miRTarBase - #MIRT216355


—
pre-miRNA Information
pre-miRNA hsa-mir-548w   
Genomic Coordinates chr16: 26025237 - 26025310
Description Homo sapiens miR-548w stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-548w
Sequence 10| AAAAGUAACUGCGGUUUUUGCCU |32
Evidence Experimental
Experiments Illumina
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 4 16 + 26025249 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs918935898 1 dbSNP
rs573018690 4 dbSNP
rs1355338018 5 dbSNP
rs1232952112 7 dbSNP
rs768527810 12 dbSNP
rs1331351492 13 dbSNP
rs925963272 14 dbSNP
rs1299975801 16 dbSNP
rs1247960808 17 dbSNP
rs1217191628 23 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
miRNAs in Extracellular Vesicles
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CCNB1   
Synonyms CCNB
Description cyclin B1
Transcript NM_031966   
Expression
Putative miRNA Targets on CCNB1
3'UTR of CCNB1
(miRNA target sites are highlighted)		 
>CCNB1|NM_031966|3'UTR
   1 CTTGTAAACTTGAGTTGGAGTACTATATTTACAAATAAAATTGGCACCATGTGCCATCTGTACATATTACTGTTGCATTT
  81 ACTTTTAATAAAGCTTGTGGCCCCTTTTACTTTTTTATAGCTTAACTAATTTGAATGTGGTTACTTCCTACTGTAGGGTA
 161 GCGGAAAAGTTGTCTTAAAAGGTATGGTGGGGATATTTTTAAAAACTCCTTTTGGTTTACCTGGGGATCCAATTGATGTA
 241 TATGTTTATATACTGGGTTCTTGTTTTATATACCTGGCTTTTACTTTATTAATATGAGTTACTGAAGGTGATGGAGGTAT
 321 TTGAAAATTTTACTTCCATAGGACATACTGCATGTAAGCCAAGTCATGGAGAATCTGCTGCATAGCTCTATTTTAAAGTA
 401 AAAGTCTACCACCGAATCCCTAGTCCCCCTGTTTTCTGTTTCTTCTTGTGATTGCTGCCATAATTCTAAGTTATTTACTT
 481 TTACCACTATTTAAGTTATCAACTTTAGCTAGTATCTTCAAACTTTCACTTTGAAAAATGAGAATTTTATATTCTAAGCC
 561 AGTTTTCATTTTGGTTTTGTGTTTTGGTTAATAAAACAATACTCAAATACAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' uccguuuuUGGCGUCAAUGAAAa 5'
                  :::||| ||||||| 
Target 5' atattactGTTGCATTTACTTTt 3'
 64 - 86 155.00 -9.80
2 
miRNA  3' uccGUUUUUGG--CGUCAAUGAAAa 5'
             :| | |||  ||  ||||||| 
Target 5' tttTATATACCTGGCTTTTACTTTa 3'
 264 - 288 154.00 -6.40
3 
miRNA  3' uccGUUUUUGGCGUC------AAUGAAAa 5'
             :|||: ::|::|      ||||||| 
Target 5' taaTAAAGCTTGTGGCCCCTTTTACTTTt 3'
 86 - 114 150.00 -8.90
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30498666 7 COSMIC
COSN30474463 18 COSMIC
COSN30537868 66 COSMIC
COSN30156290 83 COSMIC
COSN31580931 143 COSMIC
COSN7951692 308 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1227461536 5 dbSNP
rs746908757 12 dbSNP
rs140912931 18 dbSNP
rs1275271534 20 dbSNP
rs1215701860 21 dbSNP
rs547452102 26 dbSNP
rs1266296368 31 dbSNP
rs1464462279 35 dbSNP
rs776201738 37 dbSNP
rs929544247 41 dbSNP
rs745410711 50 dbSNP
rs769314866 52 dbSNP
rs1293523080 68 dbSNP
rs8192272 73 dbSNP
rs1279884369 76 dbSNP
rs1240947742 77 dbSNP
rs751323295 78 dbSNP
rs370231641 79 dbSNP
rs8192273 84 dbSNP
rs1179959771 86 dbSNP
rs1396103126 96 dbSNP
rs567773774 104 dbSNP
rs1460531450 111 dbSNP
rs1412973898 115 dbSNP
rs1412296161 118 dbSNP
rs1159459530 119 dbSNP
rs912022658 137 dbSNP
rs976791863 140 dbSNP
rs34009746 147 dbSNP
rs754860405 152 dbSNP
rs943107005 153 dbSNP
rs923165097 154 dbSNP
rs1469316983 158 dbSNP
rs1398144449 163 dbSNP
rs931940395 165 dbSNP
rs528551848 171 dbSNP
rs1211939022 185 dbSNP
rs1038836073 186 dbSNP
rs1285283920 196 dbSNP
rs904268983 202 dbSNP
rs1348356254 206 dbSNP
rs1465199322 207 dbSNP
rs893007508 210 dbSNP
rs1332224525 215 dbSNP
