miRTarBase - #MIRT215729


—
pre-miRNA Information
pre-miRNA hsa-mir-4433a   
Genomic Coordinates chr2: 64340759 - 64340839
Description Homo sapiens miR-4433a stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-4433a-3p
Sequence 51| ACAGGAGUGGGGGUGGGACAU |71
Evidence Experimental
Experiments Illumina
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs751480515 9 dbSNP
rs557760377 15 dbSNP
rs1479580865 20 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol C5orf51   
Synonyms -
Description chromosome 5 open reading frame 51
Transcript NM_175921   
Expression
Putative miRNA Targets on C5orf51
3'UTR of C5orf51
(miRNA target sites are highlighted)		 
>C5orf51|NM_175921|3'UTR
   1 TAAGTTCATCTAGTCCTTTTCAAATAGAAAAACAACAAAACCCATGAAATGGAAAAGAGAGTTCCAAAAAAGAAGACCTG
  81 TTGATACTGAATATGAGAACATTACACTGCATAAAGATATCCAGCTTGGGTACCCTACTAAAACAACATCACCATCTTTT
 161 TCATTATATATTAGTAAACCTATGAAGGGATGATTCTTTAATTTCTAAAGTGTTGTTCAAACTCACCTTAAAATACAGAT
 241 GTTATGTCACTAATAATGAGTAGTAACCCAATTTAGCTTTACAAAGATTTTTTCTATTACTTTTTTTTTTTATTGTGGTA
 321 TATGTAACACAAGTTTACCATTTTTATCATCTTTAGATTATTTTTAAATCTCACTACCTTGAAGTTTGCCATGCTTCAGA
 401 AATTAAAGTCAAGTTACTTCACTGCTTTGAATACATACTATGGATATAAATGTAGGCAAAATGAAAGATTATGACTAATA
 481 TTCAGATTCCATTTTCAATAAGGTAAATAATGAAAGATCTCACAAAGGAATCATTGTGTTTAATTATTTTGCCATGTATT
 561 ACTAATTGTATTTAAAATTTCTACTTCCCTTAGGCATTTTATAAAAATTTAAAAATTATTTTTCTATTTTGTTTAAAAGA
 641 CAATGCATGGCTTTTCAAGTGAGTAATGAAGATAAAAACCAAGCTAGGTTAGTCTACCATTAGTTCATATGTTTTTGTAG
 721 CACATCTTTTCATAACATACTGAAATTTTAATGTTTTTTGCCTTTAATAATAGGGGTGAGTGTTAAAGGCCAGAGAGCCT
 801 AACTTGATATCTTGCTCATGGTCTTTCTGTCTACCTCAACTCCTGTTGTCATCTTTGGATGATCTTTCTGATACCTTGCT
 881 GATACCTTGGACTTCTGCCCAGTGACTTTATTACATTCCAGCAGCTTACTCCCGTGGCCGCACTTTGAATGTCACCACCT
 961 TGAGTTTCTCTTTCTGGTAAAATTTCAGTAACTGATAACTGCCCTCTTTTCAGTTTTTTCACTTCCTTATTTTATTGACT
1041 TTTCTCTCCTTTATGCTCATTCCACATTCTTCAGTTCCTTCTTACCCCCTTTTCTTGACTGCTCCCCTTCCTCCTAAACT
1121 GTCAGCCCCTTTCAGGCTTTCTTCCCTATCCACCCTCAGCTTTATGGGATACTATATGAACTAATCTCACCAGTTATTCT
1201 TCTTTCCCTGGTCTTTTAGTCTAGTCCTTTGGCAAGCCCTCAACCTCAGATTAATCCTATTTATTATCTACCTTTTCGGG
1281 GATGCTGAGTTCTTTGTGATGGGTAGTCCTTCAAAGTAGAATCACTACAAGTGTCTCACTTCAGCCTTAGAAAAGCCCTC
1361 AATGTAAACCTTATGTTTGTTACTAGGGTGGCCTCTCTCCCATTTCCCGCTGTGGCTGAGCCAAACTTCATTACTTTCCT
1441 TAGGCCCTCTGCCCCTCCCCTAGCATATGGCTCTTTCTCCTATTGAACAGAAAATTGAGACTATGAAGAGGTCAACTTGT
1521 ATTTACCAACTTTACTCATTTTCCCATTTTAGAGGAAAAGAGGTTGCCTGCTTCCTATCAAAGGCGACTCTGTGCTACAT
1601 GTTGGTTTCATCTTCGCTGTCTCTCTCATTTCCCCACAAAGTGTTGTCTCACTTTCTGCCTACCTTTTAGGTATTGATCT
1681 TCACTATATTTTTTTCTCTCTCTCTCTTTTTTTTTTTTACTTTACATATTTTATACAATGTCATTCATAACTATGGCTTC
1761 TTTTACCACCTGTAATAACAGACTGAGTCTCAAACCTGTAACTTGTATCCTGACTTATCTCTTGCTTTCTAAACCTTGTT
1841 TCTAACTGTCTATCAAATATCTTCATTAGACATCCCACAGTAATTTTAAGCTCAGTGTTTCCAAACGTCAAGTCCTCATC
1921 TGTTATATAAAATCCTTTCTGCTTTGTAAGTTTTCTCTTTTTGGGATTTTCCGCAGATCAGGGCAACACAGAATGACTAC
2001 CTTCCCAGCCATGTCTCTGCAGTCATCCTGTGTAATCATGTTCTAGTCCAGTGTTGCTCAAACAGTTAAAATCCAGGCTG
2081 CTTTTGGTAAACATACAAATTCTGATATAGAGCCTCTGTGGCAAAGGGAATTTCTCAGTTCCTGCCCCAGCCCCCTTGTT
2161 TATCATTACACAGCTAAGATTTTTATTTAACTTAGCATTTTAGCAAGTTTTCTTATGAAAATACCTTTGTGCTTTCTAAG
2241 TATAAAGATTTAAATTATTTTTAATACGGTTTTTAGAACCACAGACTATCCCTCTTTTTAGAGCATCCTGATCAATTGCA
2321 AGTACTTCCACTTCTTCCCTAAATGCGCTTTGTGTGTTTTCCACCTCAGTAGCCTTGCACACATCATTACTTCTGCATCC
2401 TTCTTTGTGACCAAGTGAATACCTACCTACCTCTTAGGACTCAGCTTCAGTGATTCTGTTTTCATAGGCTTTTTAAAGCC
2481 CTTTTCAGTCAAATTAGATGCTCCTTTGTTCTGGTCCTTTACTCTTCCCCTCCCATGTTGTCGCACTGATCACACTGCTT
2561 TGTAATTATTTTCTTTATTGTTGGTAAACTCCATATTTTAAAAATTTACCTGTATACATAGTGCTTAATGCATGGTAGGC
2641 CCTTAGTAATGTTTTTGAATTAATGAGGCATGATTCTAAATGCCAAACTTTGCACAAAAAGTTGTTGCTATTGGATTCCA
2721 AACTGCTATGCCCTCTATACCAGTGGCTGACAAGGCATATAGGGATATATGCCATCCTGAGAGGAGTAAAGTGTTTAGAT
2801 TCTGAACCTGAGAAAAGAGAACTTTCTCTTAAGAAGTTGGAAACTTCATTTTACCTTCGTGACCCTGGTAGACCACTTGG
2881 TCTCACTGGTTGGTACAATTATGAGGGTAGTACTGGGTGCTTTTTATACAACTTTCCATCCCCCACACAGTTGGAGAATA
2961 ATTTGTAGACCATGGCAGTTAAAATGCTTTTTACTCTGGTGTATTATAGAATAATGAACACATTTTTATATATGTTAAAG
3041 CCTGCTAAATCATTCACTTAGAATGAAGTAACCTCAAGGTACCAAATACCCCACATAAGGAAAGTACTACACTAAATTCA
3121 CTCAACTATTGTATGCCTACCATATGCCAGATTTTATCCTAGACCCTGAGGATATAGCTTTTTAAAACCCCCTCCTGTTT
3201 CAGAGCTTATATTCTAGTGGAGGAAGTTAGACAAGCATTTTAAGTAATAAATGTATAGAGAGTGTCAAGTGATGAGTACC
3281 ATGAAGAAGAATAAATGAGGGTAAGGGGCTAGTGTGATAGGGAGAGGGGTGGGATGCCATCATATTTAGGGGTGGTTGGG
3361 AACTGTCTACTGCTTTAGCATTTGTGTCTTCAAATTTCTCTCCTTTGGTTATATACCTTGCGTATTCCGCACATTGATAA
3441 AGTTTCTTTCTTACAGAAGTTCTGATATTGAATTAAGGAATGGGTCACTACTTAAGACTTTATCATTTCAGCTACACATA
3521 AAAGGTTTCTCTCCCCTATGGATTTTGCTAATGGTTGAGTGATACCTAAAGGCCTTGTTGCATTTTTTACACTTGGGGTT
3601 TCTCTTCGGTTTGAATTCTCTCATGGTTACCAAAACTCTGTTAAAGGACTTTTCACAGTCGTTAAATGTGTATGGCTCTT
3681 TCCCAATATGAATTTTTTTGATGTTAACTAGGCTTTTAGACTTAGTTAAAGACCTGTGTGCTCTGCTGCATTTATAGGGT
3761 TTTGGGCTGCTGAGAATAATTGATGCTGATTAAGGTGCAAATCATGACTAAAGACTTTTCTTTCTTCTTTTGCATATAGT
3841 AGAGTGAGGTGAGGGTCGTGGCTAAAACCCCACAATAACTTTACATTCCTAGCTTTACAGTCTTGCTGTGAATTCTCTGG
3921 TGTTCATTAAAGTGTGAGCTGTGTTAAAAGGCATTCTTAGATTCATTTTAACCACATTTTTAAAAACTCACAGTTGGTTA
4001 ACATGATGGTTTCAGATTGCTTGCCTCTTTTCTCTTTCTACCTTACAGGGCTCCTTTTCTAGCTTAAATAAGGGTACTCC
4081 ATCTGCCACAGAATCCAGGATTCTATAGTTTTTTAGTTTCACTTCCCTATGTTCTTTTTTTTTTTTTAATTTTTAACAAT
4161 GAGATGATACCATGTTACAGCGGTATTACATTAAGATACATTTAATATAGCCACAATTAAAGTATGTATTATGTATTTAT
4241 GCTGGTGTTCTTTCATGTTATTTCTTCTAGTGAAAATTTCCAAGTAAACTGTTATTGAGCATATACATTTTTAAAAAAAT
4321 AAAACCATACACCCCTAAAAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uaCAGGGUGGGGGUGAGGACa 5'
            || |:|||:| ||||||| 
Target 5' ctGT-CTACCTCAACTCCTGt 3'
 827 - 846 166.00 -24.30
2 
miRNA  3' uacaGGGUGGGGGUGAGGACa 5'
              | ||:| ::|||:||| 
Target 5' tgcaCACATCATTACTTCTGc 3'
 2376 - 2396 141.00 -16.20
3 
miRNA  3' uacaggGUGGGG-GUGAGGACa 5'
                :|||::  |||:||| 
Target 5' tgctgaTACCTTGGACTTCTGc 3'
 877 - 898 131.00 -12.60
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30502564 29 COSMIC
COSN31492177 32 COSMIC
COSN30170495 60 COSMIC
COSN30112691 158 COSMIC
COSN6297555 240 COSMIC
COSN7942186 246 COSMIC
COSN6297556 260 COSMIC
COSN20101174 304 COSMIC
COSN27375163 312 COSMIC
