miRTarBase - #MIRT207609


—
pre-miRNA Information
pre-miRNA hsa-mir-8055   
Genomic Coordinates chr8: 6622124 - 6622220
Description Homo sapiens miR-8055 stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-8055
Sequence 65| CUUUGAGCACAUGAGCAGACGGA |87
Evidence Experimental
Experiments Illumina
DRVs in miRNA
Mutant ID Mutant Position Mutant Source
COSN29106641 21 COSMIC
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs1387051240 1 dbSNP
rs773940954 2 dbSNP
rs1007521391 11 dbSNP
rs1425192922 13 dbSNP
rs1168057456 15 dbSNP
rs79123647 20 dbSNP
rs1049046267 21 dbSNP
rs561312343 22 dbSNP
Putative Targets

Gene Information
Gene Symbol COX5B   
Synonyms COXVB
Description cytochrome c oxidase subunit 5B
Transcript NM_001862   
Expression
Putative miRNA Targets on COX5B
3'UTR of COX5B
(miRNA target sites are highlighted)		 
>COX5B|NM_001862|3'UTR
   1 GCACCTGCACTAAATTACTCAAAATGTGCTGTAAAGTTTCTTCTTTCCAGTAAAGACTAGCCATTGCATTGGCTCCTTCT
  81 CCCATAAAAAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' aggcaGACGAG---UACACGAGUUUc 5'
               |||| |   || | |||||| 
Target 5' -gcacCTGCACTAAAT-TACTCAAAa 3'
 1 - 24 125.00 -6.90
2 
miRNA  3' aggcaGACGAGUACACGAGuuuc 5'
               :||  |||  ||||    
Target 5' agccaTTG--CATTGGCTCcttc 3'
 59 - 79 90.00 -8.56
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30512787 32 COSMIC
COSN18726855 44 COSMIC
COSN31579216 61 COSMIC
COSN31554455 62 COSMIC
COSN17183279 66 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs939504809 3 dbSNP
rs778543410 11 dbSNP
rs760690110 16 dbSNP
rs1477762074 22 dbSNP
rs1057075002 25 dbSNP
rs766471212 26 dbSNP
rs1429625285 28 dbSNP
rs1418242447 29 dbSNP
rs754022256 31 dbSNP
rs755197811 32 dbSNP
rs554383588 34 dbSNP
rs758356267 37 dbSNP
rs1186097225 41 dbSNP
rs777790795 44 dbSNP
rs41280591 46 dbSNP
rs746961641 48 dbSNP
rs770522619 51 dbSNP
rs1400523517 52 dbSNP
rs1243328062 63 dbSNP
rs895310606 69 dbSNP
rs1337530686 77 dbSNP
rs1482117983 77 dbSNP
rs947827198 95 dbSNP
rs1253007503 97 dbSNP
rs968153392 102 dbSNP
rs79231961 109 dbSNP
rs1297027164 110 dbSNP
rs1226241038 111 dbSNP
rs1342589523 112 dbSNP
rs887459224 114 dbSNP
rs539657113 117 dbSNP
rs1004477477 141 dbSNP
rs188976865 165 dbSNP
rs1014803013 171 dbSNP
rs1400428735 176 dbSNP
rs576687741 186 dbSNP
rs756790743 200 dbSNP
rs1370449011 204 dbSNP
rs867952512 205 dbSNP
rs1252042673 207 dbSNP
rs1385485903 208 dbSNP
rs879388478 216 dbSNP
rs541789777 229 dbSNP
rs1183137120 234 dbSNP
rs1029271409 237 dbSNP
rs765809544 238 dbSNP
rs1272342117 243 dbSNP
rs985964937 245 dbSNP
rs1022347553 246 dbSNP
rs555378905 263 dbSNP
rs1429336835 267 dbSNP
rs1338903827 272 dbSNP
rs1166297989 273 dbSNP
rs978045217 273 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' aggcaGACGAG---UACACGAGUUUc 5'