rs1373100430 218 dbSNP
rs947231460 227 dbSNP
rs1402743833 231 dbSNP
rs149803334 233 dbSNP
rs1319954846 234 dbSNP
rs1402795519 239 dbSNP
rs1284041504 242 dbSNP
rs902961866 255 dbSNP
rs1052774733 261 dbSNP
rs1230578211 268 dbSNP
rs191764548 274 dbSNP
rs1014148810 275 dbSNP
rs539016234 279 dbSNP
rs1397456815 284 dbSNP
rs1191807226 286 dbSNP
rs1453908672 292 dbSNP
rs1242906041 306 dbSNP
rs905672533 308 dbSNP
rs1445506730 314 dbSNP
rs1283211372 317 dbSNP
rs1035390566 318 dbSNP
rs894702227 320 dbSNP
rs1258288545 324 dbSNP
rs1232924818 328 dbSNP
rs1001319017 340 dbSNP
rs1027247000 345 dbSNP
rs1428136580 354 dbSNP
rs1439264291 355 dbSNP
rs184312481 359 dbSNP
rs1435787330 361 dbSNP
rs952816918 363 dbSNP
rs1172387475 370 dbSNP
rs1413960511 380 dbSNP
rs1033766302 381 dbSNP
rs1420241368 385 dbSNP
rs982967305 386 dbSNP
rs963414156 391 dbSNP
rs1241767304 400 dbSNP
rs965517701 401 dbSNP
rs1486568654 408 dbSNP
rs1255302935 412 dbSNP
rs977137022 414 dbSNP
rs921312299 415 dbSNP
rs1274452839 418 dbSNP
rs367674932 425 dbSNP
rs373411745 426 dbSNP
rs188207759 427 dbSNP
rs1189932747 429 dbSNP
rs1415773560 435 dbSNP
rs1357818014 440 dbSNP
rs1311454311 451 dbSNP
rs931881988 456 dbSNP
rs146808800 460 dbSNP
rs986032898 461 dbSNP
rs1026289452 467 dbSNP
rs914494156 485 dbSNP
rs1408326518 489 dbSNP
rs1423144785 496 dbSNP
rs1391630974 501 dbSNP
rs752433911 513 dbSNP
rs1415311621 514 dbSNP
rs1477506356 522 dbSNP
rs947201737 545 dbSNP
rs755659997 560 dbSNP
rs192220519 564 dbSNP
rs1234582878 578 dbSNP
rs1201791910 585 dbSNP
rs1436792324 589 dbSNP
rs539013012 593 dbSNP
rs1421906257 597 dbSNP
rs1413016948 601 dbSNP
rs777445185 612 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uccguuuuUGGCGUCAAUGAAAa 5'
                  :::||| ||||||| 
Target 5' auauuacuGUUGCAUUUACUUUu 3'
 		11 - 33
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 891.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' uccguuuuUGGCGUCAAUGAAAa 5'
                  :::||| ||||||| 
Target 5' auauuacuGUUGCAUUUACUUUu 3'
 		4 - 26
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000256442.5 | 3UTR | CCAUCUGUACAUAUUACUGUUGCAUUUACUUUUAAUAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000256442.5 | 3UTR | UACAUAUUACUGUUGCAUUUACUUUUAAUAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
184 hsa-miR-548w Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT057125 DDIT4 DNA damage inducible transcript 4 2 4
MIRT063369 ETNK1 ethanolamine kinase 1 2 2
MIRT072492 RAB8B RAB8B, member RAS oncogene family 2 2
MIRT082186 ACTN4 actinin alpha 4 2 6
MIRT083033 PTBP1 polypyrimidine tract binding protein 1 2 2
MIRT085188 SLC5A3 solute carrier family 5 member 3 2 4
MIRT088905 FOXN2 forkhead box N2 2 4
MIRT089494 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 6
MIRT092039 ABHD5 abhydrolase domain containing 5 2 2
MIRT094685 FEM1C fem-1 homolog C 2 2
MIRT095393 UBE2D2 ubiquitin conjugating enzyme E2 D2 2 2
MIRT096501 BRIX1 BRX1, biogenesis of ribosomes 2 2
MIRT101296 FAM135A family with sequence similarity 135 member A 2 2
MIRT103356 CBX3 chromobox 3 2 2
MIRT103872 FOXK1 forkhead box K1 2 2
MIRT104334 CLDN12 claudin 12 2 2
MIRT104501 PEG10 paternally expressed 10 2 6
MIRT111795 MPZL1 myelin protein zero like 1 2 2
MIRT177238 BMI1 BMI1 proto-oncogene, polycomb ring finger 2 2
