRT458037 MRPL12 mitochondrial ribosomal protein L12 2 2
MIRT459041 ZNF490 zinc finger protein 490 2 2
MIRT459135 FADS6 fatty acid desaturase 6 2 2
MIRT460126 CXCL16 C-X-C motif chemokine ligand 16 2 2
MIRT460506 FAM105A family with sequence similarity 105 member A 2 6
MIRT460944 NOA1 nitric oxide associated 1 2 4
MIRT461101 OPA3 OPA3, outer mitochondrial membrane lipid metabolism regulator 2 2
MIRT462641 PHF5A PHD finger protein 5A 2 2
MIRT463584 ZBTB38 zinc finger and BTB domain containing 38 2 2
MIRT466567 TBL1XR1 transducin beta like 1 X-linked receptor 1 2 2
MIRT467090 SRRD SRR1 domain containing 2 2
MIRT471093 PIK3C2B phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta 2 2
MIRT472596 NACC1 nucleus accumbens associated 1 2 2
MIRT473084 MORN4 MORN repeat containing 4 2 2
MIRT475977 GTPBP2 GTP binding protein 2 2 2
MIRT477054 FAM210A family with sequence similarity 210 member A 2 2
MIRT478303 DDX19A DEAD-box helicase 19A 2 4
MIRT478489 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT478500 CYP1B1 cytochrome P450 family 1 subfamily B member 1 2 2
MIRT478858 CRISPLD2 cysteine rich secretory protein LCCL domain containing 2 2 2
MIRT479096 CNNM4 cyclin and CBS domain divalent metal cation transport mediator 4 2 2
MIRT479180 CLSPN claspin 2 2
MIRT479215 CLCC1 chloride channel CLIC like 1 2 2
MIRT481176 AVL9 AVL9 cell migration associated 2 6
MIRT483032 KHSRP KH-type splicing regulatory protein 2 4
MIRT485150 RASL10B RAS like family 10 member B 2 2
MIRT486104 SLC7A5 solute carrier family 7 member 5 2 4
MIRT486319 SIPA1 signal-induced proliferation-associated 1 2 2
MIRT489443 IFNLR1 interferon lambda receptor 1 2 2
MIRT489585 SSBP2 single stranded DNA binding protein 2 2 2
MIRT489702 SCAMP4 secretory carrier membrane protein 4 2 2
MIRT490184 TMEM63C transmembrane protein 63C 2 2
MIRT491211 MLLT1 MLLT1, super elongation complex subunit 2 4
MIRT491276 DHX40 DEAH-box helicase 40 2 2
MIRT495162 CNGA2 cyclic nucleotide gated channel alpha 2 2 4
MIRT495222 DSCR3 DSCR3 arrestin fold containing 2 2
MIRT496820 CHRNB2 cholinergic receptor nicotinic beta 2 subunit 2 2
MIRT498602 KRT8 keratin 8 2 2
MIRT500003 HIST1H2BD histone cluster 1 H2B family member d 2 4
MIRT502065 KRAS KRAS proto-oncogene, GTPase 2 2
MIRT508197 SLC35E1 solute carrier family 35 member E1 2 2
MIRT508477 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT509635 RRP7A ribosomal RNA processing 7 homolog A 2 4
MIRT511039 NRF1 nuclear respiratory factor 1 2 2
MIRT516684 ZNF860 zinc finger protein 860 2 4
MIRT518394 ZNF250 zinc finger protein 250 2 2
MIRT518907 CDC14B cell division cycle 14B 2 2
MIRT520502 TRAM2 translocation associated membrane protein 2 2 6
MIRT521459 RAD51 RAD51 recombinase 2 2
MIRT522354 NCKIPSD NCK interacting protein with SH3 domain 2 4
MIRT522594 MAPK1IP1L mitogen-activated protein kinase 1 interacting protein 1 like 2 2
MIRT523267 HIST1H2AE histone cluster 1 H2A family member e 2 2
MIRT523532 GLUL glutamate-ammonia ligase 2 4
MIRT524186 DFFA DNA fragmentation factor subunit alpha 2 2
MIRT526842 PHC1 polyhomeotic homolog 1 2 2