COSN1316175 464 COSMIC
COSN21550992 652 COSMIC
COSN31583257 736 COSMIC
COSN26585245 761 COSMIC
COSN9951271 802 COSMIC
COSN25749291 808 COSMIC
COSN31480339 838 COSMIC
COSN28690022 920 COSMIC
COSN16156050 1058 COSMIC
COSN5605674 1174 COSMIC
COSN2106492 2320 COSMIC
COSN25349471 2336 COSMIC
COSN21735292 2471 COSMIC
COSN15151011 2877 COSMIC
COSN14945680 3429 COSMIC
COSN18723456 3683 COSMIC
COSN31552421 3735 COSMIC
COSN18723457 3872 COSMIC
COSN30161466 3911 COSMIC
COSN31524491 3994 COSMIC
COSN21375984 4016 COSMIC
COSN4849976 4111 COSMIC
COSN18723588 4148 COSMIC
COSN16566127 4150 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1186711533 1 dbSNP
rs746926407 8 dbSNP
rs757148532 11 dbSNP
rs1236398277 13 dbSNP
rs1465898424 15 dbSNP
rs1483343727 16 dbSNP
rs1183267370 17 dbSNP
rs374722484 22 dbSNP
rs745924482 24 dbSNP
rs770042531 26 dbSNP
rs1414916617 33 dbSNP
rs1468717451 37 dbSNP
rs989450204 43 dbSNP
rs775570594 49 dbSNP
rs749715864 50 dbSNP
rs768911100 52 dbSNP
rs1276996759 54 dbSNP
rs1368697423 67 dbSNP
rs950210919 69 dbSNP
rs1267081831 78 dbSNP
rs1012617759 81 dbSNP
rs1015919871 87 dbSNP
rs1044550185 110 dbSNP
rs1296623939 114 dbSNP
rs1437577580 117 dbSNP
rs963165952 121 dbSNP
rs1325310324 128 dbSNP
rs993647650 130 dbSNP
rs1397397039 134 dbSNP
rs1277050939 139 dbSNP
rs1461829208 148 dbSNP
rs1373970982 167 dbSNP
rs1331381281 168 dbSNP
rs145499229 169 dbSNP
rs927033041 170 dbSNP
rs1250680974 171 dbSNP
rs1192480320 190 dbSNP
rs1468526850 199 dbSNP
rs954662642 200 dbSNP
rs930379257 206 dbSNP
rs780140105 216 dbSNP
rs1480241279 227 dbSNP
rs111784175 236 dbSNP
rs1463691333 245 dbSNP
rs1346015224 246 dbSNP
rs1215729949 249 dbSNP
rs886094699 251 dbSNP
rs72746996 252 dbSNP
rs1478202905 256 dbSNP
rs776016005 258 dbSNP
rs111486286 262 dbSNP
rs1397782278 276 dbSNP
rs975422350 286 dbSNP
rs1422971849 288 dbSNP
rs539312466 295 dbSNP
rs545770917 298 dbSNP
rs1387216034 301 dbSNP
rs1454374275 301 dbSNP
rs201732963 301 dbSNP
rs200220094 303 dbSNP
rs1028779657 304 dbSNP
rs11405992 304 dbSNP
rs34573251 305 dbSNP
rs75553974 305 dbSNP
rs889900786 308 dbSNP
rs1484567269 312 dbSNP
rs375491494 313 dbSNP
rs1350847892 321 dbSNP
rs1000673912 322 dbSNP
rs548610582 322 dbSNP
rs1033038177 323 dbSNP
rs529880530 331 dbSNP
rs977868451 333 dbSNP
rs763382482 338 dbSNP
rs988800319 347 dbSNP
rs142594823 355 dbSNP
rs575898205 362 dbSNP
rs1352831574 367 dbSNP
rs1336883859 371 dbSNP
rs542617961 372 dbSNP
rs1287828451 377 dbSNP
rs1413393771 379 dbSNP
rs938821511 380 dbSNP
rs1313818789 384 dbSNP
rs971602259 392 dbSNP
rs1403820233 399 dbSNP
rs894753183 405 dbSNP
rs1469173662 411 dbSNP
rs1412705916 413 dbSNP
rs1184221852 422 dbSNP
rs554564083 435 dbSNP
rs796984207 439 dbSNP
rs183730203 441 dbSNP
rs1188337324 444 dbSNP
rs1282351741 451 dbSNP
rs1452038070 453 dbSNP
rs1220519247 454 dbSNP
rs1266749200 456 dbSNP
rs927439706 467 dbSNP
rs930441261 469 dbSNP
rs984931986 476 dbSNP
rs1351486728 484 dbSNP
rs1270617070 490 dbSNP
rs540359754 499 dbSNP
rs1182765294 501 dbSNP
rs907586621 512 dbSNP
rs940355366 517 dbSNP
rs1294296224 519 dbSNP
rs1039976411 528 dbSNP
rs993264768 533 dbSNP
rs1164691666 546 dbSNP
rs188522126 553 dbSNP
rs1388696692 563 dbSNP
rs901805654 567 dbSNP
rs931890769 582 dbSNP
rs890196782 584 dbSNP
rs1416986261 590 dbSNP
rs1050249688 591 dbSNP
rs903678021 592 dbSNP
rs1372741437 593 dbSNP
rs1000680739 596 dbSNP
rs1240645402 607 dbSNP
rs1033524019 610 dbSNP
rs891845205 613 dbSNP
rs772703053 616 dbSNP
rs150984820 618 dbSNP
rs1024310509 644 dbSNP
rs1211825077 648 dbSNP
rs1247084311 663 dbSNP
rs989322510 670 dbSNP
rs773968790 688 dbSNP
rs1268102419 697 dbSNP
rs1285050240 699 dbSNP
rs1365420141 704 dbSNP
rs1021582376 708 dbSNP
rs969098979 709 dbSNP
rs977547043 716 dbSNP
rs1165390279 725 dbSNP
rs1406915408 726 dbSNP
rs1417099266 732 dbSNP
rs980338017 733 dbSNP
rs1167067032 736 dbSNP
rs1226774137 754 dbSNP
rs1450332007 755 dbSNP
rs765986783 771 dbSNP
rs1343959212 775 dbSNP
rs1468090642 778 dbSNP
rs938761503 781 dbSNP
rs952333892 790 dbSNP
rs1205800051 796 dbSNP
rs1338581831 798 dbSNP
rs1436524923 798 dbSNP
rs1272777558 803 dbSNP
rs993035353 808 dbSNP
rs916075912 810 dbSNP
rs984940874 818 dbSNP
rs761700931 830 dbSNP
rs1250968479 833 dbSNP
rs1231527238 834 dbSNP
rs1369569830 835 dbSNP
rs948959487 836 dbSNP
rs1435637785 838 dbSNP
rs1327953688 841 dbSNP
rs1188982039 866 dbSNP
rs1430152592 868 dbSNP
rs1392334811 884 dbSNP
rs530832135 884 dbSNP
rs193234223 891 dbSNP
rs1453921217 896 dbSNP
rs940448101 905 dbSNP
rs868621401 913 dbSNP
rs898850504 914 dbSNP
rs928990903 915 dbSNP
rs922926985 920 dbSNP
rs745483396 925 dbSNP
rs931923129 926 dbSNP
rs1484237771 933 dbSNP
rs1050322416 934 dbSNP
rs753521167 935 dbSNP
rs925195204 940 dbSNP
rs1392418420 941 dbSNP
rs370149155 951 dbSNP
rs1301368275 964 dbSNP
rs936509889 965 dbSNP
rs1052236358 974 dbSNP
rs184097064 980 dbSNP
rs1410253746 987 dbSNP
rs1010313978 991 dbSNP
rs1045792918 993 dbSNP
rs1397912441 1020 dbSNP
rs1434366987 1020 dbSNP
rs1178338067 1022 dbSNP
rs530017190 1028 dbSNP
rs754754080 1036 dbSNP
rs1334954949 1044 dbSNP
rs966640832 1047 dbSNP
rs1001515724 1049 dbSNP
rs1446100983 1052 dbSNP
rs1473804529 1053 dbSNP
rs10077481 1057 dbSNP
rs1344116780 1059 dbSNP
rs1187598830 1061 dbSNP
rs960145575 1066 dbSNP
rs186632009 1068 dbSNP
rs1006837940 1077 dbSNP
rs1273877065 1083 dbSNP
rs1211703403 1089 dbSNP
rs1337340137 1090 dbSNP
rs1267485440 1103 dbSNP
rs1228957052 1115 dbSNP
rs1352218313 1116 dbSNP
rs73750418 1119 dbSNP
rs916087084 1127 dbSNP
rs970192864 1128 dbSNP
rs1278746204 1129 dbSNP
rs1441266565 1133 dbSNP
rs1181436231 1136 dbSNP
rs1249504243 1151 dbSNP
rs141112563 1158 dbSNP
rs571811401 1175 dbSNP
rs975785362 1178 dbSNP
rs72746997 1198 dbSNP
rs777917475 1203 dbSNP
rs1401603498 1204 dbSNP
rs1484662362 1208 dbSNP
rs911527356 1209 dbSNP
rs985726722 1212 dbSNP
rs925194227 1214 dbSNP
rs1322881555 1224 dbSNP
rs1243874676 1225 dbSNP
rs1322066685 1227 dbSNP
rs1315163121 1228 dbSNP
rs1380767361 1233 dbSNP
rs936599788 1237 dbSNP
rs552611608 1245 dbSNP
rs913723963 1260 dbSNP
rs1435606136 1268 dbSNP
rs1038734661 1271 dbSNP
rs1437350565 1278 dbSNP