               |||| |   || | |||||| 
Target 5' --cacCUGCACUAAAU-UACUCAAAa 3'
 		1 - 23
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000258424.2 | 3UTR | CACCUGCACUAAAUUACUCAAAAUGUGCUGUAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
192 hsa-miR-8055 Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT104178 PHTF2 putative homeodomain transcription factor 2 2 6
MIRT109489 KLHL15 kelch like family member 15 2 2
MIRT138601 HIF1A hypoxia inducible factor 1 alpha subunit 2 2
MIRT207609 COX5B cytochrome c oxidase subunit 5B 2 2
MIRT246311 HIST2H2AA3 histone cluster 2 H2A family member a3 2 4
MIRT246323 HIST2H2AA4 histone cluster 2 H2A family member a4 2 4
MIRT267508 FEN1 flap structure-specific endonuclease 1 2 2
MIRT271002 FLVCR1 feline leukemia virus subgroup C cellular receptor 1 2 2
MIRT378038 SMAD5 SMAD family member 5 2 4
MIRT442382 CLVS2 clavesin 2 2 2
MIRT443996 METRN meteorin, glial cell differentiation regulator 2 4
MIRT444222 TMEM136 transmembrane protein 136 2 2
MIRT445870 ALG14 ALG14, UDP-N-acetylglucosaminyltransferase subunit 2 2
MIRT463214 ZNF131 zinc finger protein 131 2 2
MIRT464523 UBXN2B UBX domain protein 2B 2 2
MIRT471509 PCGF3 polycomb group ring finger 3 2 6
MIRT474035 LONRF1 LON peptidase N-terminal domain and ring finger 1 2 2
MIRT481566 ARIH2 ariadne RBR E3 ubiquitin protein ligase 2 2 2
MIRT485415 LZIC leucine zipper and CTNNBIP1 domain containing 2 8
MIRT485724 CALM2 calmodulin 2 2 2
MIRT500745 TNRC6A trinucleotide repeat containing 6A 2 2
MIRT502790 CELSR3 cadherin EGF LAG seven-pass G-type receptor 3 2 6
MIRT503164 AGO2 argonaute 2, RISC catalytic component 2 4
MIRT504842 HAUS3 HAUS augmin like complex subunit 3 2 6
MIRT506559 MNX1 motor neuron and pancreas homeobox 1 2 4
MIRT511372 IKZF3 IKAROS family zinc finger 3 2 6
MIRT522117 NUDT3 nudix hydrolase 3 2 4
MIRT523755 FBXO27 F-box protein 27 2 4
MIRT525160 PGPEP1 pyroglutamyl-peptidase I 2 4
MIRT537294 FZD5 frizzled class receptor 5 2 2
MIRT537493 FAM168B family with sequence similarity 168 member B 2 2
MIRT538375 CRIM1 cysteine rich transmembrane BMP regulator 1 2 2
MIRT539394 ADO 2-aminoethanethiol dioxygenase 2 2
MIRT544124 PPIL1 peptidylprolyl isomerase like 1 2 2
MIRT547269 NUFIP2 NUFIP2, FMR1 interacting protein 2 2 2
MIRT548034 GOLIM4 golgi integral membrane protein 4 2 2
MIRT551641 CCDC127 coiled-coil domain containing 127 2 2
MIRT552585 ZCCHC9 zinc finger CCHC-type containing 9 2 2
MIRT552605 ZBTB8A zinc finger and BTB domain containing 8A 2 2
MIRT554174 SLC35E2B solute carrier family 35 member E2B 2 2
MIRT556914 IRF2BP2 interferon regulatory factor 2 binding protein 2 2 2
MIRT564288 MED26 mediator complex subunit 26 2 2
MIRT571375 TTPAL alpha tocopherol transfer protein like 2 4
