miRTarBase - #MIRT216366


—
pre-miRNA Information
pre-miRNA hsa-mir-548aq   
Genomic Coordinates chr3: 185767847 - 185767904
Description Homo sapiens miR-548aq stem-loop
Comment None
RNA Secondary Structure

Mature miRNA Information
Mature miRNA hsa-miR-548aq-5p
Sequence 1| GAAAGUAAUUGCUGUUUUUGCC |22
Evidence Not_experimental
Experiments
Editing Events in miRNAs
Modification Type Position on miR Chromosome DNA Strand Genomic Position (hg38) List of PMIDs Variant details
A-to-I 7 3 - 185767898 29233923 MiREDiBase
SNPs in miRNA
Mutant ID Mutant Position Mutant Source
rs148741643 4 dbSNP
rs373424261 5 dbSNP
rs954388082 9 dbSNP
rs1008952958 10 dbSNP
rs1443286362 15 dbSNP
rs778852684 17 dbSNP
rs1042518237 21 dbSNP
rs1299293460 22 dbSNP
Putative Targets

miRNA Expression profile
Human miRNA Tissue Atlas
Circulating MicroRNA Expression Profiling
Gene Information
Gene Symbol CCNB1   
Synonyms CCNB
Description cyclin B1
Transcript NM_031966   
Expression
Putative miRNA Targets on CCNB1
3'UTR of CCNB1
(miRNA target sites are highlighted)		 
>CCNB1|NM_031966|3'UTR
   1 CTTGTAAACTTGAGTTGGAGTACTATATTTACAAATAAAATTGGCACCATGTGCCATCTGTACATATTACTGTTGCATTT
  81 ACTTTTAATAAAGCTTGTGGCCCCTTTTACTTTTTTATAGCTTAACTAATTTGAATGTGGTTACTTCCTACTGTAGGGTA
 161 GCGGAAAAGTTGTCTTAAAAGGTATGGTGGGGATATTTTTAAAAACTCCTTTTGGTTTACCTGGGGATCCAATTGATGTA
 241 TATGTTTATATACTGGGTTCTTGTTTTATATACCTGGCTTTTACTTTATTAATATGAGTTACTGAAGGTGATGGAGGTAT
 321 TTGAAAATTTTACTTCCATAGGACATACTGCATGTAAGCCAAGTCATGGAGAATCTGCTGCATAGCTCTATTTTAAAGTA
 401 AAAGTCTACCACCGAATCCCTAGTCCCCCTGTTTTCTGTTTCTTCTTGTGATTGCTGCCATAATTCTAAGTTATTTACTT
 481 TTACCACTATTTAAGTTATCAACTTTAGCTAGTATCTTCAAACTTTCACTTTGAAAAATGAGAATTTTATATTCTAAGCC
 561 AGTTTTCATTTTGGTTTTGTGTTTTGGTTAATAAAACAATACTCAAATACAAAAAAAAAAAA
Target sites Provided by authors   Predicted by miRanda    DRVs    SNPs    DRVs & SNPs
miRNA-target interactions
(Predicted by miRanda)
ID Duplex structure Position Score MFE
1 
miRNA  3' ccguuuuuguCGUUAAUGAAAg 5'
                    ||| ||||||| 
Target 5' tattactgttGCATTTACTTTt 3'
 65 - 86 152.00 -6.80
2 
miRNA  3' ccGUUUUUG--UCGUUAAUGAAAg 5'
            :| | ||  :||  ||||||| 
Target 5' ttTATATACCTGGCTTTTACTTTa 3'
 265 - 288 150.00 -6.90
3 
miRNA  3' ccGUUUUUG---UC-GUUAAUGAAAg 5'
            || || :   || :| ||||||| 
Target 5' gcCATAATTCTAAGTTATTTACTTTt 3'
 457 - 482 148.00 -5.30
DRVs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
COSN30498666 7 COSMIC
COSN30474463 18 COSMIC
COSN30537868 66 COSMIC
COSN30156290 83 COSMIC
COSN31580931 143 COSMIC
COSN7951692 308 COSMIC
SNPs in gene 3'UTRs
Mutant ID Mutant Position Mutant Source
rs1227461536 5 dbSNP
rs746908757 12 dbSNP
rs140912931 18 dbSNP
rs1275271534 20 dbSNP
rs1215701860 21 dbSNP
rs547452102 26 dbSNP