MIRT177273 COMMD3-BMI1 COMMD3-BMI1 readthrough 2 2
MIRT177626 UBE2D1 ubiquitin conjugating enzyme E2 D1 2 6
MIRT178042 SAMD8 sterile alpha motif domain containing 8 2 2
MIRT179102 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 6
MIRT179587 CAPZA1 capping actin protein of muscle Z-line alpha subunit 1 2 6
MIRT195299 LEPROT leptin receptor overlapping transcript 2 2
MIRT203143 BACH1 BTB domain and CNC homolog 1 2 2
MIRT208430 ZBTB38 zinc finger and BTB domain containing 38 2 2
MIRT214578 SMAD5 SMAD family member 5 2 4
MIRT216103 IL6ST interleukin 6 signal transducer 2 2
MIRT216355 CCNB1 cyclin B1 2 4
MIRT220050 MDFIC MyoD family inhibitor domain containing 2 2
MIRT226729 ANP32B acidic nuclear phosphoprotein 32 family member B 2 4
MIRT227698 TBC1D13 TBC1 domain family member 13 2 2
MIRT230071 SH3BGRL SH3 domain binding glutamate rich protein like 2 2
MIRT248637 HMGN2 high mobility group nucleosomal binding domain 2 2 4
MIRT254790 XRCC6 X-ray repair cross complementing 6 2 6
MIRT264376 YAP1 Yes associated protein 1 2 2
MIRT266972 LRRC55 leucine rich repeat containing 55 2 4
MIRT273949 SPRYD4 SPRY domain containing 4 2 2
MIRT281802 MAP2K1 mitogen-activated protein kinase kinase 1 2 2
MIRT293252 DR1 down-regulator of transcription 1 2 2
MIRT297097 RGPD4 RANBP2-like and GRIP domain containing 4 2 2
MIRT308170 PDE12 phosphodiesterase 12 2 2
MIRT309013 USP53 ubiquitin specific peptidase 53 2 2
MIRT311470 PRRC1 proline rich coiled-coil 1 2 2
MIRT312586 G3BP1 G3BP stress granule assembly factor 1 2 4
MIRT328130 ZNF711 zinc finger protein 711 2 2
MIRT329313 FAM53C family with sequence similarity 53 member C 2 2
MIRT334642 NEK7 NIMA related kinase 7 2 2
MIRT340673 THRAP3 thyroid hormone receptor associated protein 3 2 2
MIRT378858 ITGB8 integrin subunit beta 8 2 2
MIRT395789 SPCS3 signal peptidase complex subunit 3 2 2
MIRT405639 WBP4 WW domain binding protein 4 2 4
MIRT408287 GRPEL2 GrpE like 2, mitochondrial 2 2
MIRT442097 ZNRF2 zinc and ring finger 2 2 8
MIRT442840 GTF2H5 general transcription factor IIH subunit 5 2 2
MIRT443116 VLDLR very low density lipoprotein receptor 2 2
MIRT443147 ZDHHC21 zinc finger DHHC-type containing 21 2 2
MIRT443298 PRPS1L1 phosphoribosyl pyrophosphate synthetase 1-like 1 2 2
MIRT445080 ZNF207 zinc finger protein 207 2 2
MIRT445384 PTCHD1 patched domain containing 1 2 4
MIRT447070 MCC mutated in colorectal cancers 2 2
MIRT447300 ZNF562 zinc finger protein 562 2 2
MIRT447512 MRPS5 mitochondrial ribosomal protein S5 2 2
MIRT449511 TM6SF1 transmembrane 6 superfamily member 1 2 2
MIRT449902 C11orf34 placenta expressed transcript 1 1 2
MIRT450551 SHFM1 SEM1, 26S proteasome complex subunit 2 2
MIRT450719 PVRL3 nectin cell adhesion molecule 3 2 2
MIRT454923 ANKEF1 ankyrin repeat and EF-hand domain containing 1 2 12
MIRT455892 KIF2C kinesin family member 2C 2 2
MIRT463732 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 2 8
MIRT471182 PHB2 prohibitin 2 2 2
MIRT472764 MTMR6 myotubularin related protein 6 2 8
MIRT474457 KLHL11 kelch like family member 11 2 8
MIRT475985 GTPBP2 GTP binding protein 2 2 2
MIRT482277 AGO2 argonaute 2, RISC catalytic component 2 4
MIRT485858 ALG9 ALG9, alpha-1,2-mannosyltransferase 2 2
MIRT486192 ERH ERH, mRNA splicing and mitosis factor 2 4