rs191318582 1279 dbSNP
rs1393004269 1280 dbSNP
rs766484930 1281 dbSNP
rs754347834 1282 dbSNP
rs1370589516 1304 dbSNP
rs183814334 1307 dbSNP
rs1235328498 1308 dbSNP
rs1275308300 1315 dbSNP
rs1055794623 1325 dbSNP
rs888059167 1326 dbSNP
rs868001784 1328 dbSNP
rs146780256 1337 dbSNP
rs902467961 1341 dbSNP
rs1269687265 1343 dbSNP
rs765801344 1351 dbSNP
rs1251103485 1355 dbSNP
rs999442254 1356 dbSNP
rs1015530171 1358 dbSNP
rs962254596 1359 dbSNP
rs531835112 1363 dbSNP
rs1030045985 1364 dbSNP
rs953093928 1370 dbSNP
rs1465086194 1382 dbSNP
rs1207668381 1385 dbSNP
rs959992924 1387 dbSNP
rs985800278 1389 dbSNP
rs1014368564 1393 dbSNP
rs1023028904 1395 dbSNP
rs924965121 1403 dbSNP
rs781520124 1406 dbSNP
rs796903214 1407 dbSNP
rs188633883 1409 dbSNP
rs140481152 1410 dbSNP
rs1461781629 1416 dbSNP
rs192837417 1423 dbSNP
rs1168803999 1426 dbSNP
rs1389402510 1439 dbSNP
rs558580565 1440 dbSNP
rs1197500982 1441 dbSNP
rs577276776 1446 dbSNP
rs981899866 1461 dbSNP
rs928741407 1466 dbSNP
rs937399313 1467 dbSNP
rs944346541 1468 dbSNP
rs544040879 1483 dbSNP
rs1279983372 1484 dbSNP
rs1482589165 1496 dbSNP
rs371452554 1500 dbSNP
rs562724707 1502 dbSNP
rs1388295638 1508 dbSNP
rs1301947599 1520 dbSNP
rs574624843 1522 dbSNP
rs74899984 1528 dbSNP
rs1043987246 1530 dbSNP
rs1351461034 1531 dbSNP
rs1310183960 1534 dbSNP
rs1431284117 1544 dbSNP
rs10064380 1547 dbSNP
rs898047937 1548 dbSNP
rs997643323 1553 dbSNP
rs775721896 1557 dbSNP
rs527331111 1578 dbSNP
rs999854156 1582 dbSNP
rs1466100437 1586 dbSNP
rs1379342013 1587 dbSNP
rs1179546261 1590 dbSNP
rs1056362421 1592 dbSNP
rs1252315223 1600 dbSNP
rs895834775 1601 dbSNP
rs1484823756 1614 dbSNP
rs1030455028 1616 dbSNP
rs888900495 1617 dbSNP
rs1007298643 1622 dbSNP
rs1259532248 1631 dbSNP
rs1258570287 1634 dbSNP
rs749727751 1636 dbSNP
rs150406740 1637 dbSNP
rs1228339928 1645 dbSNP
rs1032448573 1647 dbSNP
rs1489709771 1657 dbSNP
rs957747445 1663 dbSNP
rs994895783 1664 dbSNP
rs1028240610 1672 dbSNP
rs988185761 1674 dbSNP
rs1184914373 1676 dbSNP
rs185189840 1677 dbSNP
rs368324121 1687 dbSNP
rs966249420 1689 dbSNP
rs1157267471 1690 dbSNP
rs1412553202 1695 dbSNP
rs1456648730 1695 dbSNP
rs570643526 1695 dbSNP
rs981973528 1697 dbSNP
rs1237156796 1703 dbSNP
rs1459296647 1705 dbSNP
rs1444291370 1707 dbSNP
rs1491155537 1707 dbSNP
rs879598468 1707 dbSNP
rs926429019 1707 dbSNP
rs1491324503 1708 dbSNP
rs77124193 1709 dbSNP
rs1231886764 1711 dbSNP
rs991606161 1715 dbSNP
rs1285102603 1716 dbSNP
rs1309714391 1720 dbSNP
rs1350636062 1721 dbSNP
rs909259006 1723 dbSNP
rs1408682371 1724 dbSNP
rs531453293 1725 dbSNP
rs1323121897 1726 dbSNP
rs769136747 1727 dbSNP
rs1265255953 1729 dbSNP
rs1357653110 1734 dbSNP
rs1207933276 1740 dbSNP
rs942050019 1742 dbSNP
rs1036733073 1743 dbSNP
rs1322420531 1747 dbSNP
rs1253145335 1749 dbSNP
rs979167063 1750 dbSNP
rs923791257 1754 dbSNP
rs1473899799 1758 dbSNP
rs898121682 1764 dbSNP
rs1188071299 1766 dbSNP
rs935150844 1772 dbSNP
rs371746891 1774 dbSNP
rs1212392885 1776 dbSNP
rs1051911287 1784 dbSNP
rs896442370 1788 dbSNP
rs138187114 1806 dbSNP
rs1167601212 1814 dbSNP
rs114813533 1819 dbSNP
rs1422501942 1821 dbSNP
rs1170485276 1825 dbSNP
rs1227078142 1827 dbSNP
rs1365259020 1828 dbSNP
rs1371052945 1836 dbSNP
rs1440897629 1842 dbSNP
rs905821128 1842 dbSNP
rs1295968536 1851 dbSNP
rs1032107430 1852 dbSNP
rs1380657440 1856 dbSNP
rs867792043 1861 dbSNP
rs373893875 1896 dbSNP
rs548037605 1898 dbSNP
rs760138734 1907 dbSNP
rs149588740 1908 dbSNP
rs886508855 1909 dbSNP
rs970659449 1912 dbSNP
rs1477997884 1915 dbSNP
rs982006059 1918 dbSNP
rs1019068707 1922 dbSNP
rs966301875 1926 dbSNP
rs190170767 1927 dbSNP
rs959204956 1928 dbSNP
rs1028619509 1930 dbSNP
rs1276159075 1943 dbSNP
rs1216913924 1950 dbSNP
rs776212661 1962 dbSNP
rs1275364659 1963 dbSNP
rs566479746 1973 dbSNP
rs182354310 1974 dbSNP
rs1276037095 1977 dbSNP
rs979607233 1979 dbSNP
rs1174123756 1982 dbSNP
rs1202993062 1988 dbSNP
rs923744224 2003 dbSNP
rs963791858 2005 dbSNP
rs972125070 2008 dbSNP
rs759119498 2026 dbSNP
rs935058768 2034 dbSNP
rs1471871066 2037 dbSNP
rs765010084 2038 dbSNP
rs1183265740 2040 dbSNP
rs1483187741 2048 dbSNP
rs879331207 2050 dbSNP
rs566825832 2061 dbSNP
rs1278652606 2068 dbSNP
rs1220904093 2070 dbSNP
rs933599727 2073 dbSNP
rs1051987559 2074 dbSNP
rs910777488 2085 dbSNP
rs1483586402 2088 dbSNP
rs1287503282 2094 dbSNP
rs1181557432 2096 dbSNP
rs533891754 2097 dbSNP
rs1301283118 2104 dbSNP
rs1442585863 2107 dbSNP
rs558542471 2109 dbSNP
rs1359844551 2111 dbSNP
rs947952671 2124 dbSNP
rs577237335 2131 dbSNP
rs1054326758 2142 dbSNP
rs1411801570 2144 dbSNP
rs1160449032 2150 dbSNP
rs1190245343 2151 dbSNP
rs538364696 2152 dbSNP
rs752424041 2153 dbSNP
rs1473774527 2154 dbSNP
rs1252279723 2162 dbSNP
rs1179778499 2167 dbSNP
rs1237553418 2168 dbSNP
rs1204952641 2170 dbSNP
rs1463531956 2189 dbSNP
rs1044978444 2198 dbSNP
rs538806569 2203 dbSNP
rs1009716587 2209 dbSNP
rs758260201 2216 dbSNP
rs1310258883 2222 dbSNP
rs1227995177 2226 dbSNP
rs556070248 2230 dbSNP
rs1168146143 2232 dbSNP
rs1360397888 2250 dbSNP
rs1003180199 2251 dbSNP
rs1432977144 2259 dbSNP
rs143338737 2268 dbSNP
rs1321775649 2269 dbSNP
rs1335748647 2277 dbSNP
rs1459200757 2284 dbSNP
rs959511968 2289 dbSNP
rs764088756 2291 dbSNP
rs1164437526 2297 dbSNP
rs886565313 2306 dbSNP
rs751575622 2308 dbSNP
rs1414050084 2315 dbSNP
rs1436769561 2317 dbSNP
rs542142492 2319 dbSNP
rs901980802 2322 dbSNP
rs757359312 2326 dbSNP
rs1209298029 2327 dbSNP
rs1486786338 2333 dbSNP
rs560443959 2335 dbSNP
rs1220487689 2336 dbSNP
rs1322617755 2345 dbSNP
rs115030569 2347 dbSNP
rs963524213 2348 dbSNP
rs1364519290 2349 dbSNP
rs1000562769 2353 dbSNP
rs972105220 2362 dbSNP
rs746035382 2366 dbSNP
rs1389131740 2375 dbSNP
rs1293367484 2379 dbSNP
rs1312918004 2381 dbSNP
rs1031075119 2382 dbSNP
rs919313074 2384 dbSNP
rs1350148478 2387 dbSNP
rs796368270 2391 dbSNP
rs545783269 2402 dbSNP
rs1427363903 2409 dbSNP
rs1389049975 2412 dbSNP
rs1188573370 2415 dbSNP
rs991866718 2423 dbSNP
rs954726699 2426 dbSNP
rs987391835 2427 dbSNP
rs1294285937 2434 dbSNP
rs1203307886 2454 dbSNP
rs1341639587 2458 dbSNP
rs186465491 2465 dbSNP