MIRT528729 FAM26E calcium homeostasis modulator family member 5 2 2
MIRT540695 BMP3 bone morphogenetic protein 3 2 2
MIRT544483 TRIM4 tripartite motif containing 4 2 2
MIRT551566 LETM1 leucine zipper and EF-hand containing transmembrane protein 1 2 2
MIRT563619 ZNF277 zinc finger protein 277 2 2
MIRT564467 SLC35E2 solute carrier family 35 member E2 2 2
MIRT565031 VAV2 vav guanine nucleotide exchange factor 2 2 2
MIRT570294 ARPC3 actin related protein 2/3 complex subunit 3 2 2
MIRT572932 VDAC2 voltage dependent anion channel 2 2 2
MIRT573501 IQSEC3 IQ motif and Sec7 domain 3 2 2
MIRT573675 HES6 hes family bHLH transcription factor 6 2 2
MIRT609619 TRPC4AP transient receptor potential cation channel subfamily C member 4 associated protein 2 2
MIRT611966 PKD1 polycystin 1, transient receptor potential channel interacting 2 2
MIRT613930 HIVEP3 human immunodeficiency virus type I enhancer binding protein 3 2 2
MIRT617733 ATCAY ATCAY, caytaxin 2 4
MIRT618878 MBL2 mannose binding lectin 2 2 2
MIRT627590 SHROOM3 shroom family member 3 2 2
MIRT628516 ZNF878 zinc finger protein 878 2 2
MIRT633964 GRWD1 glutamate rich WD repeat containing 1 2 2
MIRT634530 NEGR1 neuronal growth regulator 1 2 2
MIRT635455 APOLD1 apolipoprotein L domain containing 1 2 2
MIRT636412 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 2
MIRT639672 PPEF2 protein phosphatase with EF-hand domain 2 2 6
MIRT642667 RGS6 regulator of G protein signaling 6 2 2
MIRT644080 A4GALT alpha 1,4-galactosyltransferase (P blood group) 2 2
MIRT647318 RPH3AL rabphilin 3A like (without C2 domains) 2 2
MIRT647942 RNF152 ring finger protein 152 2 2
MIRT648687 AP1M1 adaptor related protein complex 1 mu 1 subunit 2 2
MIRT648817 ZNF689 zinc finger protein 689 2 2
MIRT650347 TREM1 triggering receptor expressed on myeloid cells 1 2 2
MIRT650374 MOCS3 molybdenum cofactor synthesis 3 2 4
MIRT655935 NDUFA4P1 NDUFA4, mitochondrial complex associated pseudogene 1 2 2
MIRT663778 PEX26 peroxisomal biogenesis factor 26 2 2
MIRT664297 HINT1 histidine triad nucleotide binding protein 1 2 2
MIRT665842 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT668929 COL9A2 collagen type IX alpha 2 chain 2 2
MIRT669673 ACAP2 ArfGAP with coiled-coil, ankyrin repeat and PH domains 2 2 2
MIRT669907 KIAA0754 KIAA0754 2 4
MIRT670248 TRIM13 tripartite motif containing 13 2 2
MIRT670368 ULBP3 UL16 binding protein 3 2 4
MIRT670642 BVES blood vessel epicardial substance 2 2
MIRT670749 HOOK3 hook microtubule tethering protein 3 2 2
MIRT671184 ZNF891 zinc finger protein 891 2 2
MIRT673946 ZNF500 zinc finger protein 500 2 2
MIRT674682 PLCE1 phospholipase C epsilon 1 2 2
MIRT677912 HIST1H2BN histone cluster 1 H2B family member n 2 2
MIRT678876 FAM118A family with sequence similarity 118 member A 2 2
MIRT679528 RAB36 RAB36, member RAS oncogene family 2 2
MIRT680589 ZNF573 zinc finger protein 573 2 2
MIRT680650 KIAA1456 KIAA1456 2 2
MIRT681149 INTS7 integrator complex subunit 7 2 2
MIRT681177 IBA57 IBA57 homolog, iron-sulfur cluster assembly 2 2
MIRT681234 DUSP19 dual specificity phosphatase 19 2 2