MIRT572009 HIC2 HIC ZBTB transcriptional repressor 2 2 2
MIRT572339 CKAP2L cytoskeleton associated protein 2 like 2 4
MIRT572612 CNTLN centlein 2 2
MIRT572779 ZNF277 zinc finger protein 277 2 2
MIRT573258 DCAF10 DDB1 and CUL4 associated factor 10 2 2
MIRT573353 PDE3A phosphodiesterase 3A 2 4
MIRT573362 MAP2K6 mitogen-activated protein kinase kinase 6 2 2
MIRT574194 LMNB1 lamin B1 2 2
MIRT574453 RPS16 ribosomal protein S16 2 2
MIRT574849 C12orf73 chromosome 12 open reading frame 73 2 2
MIRT575356 Zxda zinc finger, X-linked, duplicated A 2 3
MIRT612192 CCDC77 coiled-coil domain containing 77 2 2
MIRT612974 GGCX gamma-glutamyl carboxylase 2 2
MIRT613749 UNKL unkempt family like zinc finger 2 2
MIRT614085 PDE4C phosphodiesterase 4C 2 2
MIRT614405 ADAT1 adenosine deaminase, tRNA specific 1 2 2
MIRT614441 WDR92 WD repeat domain 92 2 2
MIRT614518 SUB1 SUB1 homolog, transcriptional regulator 2 2
MIRT614653 NIPAL3 NIPA like domain containing 3 2 2
MIRT614720 TEAD3 TEA domain transcription factor 3 2 2
MIRT615556 SAR1A secretion associated Ras related GTPase 1A 2 2
MIRT616636 LRAT lecithin retinol acyltransferase 2 4
MIRT617210 CERS4 ceramide synthase 4 2 2
MIRT618934 SF3A3 splicing factor 3a subunit 3 2 2
MIRT619995 C1orf64 steroid receptor associated and regulated protein 2 2
MIRT620819 MKI67IP nucleolar protein interacting with the FHA domain of MKI67 1 1
MIRT621254 PDZD2 PDZ domain containing 2 2 2
MIRT622307 SETD5 SET domain containing 5 2 2
MIRT623324 MAN1C1 mannosidase alpha class 1C member 1 2 2
MIRT625066 ACSM2A acyl-CoA synthetase medium chain family member 2A 2 2
MIRT625443 RANGAP1 Ran GTPase activating protein 1 2 2
MIRT626182 SRFBP1 serum response factor binding protein 1 2 2
MIRT626701 TRIM65 tripartite motif containing 65 2 2
MIRT628925 TBRG4 transforming growth factor beta regulator 4 2 2
MIRT630883 SLC25A33 solute carrier family 25 member 33 2 2
MIRT631653 BRI3BP BRI3 binding protein 2 2
MIRT631696 C1QTNF6 C1q and TNF related 6 2 2
MIRT632864 GSPT1 G1 to S phase transition 1 2 2
MIRT635185 NFKBID NFKB inhibitor delta 2 2
MIRT636917 ZNF845 zinc finger protein 845 2 2
MIRT637048 RAB27A RAB27A, member RAS oncogene family 2 2
MIRT637599 ZNF554 zinc finger protein 554 2 2
MIRT638204 SPTLC2 serine palmitoyltransferase long chain base subunit 2 2 2
MIRT638839 CPE carboxypeptidase E 2 2
MIRT639005 ACO1 aconitase 1 2 2
MIRT640894 AMD1 adenosylmethionine decarboxylase 1 2 2
MIRT641402 SCN2B sodium voltage-gated channel beta subunit 2 2 2
MIRT642083 FBXL2 F-box and leucine rich repeat protein 2 2 2
MIRT643179 HYPK huntingtin interacting protein K 2 2
MIRT644205 CBS cystathionine-beta-synthase 2 2
MIRT645453 ANKS6 ankyrin repeat and sterile alpha motif domain containing 6 2 2