rs1329925056 2468 dbSNP
rs1301147749 2483 dbSNP
rs1248415345 2492 dbSNP
rs1387754254 2510 dbSNP
rs370446715 2521 dbSNP
rs531289156 2526 dbSNP
rs931219969 2530 dbSNP
rs1049095509 2532 dbSNP
rs1053983125 2535 dbSNP
rs1168746258 2539 dbSNP
rs10051536 2543 dbSNP
rs562934111 2544 dbSNP
rs1433653466 2552 dbSNP
rs1270784022 2554 dbSNP
rs1458497182 2565 dbSNP
rs1179674684 2569 dbSNP
rs1042179950 2574 dbSNP
rs1482884333 2577 dbSNP
rs906244080 2578 dbSNP
rs1197668089 2587 dbSNP
rs1342926634 2604 dbSNP
rs902034833 2614 dbSNP
rs1234638895 2619 dbSNP
rs1003219238 2636 dbSNP
rs1286866799 2640 dbSNP
rs1409589485 2644 dbSNP
rs1320746319 2650 dbSNP
rs1054787836 2660 dbSNP
rs143298436 2668 dbSNP
rs548382767 2671 dbSNP
rs1399464289 2675 dbSNP
rs1301709575 2682 dbSNP
rs1470266378 2692 dbSNP
rs1431334545 2696 dbSNP
rs1005863482 2708 dbSNP
rs1156765906 2711 dbSNP
rs1472123892 2717 dbSNP
rs1413034082 2722 dbSNP
rs749586495 2729 dbSNP
rs1201055029 2731 dbSNP
rs904147125 2731 dbSNP
rs147543931 2732 dbSNP
rs1266778169 2734 dbSNP
rs1281488521 2735 dbSNP
rs1228210514 2736 dbSNP
rs533735899 2738 dbSNP
rs1281588981 2741 dbSNP
rs1229254752 2745 dbSNP
rs1240782156 2756 dbSNP
rs1026357389 2758 dbSNP
rs1332995372 2761 dbSNP
rs1452720340 2773 dbSNP
rs1408260765 2784 dbSNP
rs769040894 2787 dbSNP
rs987465319 2792 dbSNP
rs1385438099 2801 dbSNP
rs1160013800 2804 dbSNP
rs1471942961 2818 dbSNP
rs1368107142 2820 dbSNP
rs779344250 2821 dbSNP
rs1446491553 2823 dbSNP
rs1246780445 2824 dbSNP
rs748668982 2827 dbSNP
rs1286788748 2829 dbSNP
rs1208416849 2830 dbSNP
rs965020972 2835 dbSNP
rs1353901732 2849 dbSNP
rs534243102 2849 dbSNP
rs1283204771 2853 dbSNP
rs990154283 2855 dbSNP
rs1384388226 2856 dbSNP
rs140215964 2859 dbSNP
rs933730821 2860 dbSNP
rs1426614179 2864 dbSNP
rs1473279696 2869 dbSNP
rs1390342759 2870 dbSNP
rs980638985 2881 dbSNP
rs1426734200 2888 dbSNP
rs919747088 2898 dbSNP
rs945531197 2902 dbSNP
rs1187932578 2910 dbSNP
rs1476035921 2911 dbSNP
rs1406752836 2921 dbSNP
rs371324328 2928 dbSNP
rs978221832 2929 dbSNP
rs952668177 2932 dbSNP
rs1290971970 2946 dbSNP
rs1167377352 2947 dbSNP
rs1361065010 2949 dbSNP
rs1271871395 2955 dbSNP
rs927733412 2964 dbSNP
rs939081096 2971 dbSNP
rs1397852273 2976 dbSNP
rs907889616 2991 dbSNP
rs1054819333 2995 dbSNP
rs1404883342 2995 dbSNP
rs894789498 2997 dbSNP
rs941007827 2998 dbSNP
rs1330325504 3005 dbSNP
rs1301774831 3015 dbSNP
rs1406998524 3019 dbSNP
rs1368886479 3029 dbSNP
rs1168113212 3031 dbSNP
rs1038710561 3034 dbSNP
rs1422333289 3045 dbSNP
rs897029441 3072 dbSNP
rs1410506828 3096 dbSNP
rs1477964053 3108 dbSNP
rs1270053980 3111 dbSNP
rs1201966136 3113 dbSNP
rs1279229421 3117 dbSNP
rs1490754127 3121 dbSNP
rs1249161925 3129 dbSNP
rs558126038 3140 dbSNP
rs1307545586 3142 dbSNP
rs1274443442 3143 dbSNP
rs976044011 3146 dbSNP
rs1344136620 3149 dbSNP
rs1283702452 3152 dbSNP
rs1225103546 3160 dbSNP
rs570860389 3162 dbSNP
rs1348907156 3167 dbSNP
rs993967786 3168 dbSNP
rs1221738865 3172 dbSNP
rs1443139625 3176 dbSNP
rs1356381948 3191 dbSNP
rs1266680139 3193 dbSNP
rs1050744041 3218 dbSNP
rs1414412068 3219 dbSNP
rs1430588877 3224 dbSNP
rs1179120372 3225 dbSNP
rs1471798540 3227 dbSNP
rs1483774071 3235 dbSNP
rs1181878164 3236 dbSNP
rs1231767092 3252 dbSNP
rs886795421 3254 dbSNP
rs1234120792 3256 dbSNP
rs1207347817 3257 dbSNP
rs1183169448 3261 dbSNP
rs932067411 3265 dbSNP
rs1263645905 3269 dbSNP
rs1225166025 3276 dbSNP
rs10473254 3277 dbSNP
rs903978362 3278 dbSNP
rs890577031 3288 dbSNP
rs1372913847 3298 dbSNP
rs1282554702 3305 dbSNP
rs1332791518 3309 dbSNP
rs1313399549 3318 dbSNP
rs1008926201 3322 dbSNP
rs1339242285 3325 dbSNP
rs1328311983 3327 dbSNP
rs1456070795 3328 dbSNP
rs1017661569 3339 dbSNP
rs1160208031 3340 dbSNP
rs1333988777 3342 dbSNP
rs556664663 3351 dbSNP
rs376772461 3352 dbSNP
rs1053085095 3353 dbSNP
rs1179676395 3355 dbSNP
rs117302792 3365 dbSNP
rs1013279979 3370 dbSNP
rs989458193 3373 dbSNP
rs554026255 3379 dbSNP
rs4957435 3390 dbSNP
rs966944629 3394 dbSNP
rs1026821681 3412 dbSNP
rs779479911 3415 dbSNP
rs1319020501 3416 dbSNP
rs952631096 3422 dbSNP
rs928098914 3423 dbSNP
rs1271682279 3425 dbSNP
rs1015958320 3429 dbSNP
rs939112136 3430 dbSNP
rs1433534342 3440 dbSNP
rs976096091 3447 dbSNP
rs923268952 3455 dbSNP
rs990988402 3465 dbSNP
rs1444446111 3472 dbSNP
rs546151512 3475 dbSNP
rs986595155 3476 dbSNP
rs925485696 3482 dbSNP
rs1162283092 3486 dbSNP
rs936863837 3488 dbSNP
rs11558733 3500 dbSNP
rs1392360445 3502 dbSNP
rs916307387 3507 dbSNP
rs188089195 3510 dbSNP
rs759147542 3519 dbSNP
rs941025512 3523 dbSNP
rs892761962 3532 dbSNP
rs949607768 3537 dbSNP
rs142680333 3539 dbSNP
rs1486714195 3548 dbSNP
rs375698375 3554 dbSNP
rs769311638 3559 dbSNP
rs904820909 3566 dbSNP
rs1360360873 3568 dbSNP
rs1416237856 3574 dbSNP
rs1226258324 3577 dbSNP
rs1307492579 3578 dbSNP
rs150722016 3581 dbSNP
rs1365966340 3583 dbSNP
rs367610536 3583 dbSNP
rs546433306 3583 dbSNP
rs1450663162 3586 dbSNP
rs888191817 3589 dbSNP
rs1403964134 3591 dbSNP
rs1312683399 3593 dbSNP
rs1004478374 3594 dbSNP
rs1367006094 3598 dbSNP
rs139068128 3599 dbSNP
rs965301169 3604 dbSNP
rs1269504072 3608 dbSNP
rs1265010178 3609 dbSNP
rs541990001 3610 dbSNP
rs1198351813 3611 dbSNP
rs976596848 3615 dbSNP
rs1030304634 3619 dbSNP
rs953349161 3625 dbSNP
rs1480360953 3632 dbSNP
rs1251921435 3633 dbSNP
rs1050916805 3635 dbSNP
rs1263424350 3647 dbSNP
rs1310897293 3650 dbSNP
rs890973805 3654 dbSNP
rs1224499950 3655 dbSNP
rs180940149 3662 dbSNP
rs1389276231 3664 dbSNP
rs1250307033 3668 dbSNP
rs576471179 3671 dbSNP
rs185559671 3673 dbSNP
rs1015182939 3675 dbSNP
rs566730777 3682 dbSNP
rs1463478075 3683 dbSNP
rs1375847679 3687 dbSNP
rs534233911 3689 dbSNP
rs1175525549 3693 dbSNP
rs1480624288 3693 dbSNP
rs1011360346 3696 dbSNP
rs555866976 3701 dbSNP
rs1022293449 3703 dbSNP
rs1251350509 3705 dbSNP
rs1479078529 3714 dbSNP
rs1177278164 3717 dbSNP
rs779766092 3722 dbSNP
rs949619303 3723 dbSNP
rs966975734 3724 dbSNP
rs1046660430 3726 dbSNP
rs1326133830 3727 dbSNP
rs1286809386 3729 dbSNP
rs926290740 3732 dbSNP
rs1334750287 3734 dbSNP
rs937704420 3740 dbSNP
rs1048043613 3741 dbSNP