MIRT681626 F2RL2 coagulation factor II thrombin receptor like 2 2 2
MIRT681643 SCRG1 stimulator of chondrogenesis 1 2 2
MIRT681926 KAT7 lysine acetyltransferase 7 2 2
MIRT682050 MRPS10 mitochondrial ribosomal protein S10 2 2
MIRT682156 SMS spermine synthase 2 2
MIRT683555 HAVCR1 hepatitis A virus cellular receptor 1 2 2
MIRT684304 TRUB2 TruB pseudouridine synthase family member 2 2 2
MIRT684458 MFSD4 major facilitator superfamily domain containing 4A 2 2
MIRT685986 CCDC77 coiled-coil domain containing 77 2 2
MIRT686782 AZF1 azoospermia factor 1 2 2
MIRT687329 OSMR oncostatin M receptor 2 2
MIRT687629 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT688792 CCNB1 cyclin B1 2 2
MIRT689756 PRR13 proline rich 13 2 2
MIRT690823 SGSM2 small G protein signaling modulator 2 2 2
MIRT691310 ZNF681 zinc finger protein 681 2 2
MIRT692676 ZMYM1 zinc finger MYM-type containing 1 2 2
MIRT693508 MOB3A MOB kinase activator 3A 2 2
MIRT694657 C14orf119 chromosome 14 open reading frame 119 2 2
MIRT694889 ZNF417 zinc finger protein 417 2 2
MIRT695740 ZNF117 zinc finger protein 117 2 2
MIRT697101 GPKOW G-patch domain and KOW motifs 2 2
MIRT698968 SPAST spastin 2 2
MIRT700379 RAB33B RAB33B, member RAS oncogene family 2 2
MIRT703930 EPG5 ectopic P-granules autophagy protein 5 homolog 2 2
MIRT706234 SYT15 synaptotagmin 15 2 2
MIRT706494 SEPT6 septin 6 2 2
MIRT710451 BTNL3 butyrophilin like 3 2 2
MIRT711684 ATF7IP activating transcription factor 7 interacting protein 2 2
MIRT711997 F9 coagulation factor IX 2 2
MIRT712727 NCAPG2 non-SMC condensin II complex subunit G2 2 2
MIRT713111 TMBIM4 transmembrane BAX inhibitor motif containing 4 2 2
MIRT713156 YWHAZ tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein zeta 2 2
MIRT713440 AJAP1 adherens junctions associated protein 1 2 2
MIRT713830 NUP98 nucleoporin 98 2 2
MIRT714979 RAB21 RAB21, member RAS oncogene family 2 2
MIRT717411 ZCCHC24 zinc finger CCHC-type containing 24 2 2
MIRT718433 ZNF85 zinc finger protein 85 2 2
MIRT720575 SDHAF2 succinate dehydrogenase complex assembly factor 2 2 2
MIRT725098 TMEM120B transmembrane protein 120B 2 2
miRNA-Drug Associations
miRNA Small Melocule FDA CID Detection Method Condition PMID Year Expression Pattern of miRNA
miR-3192 5-Fluorouracil approved 3385 Microarray CNE cells 22614822 2012 up-regulated
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-3192 Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-3192 Cisplatin 5460033 NSC119875 approved sensitive cell line (BxPC3)
hsa-miR-3192-5p Temozolomide 5394 NSC362856 approved sensitive cell line (U251)
hsa-miR-3192-5p Gefitinib 123631 NSC715055 approved resistant cell line (PC9)
hsa-miR-3192-5p Cisplatin 5460033 NSC119875 approved resistant cell line (A549)
hsa-miR-3192-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-3192-5p Platinum 23939 resistant tissue
hsa-miR-3192-5p Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-3192-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-3192-5p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)

Error report submission