rs1266296368 31 dbSNP
rs1464462279 35 dbSNP
rs776201738 37 dbSNP
rs929544247 41 dbSNP
rs745410711 50 dbSNP
rs769314866 52 dbSNP
rs1293523080 68 dbSNP
rs8192272 73 dbSNP
rs1279884369 76 dbSNP
rs1240947742 77 dbSNP
rs751323295 78 dbSNP
rs370231641 79 dbSNP
rs8192273 84 dbSNP
rs1179959771 86 dbSNP
rs1396103126 96 dbSNP
rs567773774 104 dbSNP
rs1460531450 111 dbSNP
rs1412973898 115 dbSNP
rs1412296161 118 dbSNP
rs1159459530 119 dbSNP
rs912022658 137 dbSNP
rs976791863 140 dbSNP
rs34009746 147 dbSNP
rs754860405 152 dbSNP
rs943107005 153 dbSNP
rs923165097 154 dbSNP
rs1469316983 158 dbSNP
rs1398144449 163 dbSNP
rs931940395 165 dbSNP
rs528551848 171 dbSNP
rs1211939022 185 dbSNP
rs1038836073 186 dbSNP
rs1285283920 196 dbSNP
rs904268983 202 dbSNP
rs1348356254 206 dbSNP
rs1465199322 207 dbSNP
rs893007508 210 dbSNP
rs1332224525 215 dbSNP
rs1373100430 218 dbSNP
rs947231460 227 dbSNP
rs1402743833 231 dbSNP
rs149803334 233 dbSNP
rs1319954846 234 dbSNP
rs1402795519 239 dbSNP
rs1284041504 242 dbSNP
rs902961866 255 dbSNP
rs1052774733 261 dbSNP
rs1230578211 268 dbSNP
rs191764548 274 dbSNP
rs1014148810 275 dbSNP
rs539016234 279 dbSNP
rs1397456815 284 dbSNP
rs1191807226 286 dbSNP
rs1453908672 292 dbSNP
rs1242906041 306 dbSNP
rs905672533 308 dbSNP
rs1445506730 314 dbSNP
rs1283211372 317 dbSNP
rs1035390566 318 dbSNP
rs894702227 320 dbSNP
rs1258288545 324 dbSNP
rs1232924818 328 dbSNP
rs1001319017 340 dbSNP
rs1027247000 345 dbSNP
rs1428136580 354 dbSNP
rs1439264291 355 dbSNP
rs184312481 359 dbSNP
rs1435787330 361 dbSNP
rs952816918 363 dbSNP
rs1172387475 370 dbSNP
rs1413960511 380 dbSNP
rs1033766302 381 dbSNP
rs1420241368 385 dbSNP
rs982967305 386 dbSNP
rs963414156 391 dbSNP
rs1241767304 400 dbSNP
rs965517701 401 dbSNP
rs1486568654 408 dbSNP
rs1255302935 412 dbSNP
rs977137022 414 dbSNP
rs921312299 415 dbSNP
rs1274452839 418 dbSNP
rs367674932 425 dbSNP
rs373411745 426 dbSNP
rs188207759 427 dbSNP
rs1189932747 429 dbSNP
rs1415773560 435 dbSNP
rs1357818014 440 dbSNP
rs1311454311 451 dbSNP
rs931881988 456 dbSNP
rs146808800 460 dbSNP
rs986032898 461 dbSNP
rs1026289452 467 dbSNP
rs914494156 485 dbSNP
rs1408326518 489 dbSNP
rs1423144785 496 dbSNP
rs1391630974 501 dbSNP
rs752433911 513 dbSNP
rs1415311621 514 dbSNP
rs1477506356 522 dbSNP
rs947201737 545 dbSNP
rs755659997 560 dbSNP
rs192220519 564 dbSNP
rs1234582878 578 dbSNP
rs1201791910 585 dbSNP
rs1436792324 589 dbSNP
rs539013012 593 dbSNP
rs1421906257 597 dbSNP
rs1413016948 601 dbSNP
rs777445185 612 dbSNP
Experimental Support 1 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions HEK293
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... PAR-CLIP data was present in GSM545216. RNA binding protein: AGO2. Condition:miR-124 transfection ...