rs1403870726 3743 dbSNP
rs1317605139 3744 dbSNP
rs1335978107 3756 dbSNP
rs116227515 3768 dbSNP
rs751481056 3770 dbSNP
rs1156532031 3782 dbSNP
rs1003961189 3784 dbSNP
rs1036835571 3788 dbSNP
rs960882279 3791 dbSNP
rs900987876 3796 dbSNP
rs990963005 3798 dbSNP
rs1283402100 3799 dbSNP
rs916322449 3806 dbSNP
rs1322142471 3807 dbSNP
rs1462997544 3813 dbSNP
rs1266644724 3816 dbSNP
rs1204908491 3825 dbSNP
rs570754410 3831 dbSNP
rs1260916042 3838 dbSNP
rs974183269 3839 dbSNP
rs1240623644 3845 dbSNP
rs918232286 3850 dbSNP
rs1313651364 3852 dbSNP
rs1269624167 3854 dbSNP
rs1384889538 3855 dbSNP
rs761846806 3859 dbSNP
rs1050986220 3862 dbSNP
rs1204899838 3869 dbSNP
rs879870696 3870 dbSNP
rs912441452 3874 dbSNP
rs574544898 3875 dbSNP
rs1039532379 3883 dbSNP
rs531685298 3901 dbSNP
rs1384694931 3903 dbSNP
rs1164235344 3907 dbSNP
rs1008010597 3908 dbSNP
rs1246723121 3919 dbSNP
rs1268283834 3921 dbSNP
rs1032336772 3935 dbSNP
rs116834399 3937 dbSNP
rs1264244364 3957 dbSNP
rs778917166 3959 dbSNP
rs1044145475 3965 dbSNP
rs902528220 3974 dbSNP
rs780100924 3982 dbSNP
rs1361549081 3983 dbSNP
rs1268319865 4003 dbSNP
rs970857408 4004 dbSNP
rs1035272375 4010 dbSNP
rs1157803653 4024 dbSNP
rs1403355147 4025 dbSNP
rs1209728303 4026 dbSNP
rs1365178731 4036 dbSNP
rs568535896 4039 dbSNP
rs1164373332 4040 dbSNP
rs982264563 4048 dbSNP
rs190176501 4051 dbSNP
rs1418052817 4052 dbSNP
rs1167868822 4054 dbSNP
rs1382460229 4062 dbSNP
rs926888111 4067 dbSNP
rs1197694637 4071 dbSNP
rs938275529 4072 dbSNP
rs1267695452 4074 dbSNP
rs1048572465 4083 dbSNP
rs1490702653 4087 dbSNP
rs1270221696 4099 dbSNP
rs909518180 4101 dbSNP
rs1406713296 4108 dbSNP
rs960913079 4109 dbSNP
rs1271777900 4110 dbSNP
rs1253872472 4111 dbSNP
rs1221463837 4123 dbSNP
rs1012861340 4129 dbSNP
rs1303678220 4131 dbSNP
rs1303962264 4135 dbSNP
rs1483987994 4135 dbSNP
rs202119670 4135 dbSNP
rs1344394886 4148 dbSNP
rs879003940 4148 dbSNP
rs1402519629 4149 dbSNP
rs1328196198 4165 dbSNP
rs1036708430 4169 dbSNP
rs78514399 4170 dbSNP
rs1317170467 4177 dbSNP
rs1174775428 4180 dbSNP
rs1237833915 4182 dbSNP
rs997996741 4183 dbSNP
rs1199731800 4184 dbSNP
rs747880353 4189 dbSNP
rs962797606 4199 dbSNP
rs1230695505 4201 dbSNP
rs1203194620 4204 dbSNP
rs973865376 4206 dbSNP
rs918314242 4207 dbSNP
rs1274995242 4209 dbSNP
rs10472358 4216 dbSNP
rs1322583032 4219 dbSNP
rs1283642230 4230 dbSNP
rs183123958 4236 dbSNP
rs912515310 4239 dbSNP
rs557983373 4244 dbSNP
rs1251271744 4245 dbSNP
rs541673121 4246 dbSNP
rs1442977872 4248 dbSNP
rs1335343256 4259 dbSNP
rs1356837596 4259 dbSNP
rs914398483 4269 dbSNP
rs1032759517 4278 dbSNP
rs1179838349 4288 dbSNP
rs560352651 4292 dbSNP
rs1415879673 4295 dbSNP
rs543369998 4296 dbSNP
rs1405341168 4302 dbSNP
rs1009669138 4304 dbSNP
rs1470182937 4306 dbSNP
rs1239421541 4308 dbSNP
rs1043851172 4313 dbSNP
rs10472359 4314 dbSNP
rs982317171 4318 dbSNP
rs371855024 4335 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545212. RNA binding protein: AGO1. Condition:Control PAR-CLIP data was present in GSM545213. RNA binding protein: AGO2. Condition:Control PAR-CLIP data was present in GSM545214. RNA binding protein: AGO3. Condition:Control PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection PAR-CLIP data was present in GSM545217. RNA binding protein: AGO2. Condition:miR-7 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 285636.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM714644. RNA binding protein: AGO2. Condition:completeT1 "PAR-CLIP data was present in GSM714645. RNA binding protein: AGO2. Condition:completeT1 ...

- Kishore S; Jaskiewicz L; Burger L; Hausser et al., 2011, Nature methods.

Article - Kishore S; Jaskiewicz L; Burger L; Hausser et al.
- Nature methods, 2011
Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.
LinkOut: [PMID: 21572407]
Experimental Support 3 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Disease 285636.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in GSM1065667. RNA binding protein: AGO1. Condition:4-thiouridine "PAR-CLIP data was present in GSM1065669. RNA binding protein: AGO1. Condition:4-thiouridine ...

- Memczak S; Jens M; Elefsinioti A; Torti F; et al., 2013, Nature.

Article - Memczak S; Jens M; Elefsinioti A; Torti F; et al.
- Nature, 2013
Circular RNAs (circRNAs) in animals are an enigmatic class of RNA with unknown function. To explore circRNAs systematically, we sequenced and computationally analysed human, mouse and nematode RNA. We detected thousands of well-expressed, stable circRNAs, often showing tissue/developmental-stage-specific expression. Sequence analysis indicated important regulatory functions for circRNAs. We found that a human circRNA, antisense to the cerebellar degeneration-related protein 1 transcript (CDR1as), is densely bound by microRNA (miRNA) effector complexes and harbours 63 conserved binding sites for the ancient miRNA miR-7. Further analyses indicated that CDR1as functions to bind miR-7 in neuronal tissues. Human CDR1as expression in zebrafish impaired midbrain development, similar to knocking down miR-7, suggesting that CDR1as is a miRNA antagonist with a miRNA-binding capacity ten times higher than any other known transcript. Together, our data provide evidence that circRNAs form a large class of post-transcriptional regulators. Numerous circRNAs form by head-to-tail splicing of exons, suggesting previously unrecognized regulatory potential of coding sequences.
LinkOut: [PMID: 23446348]
Experimental Support 4 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions TZM-bl
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM1462574. RNA binding protein: AGO2. Condition:TZM-bl ami BaL ...

- Whisnant AW; Bogerd HP; Flores O; Ho P; et al., 2013, mBio.

Article - Whisnant AW; Bogerd HP; Flores O; Ho P; et al.
- mBio, 2013
UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.
LinkOut: [PMID: 23592263]
Experimental Support 5 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions MCF7
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRR1045082. RNA binding protein: AGO2. Condition:Untreated ...