MIRT488609 FAM3C family with sequence similarity 3 member C 2 6
MIRT489984 DDB1 damage specific DNA binding protein 1 2 2
MIRT493476 IPMK inositol polyphosphate multikinase 2 2
MIRT494280 CEP120 centrosomal protein 120 2 2
MIRT497992 ZBTB20 zinc finger and BTB domain containing 20 2 2
MIRT498473 PTBP2 polypyrimidine tract binding protein 2 2 10
MIRT498559 TMEM30B transmembrane protein 30B 2 2
MIRT499867 SVOP SV2 related protein 2 10
MIRT500220 INHBA inhibin beta A subunit 2 10
MIRT500694 TRIM37 tripartite motif containing 37 2 2
MIRT500988 SPPL2A signal peptide peptidase like 2A 2 4
MIRT501023 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 2 6
MIRT502736 CLIP1 CAP-Gly domain containing linker protein 1 2 8
MIRT502798 CELSR3 cadherin EGF LAG seven-pass G-type receptor 3 2 6
MIRT502887 CDK4 cyclin dependent kinase 4 2 8
MIRT503483 ZNF154 zinc finger protein 154 2 6
MIRT503717 GRM5 glutamate metabotropic receptor 5 2 2
MIRT505137 YOD1 YOD1 deubiquitinase 2 2
MIRT505802 RSBN1 round spermatid basic protein 1 2 8
MIRT505841 POLR1B RNA polymerase I subunit B 2 4
MIRT509284 NPM3 nucleophosmin/nucleoplasmin 3 2 6
MIRT516829 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT520519 TRA2B transformer 2 beta homolog 2 2
MIRT520723 TM9SF3 transmembrane 9 superfamily member 3 2 6
MIRT525403 SHISA9 shisa family member 9 2 4
MIRT525867 ARL13B ADP ribosylation factor like GTPase 13B 2 2
MIRT526013 RBM4B RNA binding motif protein 4B 2 2
MIRT526084 TMEM41B transmembrane protein 41B 2 2
MIRT527931 FRY FRY microtubule binding protein 2 2
MIRT528818 RAB32 RAB32, member RAS oncogene family 2 2
MIRT531062 SLC9A4 solute carrier family 9 member A4 2 4
MIRT535495 PANX1 pannexin 1 2 2
MIRT536682 IKZF5 IKAROS family zinc finger 5 2 2
MIRT536835 HMBOX1 homeobox containing 1 2 2
MIRT537202 GDE1 glycerophosphodiester phosphodiesterase 1 2 4
MIRT537834 EFNA5 ephrin A5 2 2
MIRT538345 CSE1L chromosome segregation 1 like 2 4
MIRT541242 GPC4 glypican 4 2 2
MIRT543235 PEX7 peroxisomal biogenesis factor 7 2 2
MIRT543450 PARP15 poly(ADP-ribose) polymerase family member 15 2 2
MIRT543711 XKR9 XK related 9 2 2
MIRT543907 ESYT1 extended synaptotagmin 1 2 2
MIRT543999 KLRC3 killer cell lectin like receptor C3 2 2
MIRT544070 METTL8 methyltransferase like 8 2 2
MIRT544187 ANGPTL3 angiopoietin like 3 2 2
MIRT544808 ACSM2B acyl-CoA synthetase medium chain family member 2B 2 2
MIRT545046 PRELID1 PRELI domain containing 1 2 2
MIRT545214 HIST1H2BD histone cluster 1 H2B family member d 2 2
MIRT545289 SPC25 SPC25, NDC80 kinetochore complex component 2 2
MIRT545550 GIMAP4 GTPase, IMAP family member 4 2 2
MIRT546497 SIK1 salt inducible kinase 1 2 2
MIRT546914 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 2
MIRT547675 KPNA1 karyopherin subunit alpha 1 2 4
MIRT547770 KATNAL1 katanin catalytic subunit A1 like 1 2 2
MIRT548687 CRNKL1 crooked neck pre-mRNA splicing factor 1 2 2
MIRT548901 CHEK2 checkpoint kinase 2 2 4
MIRT549957 RPL7L1 ribosomal protein L7 like 1 2 4
MIRT550489 TMEM241 transmembrane protein 241 2 2
MIRT551049 MKLN1 muskelin 1 2 2
MIRT552811 XIAP X-linked inhibitor of apoptosis 2 4
MIRT553145 UBE2H ubiquitin conjugating enzyme E2 H 2 2
MIRT553830 SYNCRIP synaptotagmin binding cytoplasmic RNA interacting protein 2 2
MIRT554258 SIX4 SIX homeobox 4 2 2