MIRT645797 OMA1 OMA1 zinc metallopeptidase 2 2
MIRT645960 TTF2 transcription termination factor 2 2 2
MIRT646334 CLIC6 chloride intracellular channel 6 2 2
MIRT646484 APBB3 amyloid beta precursor protein binding family B member 3 2 2
MIRT646611 SMOC2 SPARC related modular calcium binding 2 2 2
MIRT649392 SH2D4A SH2 domain containing 4A 2 2
MIRT650540 MSANTD2 Myb/SANT DNA binding domain containing 2 2 2
MIRT650679 CD82 CD82 molecule 2 2
MIRT652118 TRPM7 transient receptor potential cation channel subfamily M member 7 2 2
MIRT652588 TIMM8A translocase of inner mitochondrial membrane 8A 2 2
MIRT654807 PPT1 palmitoyl-protein thioesterase 1 2 2
MIRT655318 PCYOX1 prenylcysteine oxidase 1 2 2
MIRT655411 PAN2 PAN2 poly(A) specific ribonuclease subunit 2 2
MIRT659671 CD86 CD86 molecule 2 2
MIRT660190 BMPR1A bone morphogenetic protein receptor type 1A 2 2
MIRT660883 ADCYAP1R1 ADCYAP receptor type I 2 2
MIRT661695 MTO1 mitochondrial tRNA translation optimization 1 2 2
MIRT661765 BIVM basic, immunoglobulin-like variable motif containing 2 2
MIRT662787 TBC1D25 TBC1 domain family member 25 2 2
MIRT663733 ZNF285 zinc finger protein 285 2 2
MIRT663787 DDX53 DEAD-box helicase 53 2 2
MIRT664663 IMPA2 inositol monophosphatase 2 2 2
MIRT665702 TMX4 thioredoxin related transmembrane protein 4 2 2
MIRT667444 MAPK14 mitogen-activated protein kinase 14 2 2
MIRT667946 HMGCS1 3-hydroxy-3-methylglutaryl-CoA synthase 1 2 2
MIRT668776 DAAM1 dishevelled associated activator of morphogenesis 1 2 4
MIRT669824 ISCA2 iron-sulfur cluster assembly 2 2 2
MIRT670398 ZXDA zinc finger, X-linked, duplicated A 2 3
MIRT670402 ELP2 elongator acetyltransferase complex subunit 2 2 2
MIRT671112 ZNF573 zinc finger protein 573 2 2
MIRT671129 CD226 CD226 molecule 2 2
MIRT671145 ANKRD9 ankyrin repeat domain 9 2 2
MIRT671315 ACTR1A ARP1 actin related protein 1 homolog A 2 2
MIRT671329 FAM71F2 family with sequence similarity 71 member F2 2 2
MIRT671857 ZNF429 zinc finger protein 429 2 2
MIRT672009 PXMP4 peroxisomal membrane protein 4 2 2
MIRT672054 KIAA0930 KIAA0930 2 2
MIRT672466 RTTN rotatin 2 2
MIRT672642 SLC25A16 solute carrier family 25 member 16 2 4
MIRT672660 GTF2H5 general transcription factor IIH subunit 5 2 2
MIRT672755 UBE2V2 ubiquitin conjugating enzyme E2 V2 2 2
MIRT672839 ICOSLG inducible T-cell costimulator ligand 2 2
MIRT672917 LRRC2 leucine rich repeat containing 2 2 2
MIRT672983 KBTBD6 kelch repeat and BTB domain containing 6 2 2
MIRT673051 AGO3 argonaute 3, RISC catalytic component 2 2
MIRT673078 AK1 adenylate kinase 1 2 2
MIRT673143 C1orf50 chromosome 1 open reading frame 50 2 2
MIRT673303 UBE2G2 ubiquitin conjugating enzyme E2 G2 2 2
MIRT673319 THAP1 THAP domain containing 1 2 2
MIRT673339 SLC35F6 solute carrier family 35 member F6 2 2