- Farazi TA; Ten Hoeve JJ; Brown M; et al., 2014, Genome biology.

Article - Farazi TA; Ten Hoeve JJ; Brown M; et al.
- Genome biology, 2014
BACKGROUND: Various microRNAs (miRNAs) are up- or downregulated in tumors. However, the repression of cognate miRNA targets responsible for the phenotypic effects of this dysregulation in patients remains largely unexplored. To define miRNA targets and associated pathways, together with their relationship to outcome in breast cancer, we integrated patient-paired miRNA-mRNA expression data with a set of validated miRNA targets and pathway inference. RESULTS: To generate a biochemically-validated set of miRNA-binding sites, we performed argonaute-2 photoactivatable-ribonucleoside-enhanced crosslinking and immunoprecipitation (AGO2-PAR-CLIP) in MCF7 cells. We then defined putative miRNA-target interactions using a computational model, which ranked and selected additional TargetScan-predicted interactions based on features of our AGO2-PAR-CLIP binding-site data. We subselected modeled interactions according to the abundance of their constituent miRNA and mRNA transcripts in tumors, and we took advantage of the variability of miRNA expression within molecular subtypes to detect miRNA repression. Interestingly, our data suggest that miRNA families control subtype-specific pathways; for example, miR-17, miR-19a, miR-25, and miR-200b show high miRNA regulatory activity in the triple-negative, basal-like subtype, whereas miR-22 and miR-24 do so in the HER2 subtype. An independent dataset validated our findings for miR-17 and miR-25, and showed a correlation between the expression levels of miR-182 targets and overall patient survival. Pathway analysis associated miR-17, miR-19a, and miR-200b with leukocyte transendothelial migration. CONCLUSIONS: We combined PAR-CLIP data with patient expression data to predict regulatory miRNAs, revealing potential therapeutic targets and prognostic markers in breast cancer.
LinkOut: [PMID: 24398324]
Experimental Support 6 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HCT116
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in ERX177602. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_4 PAR-CLIP data was present in ERX177604. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_2_6 PAR-CLIP data was present in ERX177600. RNA binding protein: AGO2. Condition:p53_V_Ago_CLIP_2_2 PAR-CLIP data was present in ERX177612. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_2 PAR-CLIP data was present in ERX177622. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_12 PAR-CLIP data was present in ERX177624. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_4_2 PAR-CLIP data was present in ERX177626. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_4 PAR-CLIP data was present in ERX177634. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_12 PAR-CLIP data was present in ERX177599. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_1 PAR-CLIP data was present in ERX177603. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_2_5 PAR-CLIP data was present in ERX177606. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_8 PAR-CLIP data was present in ERX177610. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_2_12 PAR-CLIP data was present in ERX177611. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_1 PAR-CLIP data was present in ERX177614. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_4 PAR-CLIP data was present in ERX177615. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_3_5 PAR-CLIP data was present in ERX177616. RNA binding protein: AGO2. Condition:p53_V_AGO_CLIP_3_6 PAR-CLIP data was present in ERX177618. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_3_8 PAR-CLIP data was present in ERX177623. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_1 PAR-CLIP data was present in ERX177627. RNA binding protein: AGO2. Condition:p53_D_AGO_CLIP_4_5 PAR-CLIP data was present in ERX177629. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_4_7 PAR-CLIP data was present in ERX177630. RNA binding protein: AGO2. Condition:KO_V_AGO_CLIP_4_8 PAR-CLIP data was present in ERX177605. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_2_7 PAR-CLIP data was present in ERX177617. RNA binding protein: AGO2. Condition:KO_D_AGO_CLIP_3_7 ...

- Krell J; Stebbing J; Carissimi C; Dabrowska et al., 2016, Genome research.

Article - Krell J; Stebbing J; Carissimi C; Dabrowska et al.
- Genome research, 2016
DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.
LinkOut: [PMID: 26701625]
Experimental Support 7 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions Prostate Tissue
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in SRX1760632. RNA binding protein: AGO2. Condition:AGO-CLIP-22RV1_C ...

- Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al., 2016, Neoplasia (New York, N.Y.).

Article - Hamilton MP; Rajapakshe KI; Bader DA; Cerne et al.
- Neoplasia (New York, N.Y.), 2016
MicroRNA (miRNA) deregulation in prostate cancer (PCa) contributes to PCa initiation and metastatic progression. To comprehensively define the cancer-associated changes in miRNA targeting and function in commonly studied models of PCa, we performed photoactivatable ribonucleoside-enhanced cross-linking immunoprecipitation of the Argonaute protein in a panel of PCa cell lines modeling different stages of PCa progression. Using this comprehensive catalogue of miRNA targets, we analyzed miRNA targeting on known drivers of PCa and examined tissue-specific and stage-specific pathway targeting by miRNAs. We found that androgen receptor is the most frequently targeted PCa oncogene and that miR-148a targets the largest number of known PCa drivers. Globally, tissue-specific and stage-specific changes in miRNA targeting are driven by homeostatic response to active oncogenic pathways. Our findings indicate that, even in advanced PCa, the miRNA pool adapts to regulate continuing alterations in the cancer genome to balance oncogenic molecular changes. These findings are important because they are the first to globally characterize miRNA changes in PCa and demonstrate how the miRNA target spectrum responds to staged tumorigenesis.
LinkOut: [PMID: 27292025]
CLIP-seq Support 1 for dataset GSM545212
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / Control
Location of target site ENST00000381647.2 | 3UTR | UCUUUCUGUCUACCUCAACUCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset GSM545213
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / Control
Location of target site ENST00000381647.2 | 3UTR | UCUUUCUGUCUACCUCAACUCC
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 3 for dataset GSM545214
Method / RBP PAR-CLIP / AGO3
Cell line / Condition HEK293 / Control
Location of target site ENST00000381647.2 | 3UTR | UCUUUCUGUCUACCUCAACU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 4 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000381647.2 | 3UTR | UCUUUCUGUCUACCUCAACUCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 5 for dataset GSM545217
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-7 transfection
Location of target site ENST00000381647.2 | 3UTR | UCUUUCUGUCUACCUCAACUCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 6 for dataset GSM714644
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repA
Location of target site ENST00000381647.2 | 3UTR | CUCAUGGUCUUUCUGUCUACCUCAACUCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 7 for dataset GSM714645
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / completeT1, repB
Location of target site ENST00000381647.2 | 3UTR | CUUUCUGUCUACCUCAACUCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 21572407 / GSE28865
CLIP-seq Viewer Link
CLIP-seq Support 8 for dataset GSM1065667
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_6
Location of target site ENST00000381647.2 | 3UTR | UCUUUCUGUCUACCUCAACUCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 9 for dataset GSM1065669
Method / RBP PAR-CLIP / AGO1
Cell line / Condition HEK293 / 4-thiouridine, ML_MM_8
Location of target site ENST00000381647.2 | 3UTR | UCUUUCUGUCUACCUCAACUCCU