MIRT555781 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 2 2
MIRT556318 MAP2K4 mitogen-activated protein kinase kinase 4 2 2
MIRT556499 LIPA lipase A, lysosomal acid type 2 2
MIRT556693 KLHL28 kelch like family member 28 2 2
MIRT556752 KLF7 Kruppel like factor 7 2 2
MIRT556990 HPRT1 hypoxanthine phosphoribosyltransferase 1 2 2
MIRT557146 HOXA13 homeobox A13 2 2
MIRT557487 GPR27 G protein-coupled receptor 27 2 4
MIRT558102 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 2 2
MIRT559344 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT560335 ZWINT ZW10 interacting kinetochore protein 2 2
MIRT561299 ZBTB43 zinc finger and BTB domain containing 43 2 2
MIRT561883 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT561927 MFSD9 major facilitator superfamily domain containing 9 2 2
MIRT562935 TNIP2 TNFAIP3 interacting protein 2 2 2
MIRT563291 BBS10 Bardet-Biedl syndrome 10 2 2
MIRT563405 KIF3A kinesin family member 3A 2 2
MIRT563562 KIAA1586 KIAA1586 2 2
MIRT565876 NHS NHS actin remodeling regulator 2 2
MIRT566081 RCC2 regulator of chromosome condensation 2 2 2
MIRT566396 PLAGL2 PLAG1 like zinc finger 2 2 2
MIRT567259 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 2
MIRT571468 CCDC80 coiled-coil domain containing 80 2 2
MIRT572939 VDAC2 voltage dependent anion channel 2 2 2
MIRT573628 ZNF724P zinc finger protein 724 2 2
MIRT573717 KHSRP KH-type splicing regulatory protein 2 2
MIRT609088 SMIM15 small integral membrane protein 15 2 6
MIRT617936 EBNA1BP2 EBNA1 binding protein 2 2 2
MIRT618379 PRKG2 protein kinase, cGMP-dependent, type II 2 2
MIRT619627 PLEKHG7 pleckstrin homology and RhoGEF domain containing G7 2 2
MIRT623455 KDM5A lysine demethylase 5A 2 2
MIRT629145 CTCFL CCCTC-binding factor like 2 2
MIRT638521 LYRM2 LYR motif containing 2 2 2
MIRT649483 CLDN16 claudin 16 2 2
MIRT683148 MTHFD1 methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 2 2
MIRT691660 SLC43A3 solute carrier family 43 member 3 2 2
MIRT693201 MKI67 marker of proliferation Ki-67 2 2
MIRT695334 AQP3 aquaporin 3 (Gill blood group) 2 2
MIRT701023 PCGF5 polycomb group ring finger 5 2 2
MIRT708753 RYBP RING1 and YY1 binding protein 2 2
MIRT717558 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT719286 SETD7 SET domain containing lysine methyltransferase 7 2 2
MIRT725172 SDAD1 SDA1 domain containing 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-548w Paclitaxel 36314 NSC125973 approved sensitive cell line (W1)
hsa-mir-548w Cisplatin 5460033 NSC119875 approved sensitive cell line (W1)
hsa-miR-548w Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-548w Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-548w Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-548w Doxorubicin 31703 NSC123127 approved resistant cell line (BAS)
hsa-miR-548w Cisplatin 5460033 NSC119875 approved resistant cell line (MGC-803)
hsa-miR-548w Cisplatin 5460033 NSC119875 approved sensitive cell line (A549)
hsa-miR-548w Gemcitabine 60750 NSC613327 approved sensitive cell line (PANC-1) (100 ng/ml)
hsa-miR-548w Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide/Methotrexate/Gemcitabine resistant cell line (Bats-72)
hsa-miR-548w Paclitaxel/Docetaxel/Vinorelbine/Doxorubicin/Etoposide resistant cell line (Bads-200)

Error report submission