MIRT673554 PLA2G16 phospholipase A2 group XVI 2 2
MIRT673656 ZNF440 zinc finger protein 440 2 2
MIRT673693 SGK494 uncharacterized serine/threonine-protein kinase SgK494 2 2
MIRT673720 EMCN endomucin 2 2
MIRT673840 CALCOCO2 calcium binding and coiled-coil domain 2 2 2
MIRT673869 KLF2 Kruppel like factor 2 2 2
MIRT673888 DCTN6 dynactin subunit 6 2 2
MIRT674180 PLEKHM3 pleckstrin homology domain containing M3 2 2
MIRT674579 SLC35B4 solute carrier family 35 member B4 2 2
MIRT674604 RBBP4 RB binding protein 4, chromatin remodeling factor 2 2
MIRT674737 SLC16A1 solute carrier family 16 member 1 2 2
MIRT674824 ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 motif 4 2 2
MIRT674993 STRN3 striatin 3 2 2
MIRT675058 FGD6 FYVE, RhoGEF and PH domain containing 6 2 2
MIRT675072 CCR6 C-C motif chemokine receptor 6 2 2
MIRT675116 FSD2 fibronectin type III and SPRY domain containing 2 2 2
MIRT675158 YARS2 tyrosyl-tRNA synthetase 2 2 2
MIRT675254 LPP LIM domain containing preferred translocation partner in lipoma 2 2
MIRT675434 LEAP2 liver enriched antimicrobial peptide 2 2 2
MIRT675687 PIWIL1 piwi like RNA-mediated gene silencing 1 2 2
MIRT675772 YIPF4 Yip1 domain family member 4 2 2
MIRT675883 SNAP29 synaptosome associated protein 29 2 2
MIRT677923 SLC35E1 solute carrier family 35 member E1 2 2
MIRT678991 MBD1 methyl-CpG binding domain protein 1 2 2
MIRT679010 MTMR10 myotubularin related protein 10 2 2
MIRT679024 ZNF419 zinc finger protein 419 2 2
MIRT679392 IL10RB interleukin 10 receptor subunit beta 2 2
MIRT679407 GMCL1 germ cell-less, spermatogenesis associated 1 2 2
MIRT683745 C3orf36 chromosome 3 open reading frame 36 2 2
MIRT689266 ZNF99 zinc finger protein 99 2 2
MIRT690502 MDM2 MDM2 proto-oncogene 2 2
MIRT700939 PDP2 pyruvate dehyrogenase phosphatase catalytic subunit 2 2 2
MIRT702073 PCDHB11 protocadherin beta 11 2 2
MIRT705020 CALU calumenin 2 2
MIRT706196 ACOT9 acyl-CoA thioesterase 9 2 2
MIRT706253 MKLN1 muskelin 1 2 2
MIRT706540 GJD2 gap junction protein delta 2 2 2
MIRT707358 ORAI2 ORAI calcium release-activated calcium modulator 2 2 2
MIRT707407 RRP7A ribosomal RNA processing 7 homolog A 2 2
MIRT710638 GLUL glutamate-ammonia ligase 2 2
MIRT714213 C10orf71 chromosome 10 open reading frame 71 2 2
MIRT715646 USP6NL USP6 N-terminal like 2 2
MIRT717751 KCNRG potassium channel regulator 2 2
MIRT720793 GCH1 GTP cyclohydrolase 1 2 2
MIRT722254 POLQ DNA polymerase theta 2 2
MIRT723765 MPLKIP M-phase specific PLK1 interacting protein 2 2
MIRT724965 TNS1 tensin 1 2 2
MIRT736568 TP53INP1 tumor protein p53 inducible nuclear protein 1 3 0
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-miR-8055 Cisplatin 5460033 NSC119875 approved sensitive cell line (CP20)

Error report submission