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23446348 / GSE43573
CLIP-seq Viewer Link
CLIP-seq Support 10 for dataset SRR1045082
Method / RBP PAR-CLIP / AGO2
Cell line / Condition MCF7 / Untreated
Location of target site ENST00000381647.2 | 3UTR | UCUUUCUGUCUACCUCAACUCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 24398324 / SRX388831
CLIP-seq Viewer Link
CLIP-seq Support 11 for dataset GSM1462574
Method / RBP PAR-CLIP / AGO2
Cell line / Condition TZM-bl / TZM-bl ami BaL
Location of target site ENST00000381647.2 | 3UTR | AUAUCUUGCUCAUGGUCUUUCUGUCUACCUCAACUCCUG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 23592263 / GSE59944
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
256 hsa-miR-4433a-3p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT088097 SEPT2 septin 2 2 2
MIRT143134 MGRN1 mahogunin ring finger 1 2 2
MIRT153912 NCOA3 nuclear receptor coactivator 3 2 2
MIRT154894 GNAS GNAS complex locus 2 4
MIRT200996 ZNF805 zinc finger protein 805 2 2
MIRT215729 C5ORF51 chromosome 5 open reading frame 51 2 10
MIRT235593 POFUT1 protein O-fucosyltransferase 1 2 2
MIRT263250 SGPL1 sphingosine-1-phosphate lyase 1 2 2
MIRT317951 CDC5L cell division cycle 5 like 2 4
MIRT325572 HIATL1 major facilitator superfamily domain containing 14B 2 4
MIRT354739 LSM3 LSM3 homolog, U6 small nuclear RNA and mRNA degradation associated 2 2
MIRT444552 UBE2D3 ubiquitin conjugating enzyme E2 D3 2 4
MIRT446978 SUSD5 sushi domain containing 5 2 2
MIRT451036 ZNF610 zinc finger protein 610 2 2
MIRT451596 TRPM7 transient receptor potential cation channel subfamily M member 7 2 2
MIRT452025 NLRP6 NLR family pyrin domain containing 6 2 2
MIRT452594 CA6 carbonic anhydrase 6 2 2
MIRT452768 TCEA3 transcription elongation factor A3 2 4
MIRT452959 ZNF844 zinc finger protein 844 2 2
MIRT453191 ACSF2 acyl-CoA synthetase family member 2 2 2
MIRT453382 RHD Rh blood group D antigen 2 2
MIRT453685 CEBPD CCAAT/enhancer binding protein delta 2 2
MIRT455272 DDX39B DExD-box helicase 39B 2 8
MIRT455346 BAMBI BMP and activin membrane bound inhibitor 2 2
MIRT456494 SERAC1 serine active site containing 1 2 2
MIRT456585 NID1 nidogen 1 2 2
MIRT456888 DDA1 DET1 and DDB1 associated 1 2 2
MIRT457123 APOLD1 apolipoprotein L domain containing 1 2 2
MIRT457852 ZNF324B zinc finger protein 324B 2 2
MIRT457987 APAF1 apoptotic peptidase activating factor 1 2 2
MIRT459278 APOBEC3F apolipoprotein B mRNA editing enzyme catalytic subunit 3F 2 2
MIRT459625 SLC25A33 solute carrier family 25 member 33 2 2
MIRT459715 SGK494 uncharacterized serine/threonine-protein kinase SgK494 2 2
MIRT460057 RPL22L1 ribosomal protein L22 like 1 2 2
MIRT460182 UNK unkempt family zinc finger 2 6
MIRT460288 PDE11A phosphodiesterase 11A 2 2
MIRT460841 EGF epidermal growth factor 2 4
MIRT460860 TBC1D19 TBC1 domain family member 19 2 2
MIRT461519 EMC7 ER membrane protein complex subunit 7 2 2
MIRT461729 SLC27A1 solute carrier family 27 member 1 2 4
MIRT461821 SNAP23 synaptosome associated protein 23 2 2
MIRT462066 CCDC77 coiled-coil domain containing 77 2 4
MIRT462084 MSANTD2 Myb/SANT DNA binding domain containing 2 2 2
MIRT462508 MTFMT mitochondrial methionyl-tRNA formyltransferase 2 10
MIRT464239 VCP valosin containing protein 2 2
MIRT465316 TRAF5 TNF receptor associated factor 5 2 2
MIRT466549 TBL1XR1 transducin beta like 1 X-linked receptor 1 2 2
MIRT467128 SRGAP1 SLIT-ROBO Rho GTPase activating protein 1 2 8
MIRT468091 SHCBP1 SHC binding and spindle associated 1 2 2
MIRT469630 RAD21 RAD21 cohesin complex component 2 6
MIRT471097 PIK3C2B phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta 2 2
MIRT472704 MYBL1 MYB proto-oncogene like 1 2 2
MIRT472830 MTMR10 myotubularin related protein 10 2 2
MIRT472872 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 2
MIRT472895 MTDH metadherin 2 2
MIRT473728 MAPK1 mitogen-activated protein kinase 1 2 2
MIRT473859 MAP2K4 mitogen-activated protein kinase kinase 4 2 2
MIRT474047 LONRF1 LON peptidase N-terminal domain and ring finger 1 2 2
MIRT474297 LAMC1 laminin subunit gamma 1 2 2
MIRT474658 KLF13 Kruppel like factor 13 2 2
MIRT475234 IKZF3 IKAROS family zinc finger 3 2 2
MIRT475500 HSP90B1 heat shock protein 90 beta family member 1 2 2
MIRT475742 HERPUD1 homocysteine inducible ER protein with ubiquitin like domain 1 2 4
MIRT475793 HDGF heparin binding growth factor 2 2
MIRT477254 ERGIC2 ERGIC and golgi 2 2 2
MIRT478228 DDX52 DExD-box helicase 52 2 2
MIRT478393 DCTN5 dynactin subunit 5 2 2
MIRT478754 CS citrate synthase 2 2
MIRT478827 CRKL CRK like proto-oncogene, adaptor protein 2 4
MIRT480234 C9orf41 carnosine N-methyltransferase 1 2 2
MIRT480597 BTRC beta-transducin repeat containing E3 ubiquitin protein ligase 2 2
MIRT484121 C14orf142 GON7, KEOPS complex subunit homolog 2 2
MIRT484689 PACSIN1 protein kinase C and casein kinase substrate in neurons 1 2 2
MIRT486331 C11orf54 chromosome 11 open reading frame 54 2 4
MIRT488599 FAM3C family with sequence similarity 3 member C 2 8
MIRT488833 MRRF mitochondrial ribosome recycling factor 2 2
MIRT492523 RAB15 RAB15, member RAS oncogene family 2 4
MIRT493632 HIC2 HIC ZBTB transcriptional repressor 2 2 2
MIRT500026 ABCF2 ATP binding cassette subfamily F member 2 2 8
MIRT501075 SMAD7 SMAD family member 7 2 8
MIRT503094 BTG2 BTG anti-proliferation factor 2 2 4
MIRT503336 MMAB methylmalonic aciduria (cobalamin deficiency) cblB type 2 2
MIRT505465 STMN1 stathmin 1 2 4
MIRT505726 SERTAD3 SERTA domain containing 3 2 4
MIRT509333 MS4A4A membrane spanning 4-domains A4A 2 2
MIRT509978 KCNMB1 potassium calcium-activated channel subfamily M regulatory beta subunit 1 2 4
MIRT513068 CHST6 carbohydrate sulfotransferase 6 2 2
MIRT513446 EMP1 epithelial membrane protein 1 2 6
MIRT513736 PSD3 pleckstrin and Sec7 domain containing 3 2 4
MIRT513996 CENPQ centromere protein Q 2 4
MIRT516538 MIXL1 Mix paired-like homeobox 2 2
MIRT517606 SAV1 salvador family WW domain containing protein 1 2 2
MIRT518064 CEP89 centrosomal protein 89 2 2
MIRT518119 RNMTL1 mitochondrial rRNA methyltransferase 3 2 2
MIRT518325 WDR92 WD repeat domain 92 2 2
MIRT519048 ABCB11 ATP binding cassette subfamily B member 11 2 2
MIRT520972 SPPL2A signal peptide peptidase like 2A 2 4
MIRT521359 RPL35A ribosomal protein L35a 2 2
MIRT523359 GTF3C6 general transcription factor IIIC subunit 6 2 2
MIRT523801 FAM63A MINDY lysine 48 deubiquitinase 1 2 2
MIRT524622 C7orf73 short transmembrane mitochondrial protein 1 2 2
MIRT525550 PHB2 prohibitin 2 2 4
MIRT529709 ZBTB49 zinc finger and BTB domain containing 49 2 2
MIRT531605 PLEKHA6 pleckstrin homology domain containing A6 2 2
MIRT532387 UMPS uridine monophosphate synthetase 2 2
MIRT534468 SCD stearoyl-CoA desaturase 2 4
MIRT537546 ETNK1 ethanolamine kinase 1 2 2
MIRT541619 C11orf31 selenoprotein H 2 2
MIRT548380 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 2 4
MIRT549523 HDDC2 HD domain containing 2 2 2
MIRT549774 SOD2 superoxide dismutase 2 2 2
MIRT550578 SLC2A5 solute carrier family 2 member 5 2 2
MIRT551498 CENPN centromere protein N 2 4
MIRT552301 ITGA3 integrin subunit alpha 3 2 2
MIRT555400 PPM1L protein phosphatase, Mg2+/Mn2+ dependent 1L 2 2
MIRT556399 LUC7L LUC7 like 2 2
MIRT557047 HOXB3 homeobox B3 2 2
MIRT558072 ERO1L endoplasmic reticulum oxidoreductase 1 alpha 1 2
MIRT559659 AHCYL2 adenosylhomocysteinase like 2 2 2
MIRT561239 ZNF354B zinc finger protein 354B 2 2
MIRT566899 LRIG2 leucine rich repeats and immunoglobulin like domains 2 2 2
MIRT568786 FAM120B family with sequence similarity 120B 2 2
MIRT574014 MRPL12 mitochondrial ribosomal protein L12 2 2
MIRT574885 Dnajc6 DnaJ heat shock protein family (Hsp40) member C6 2 2
MIRT575243 Serping1 serine (or cysteine) peptidase inhibitor, clade G, member 1 2 2
MIRT576194 Vsig2 V-set and immunoglobulin domain containing 2 2 2
MIRT576309 Acbd7 acyl-Coenzyme A binding domain containing 7 2 2
MIRT576484 Lhx4 LIM homeobox protein 4 2 3
MIRT576646 Mill2 MHC I like leukocyte 2 1 1
MIRT576708 Kras Kirsten rat sarcoma viral oncogene homolog 2 2
MIRT576855 Socs6 suppressor of cytokine signaling 6 2 2
MIRT576950 Aldoa aldolase A, fructose-bisphosphate 2 2
MIRT617133 ZNF556 zinc finger protein 556 2 4
MIRT617928 ZNF783 zinc finger family member 783 2 2
MIRT618981 MRPS16 mitochondrial ribosomal protein S16 2 2
MIRT621100 SIX3 SIX homeobox 3 2 2
MIRT624537 BROX BRO1 domain and CAAX motif containing 2 2
MIRT625663 C2orf48 chromosome 2 open reading frame 48 2 2
MIRT627059 DCTN6 dynactin subunit 6 2 2
MIRT628319 CLPB ClpB homolog, mitochondrial AAA ATPase chaperonin 2 2
MIRT630859 ENTPD5 ectonucleoside triphosphate diphosphohydrolase 5 2 2
MIRT632295 TMEM65 transmembrane protein 65 2 2
MIRT634115 ZNF207 zinc finger protein 207 2 2
MIRT634736 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT635655 NDST3 N-deacetylase and N-sulfotransferase 3 2 2
MIRT635772 PDCL3 phosducin like 3 2 2
MIRT635911 LILRA2 leukocyte immunoglobulin like receptor A2 2 2
MIRT636365 OGFRL1 opioid growth factor receptor like 1 2 4
MIRT637251 GLRX2 glutaredoxin 2 2 2
MIRT638705 FZD4 frizzled class receptor 4 2 2
MIRT639640 PREX2 phosphatidylinositol-3,4,5-trisphosphate dependent Rac exchange factor 2 2 2
MIRT639676 PPEF2 protein phosphatase with EF-hand domain 2 2 4
MIRT642267 SMIM17 small integral membrane protein 17 2 2
MIRT642372 ZNF581 zinc finger protein 581 2 2
MIRT643545 SLC25A17 solute carrier family 25 member 17 2 2
MIRT647994 PDE12 phosphodiesterase 12 2 2
MIRT649094 NOM1 nucleolar protein with MIF4G domain 1 2 2
MIRT650993 ZNF770 zinc finger protein 770 2 2
MIRT651956 UBE2N ubiquitin conjugating enzyme E2 N 2 2
MIRT652977 SUN2 Sad1 and UNC84 domain containing 2 2 2
MIRT654389 RBM12B RNA binding motif protein 12B 2 2
MIRT655637 OLFML2A olfactomedin like 2A 2 2
MIRT655729 NRXN3 neurexin 3 2 2
MIRT658171 FCHSD1 FCH and double SH3 domains 1 2 2
MIRT660937 ACOX1 acyl-CoA oxidase 1 2 2
MIRT662112 CERKL ceramide kinase like 2 2
MIRT662302 MPV17L MPV17 mitochondrial inner membrane protein like 2 2
MIRT662993 TMEM59 transmembrane protein 59 2 2
MIRT663071 SFR1 SWI5 dependent homologous recombination repair protein 1 2 2
MIRT663704 ABHD17B abhydrolase domain containing 17B 2 2
MIRT663864 MUC20 mucin 20, cell surface associated 2 2
MIRT665185 HAUS5 HAUS augmin like complex subunit 5 2 4
MIRT665402 WEE1 WEE1 G2 checkpoint kinase 2 2
MIRT665688 TNPO3 transportin 3 2 2
MIRT665795 TMEM170A transmembrane protein 170A 2 2
MIRT665847 TIAL1 TIA1 cytotoxic granule associated RNA binding protein like 1 2 2
MIRT666999 PDPN podoplanin 2 2
MIRT667598 LIPC lipase C, hepatic type 2 2
MIRT668576 ELMSAN1 ELM2 and Myb/SANT domain containing 1 2 4
MIRT670960 UGGT1 UDP-glucose glycoprotein glucosyltransferase 1 2 2
MIRT671187 ZNF891 zinc finger protein 891 2 2
MIRT671739 ZNF451 zinc finger protein 451 2 2
MIRT672745 ZNF585B zinc finger protein 585B 2 4
MIRT673446 ZNF583 zinc finger protein 583 2 2
MIRT679843 GPR75 G protein-coupled receptor 75 2 2
MIRT680556 ZNF584 zinc finger protein 584 2 2
MIRT680661 C1orf210 chromosome 1 open reading frame 210 2 2
MIRT681285 RFC2 replication factor C subunit 2 2 2
MIRT683264 ZNF329 zinc finger protein 329 2 2
MIRT684519 C1orf174 chromosome 1 open reading frame 174 2 2
MIRT685065 GEMIN4 gem nuclear organelle associated protein 4 2 2
MIRT685157 DTWD2 DTW domain containing 2 2 2
MIRT685168 ERCC1 ERCC excision repair 1, endonuclease non-catalytic subunit 2 2
MIRT685470 CACNG8 calcium voltage-gated channel auxiliary subunit gamma 8 2 2
MIRT686001 NEK4 NIMA related kinase 4 2 2
MIRT687027 RNF24 ring finger protein 24 2 2
MIRT687543 MOB1B MOB kinase activator 1B 2 2
MIRT687592 MANEAL mannosidase endo-alpha like 2 2
MIRT687753 KIAA1328 KIAA1328 2 2
MIRT688050 GLUL glutamate-ammonia ligase 2 2
MIRT688374 ENPP1 ectonucleotide pyrophosphatase/phosphodiesterase 1 2 2
MIRT688802 CBFA2T3 CBFA2/RUNX1 translocation partner 3 2 2
MIRT688957 ATXN3 ataxin 3 2 2
MIRT689281 C5AR2 complement component 5a receptor 2 2 2
MIRT689988 NNMT nicotinamide N-methyltransferase 2 2
MIRT689997 MMP17 matrix metallopeptidase 17 2 2
MIRT690014 LUZP2 leucine zipper protein 2 2 2
MIRT690161 ELP3 elongator acetyltransferase complex subunit 3 2 2
MIRT690379 ZSWIM7 zinc finger SWIM-type containing 7 2 2
MIRT690563 MICA MHC class I polypeptide-related sequence A 2 2
MIRT691891 EVC EvC ciliary complex subunit 1 2 2
MIRT693107 SCNM1 sodium channel modifier 1 2 2
MIRT693832 ZFP64 ZFP64 zinc finger protein 2 2
MIRT694105 ZNF446 zinc finger protein 446 2 2
MIRT694179 ZNF486 zinc finger protein 486 2 2
MIRT694475 LRTOMT leucine rich transmembrane and O-methyltransferase domain containing 2 2
MIRT694998 GGA2 golgi associated, gamma adaptin ear containing, ARF binding protein 2 2 2
MIRT695031 ALG10B ALG10B, alpha-1,2-glucosyltransferase 2 2
MIRT695163 TCTN2 tectonic family member 2 2 2
MIRT695525 SLC25A34 solute carrier family 25 member 34 2 2
MIRT696067 ZNF264 zinc finger protein 264 2 2
MIRT696616 CRIPT CXXC repeat containing interactor of PDZ3 domain 2 2
MIRT696661 AGXT2 alanine--glyoxylate aminotransferase 2 2 2
MIRT696705 PNPO pyridoxamine 5'-phosphate oxidase 2 2
MIRT697173 INMT indolethylamine N-methyltransferase 2 2
MIRT697303 ZNF652 zinc finger protein 652 2 2
MIRT697491 ZBTB8B zinc finger and BTB domain containing 8B 2 2
MIRT698657 TERF2 telomeric repeat binding factor 2 2 2
MIRT699042 SOAT1 sterol O-acyltransferase 1 2 2
MIRT699185 SLX4IP SLX4 interacting protein 2 2
MIRT699598 SHOC2 SHOC2, leucine rich repeat scaffold protein 2 2
MIRT700150 RNF115 ring finger protein 115 2 2
MIRT700720 PNO1 partner of NOB1 homolog 2 2
MIRT700870 PER2 period circadian clock 2 2 2
MIRT700912 PDXK pyridoxal kinase 2 2
MIRT701095 PAPOLG poly(A) polymerase gamma 2 2
MIRT701194 OTUD3 OTU deubiquitinase 3 2 2
MIRT702203 LPP LIM domain containing preferred translocation partner in lipoma 2 2
MIRT702272 LHX4 LIM homeobox 4 2 3
MIRT703125 GPRC5A G protein-coupled receptor class C group 5 member A 2 2
MIRT703252 GNS glucosamine (N-acetyl)-6-sulfatase 2 2
MIRT703262 GNL3L G protein nucleolar 3 like 2 2
MIRT703440 FYTTD1 forty-two-three domain containing 1 2 2
MIRT704321 DCUN1D5 defective in cullin neddylation 1 domain containing 5 2 2
MIRT704393 CTSS cathepsin S 2 2
MIRT704483 CPT1A carnitine palmitoyltransferase 1A 2 2
MIRT704880 CCSER2 coiled-coil serine rich protein 2 2 2
MIRT704926 CCDC36 coiled-coil domain containing 36 2 2
MIRT705175 BZW1 basic leucine zipper and W2 domains 1 2 2
MIRT706561 EIF2AK2 eukaryotic translation initiation factor 2 alpha kinase 2 2 2
MIRT707048 TRPV2 transient receptor potential cation channel subfamily V member 2 2 2
MIRT711497 PGD phosphogluconate dehydrogenase 2 2
MIRT716644 EPGN epithelial mitogen 2 2
MIRT720083 TNRC6B trinucleotide repeat containing 6B 2 2
MIRT722288 PMPCA peptidase, mitochondrial processing alpha subunit 2 2
MIRT725468 GRAP2 GRB2-related adaptor protein 2 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-4433a Dabrafenib 44462760 NSC764134 approved resistant cell line (A375)
hsa-mir-4433a Paclitaxel 36314 NSC125973 approved resistant cell line (W1)
hsa-mir-4433a Vincristine 5978 approved resistant cell line (W1)
hsa-mir-4433a Cisplatin 5460033 NSC119875 approved resistant cell line (BxPC3)
hsa-miR-4433a-3p Platinum 23939 sensitive High Ovarian Cancer tissue
hsa-miR-4433a-3p Imatinib 5291 NSC743414 approved sensitive High Gastrointestinal Stromal Tumor cell line (882R-NC, 882R-OE, 882R-KD)
hsa-miR-4433a-3p Cisplatin 5460033 NSC119875 approved resistant High Pancreatic Cancer cell line (BxPC-3)
hsa-miR-4433a-3p Paclitaxel 36314 NSC125973 approved resistant High Non-Small Cell Lung Cancer cell line (A549)
hsa-miR-4433a-3p Imatinib 5291 NSC743414 approved sensitive High Chronic Myelogenous Leukemia tissue
hsa-miR-4433a-3p Cisplatin 5460033 NSC119875 approved resistant High Ovarian Cancer cell line (A2780CIS)
hsa-miR-4433a-3p Cisplatin 5460033 NSC119875 approved sensitive cell line (CAL-27) (mitochondrial RNA)
hsa-miR-4433a-3p Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-4433a-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CP20)
hsa-miR-4433a-3p Cisplatin 5460033 NSC119875 approved resistant cell line (CIS)
hsa-miR-4433a-3p Neoadjuvant chemotherapy sensitive tissue (breast cancer)
hsa-miR-4433a-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (1500 ng/ml)
hsa-miR-4433a-3p Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)

Error report submission