- Hafner M; Landthaler M; Burger L; Khorshid et al., 2010, Cell.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ccguuuuuguCGUUAAUGAAAg 5'
                    ||| ||||||| 
Target 5' uauuacuguuGCAUUUACUUUu 3'
 		12 - 33
Article - Hafner M; Landthaler M; Burger L; Khorshid et al.
- Cell, 2010
RNA transcripts are subject to posttranscriptional gene regulation involving hundreds of RNA-binding proteins (RBPs) and microRNA-containing ribonucleoprotein complexes (miRNPs) expressed in a cell-type dependent fashion. We developed a cell-based crosslinking approach to determine at high resolution and transcriptome-wide the binding sites of cellular RBPs and miRNPs. The crosslinked sites are revealed by thymidine to cytidine transitions in the cDNAs prepared from immunopurified RNPs of 4-thiouridine-treated cells. We determined the binding sites and regulatory consequences for several intensely studied RBPs and miRNPs, including PUM2, QKI, IGF2BP1-3, AGO/EIF2C1-4 and TNRC6A-C. Our study revealed that these factors bind thousands of sites containing defined sequence motifs and have distinct preferences for exonic versus intronic or coding versus untranslated transcript regions. The precise mapping of binding sites across the transcriptome will be critical to the interpretation of the rapidly emerging data on genetic variation between individuals and how these variations contribute to complex genetic diseases.
LinkOut: [PMID: 20371350]
Experimental Support 2 for Functional miRNA-Target Interaction
miRNA:Target ----
Validation Method
Conditions hESCs (WA-09)
Disease 891.0
Location of target site 3'UTR
Tools used in this research TargetScan , miRTarCLIP , Piranha
Original Description (Extracted from the article) ... "PAR-CLIP data was present in SRR359787. RNA binding protein: AGO2. Condition:4-thiouridine ...

- Lipchina I; Elkabetz Y; Hafner M; Sheridan et al., 2011, Genes & development.

miRNA-target interactions (Provided by authors)
ID Duplex structure Position
1 
miRNA  3' ccguuuuuguCGUUAAUGAAAg 5'
                    ||| ||||||| 
Target 5' uauuacuguuGCAUUUACUUUu 3'
 		5 - 26
Article - Lipchina I; Elkabetz Y; Hafner M; Sheridan et al.
- Genes & development, 2011
MicroRNAs are important regulators in many cellular processes, including stem cell self-renewal. Recent studies demonstrated their function as pluripotency factors with the capacity for somatic cell reprogramming. However, their role in human embryonic stem (ES) cells (hESCs) remains poorly understood, partially due to the lack of genome-wide strategies to identify their targets. Here, we performed comprehensive microRNA profiling in hESCs and in purified neural and mesenchymal derivatives. Using a combination of AGO cross-linking and microRNA perturbation experiments, together with computational prediction, we identified the targets of the miR-302/367 cluster, the most abundant microRNAs in hESCs. Functional studies identified novel roles of miR-302/367 in maintaining pluripotency and regulating hESC differentiation. We show that in addition to its role in TGF-beta signaling, miR-302/367 promotes bone morphogenetic protein (BMP) signaling by targeting BMP inhibitors TOB2, DAZAP2, and SLAIN1. This study broadens our understanding of microRNA function in hESCs and is a valuable resource for future studies in this area.
LinkOut: [PMID: 22012620]
CLIP-seq Support 1 for dataset GSM545216
Method / RBP PAR-CLIP / AGO2
Cell line / Condition HEK293 / miR-124 transfection
Location of target site ENST00000256442.5 | 3UTR | CCAUCUGUACAUAUUACUGUUGCAUUUACUUUUAAUAAAG
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 20371350 / GSE21578
CLIP-seq Viewer Link
CLIP-seq Support 2 for dataset SRR359787
Method / RBP PAR-CLIP / AGO2
Cell line / Condition hESCs (WA-09) / 4-thiouridine, RNase T1
Location of target site ENST00000256442.5 | 3UTR | UACAUAUUACUGUUGCAUUUACUUUUAAUAAA
Tools used in this analysis TargetScan, miRTarCLIP, and Piranha
Article / Accession Series PMID: 22012620 / SRX103431
CLIP-seq Viewer Link
MiRNA-Target Expression Profile
Dataset Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
MiRNA-Target Expression Profile (TCGA)
Tumor Pearson Correlation P-value for Pearson Correlation Spearman Correlation P-value for Spearman Correlation Samples Chart
184 hsa-miR-548aq-5p Target Genes:
Functional analysis:
ID Target Description Validation methods
Strong evidence Less strong evidence
MIRT057134 DDIT4 DNA damage inducible transcript 4 2 4
MIRT063382 ETNK1 ethanolamine kinase 1 2 2
MIRT072505 RAB8B RAB8B, member RAS oncogene family 2 2
MIRT082197 ACTN4 actinin alpha 4 2 6
MIRT083047 PTBP1 polypyrimidine tract binding protein 1 2 2
MIRT085199 SLC5A3 solute carrier family 5 member 3 2 4
MIRT088917 FOXN2 forkhead box N2 2 4
MIRT089509 MTHFD2 methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2, methenyltetrahydrofolate cyclohydrolase 2 6
MIRT092051 ABHD5 abhydrolase domain containing 5 2 2
MIRT094694 FEM1C fem-1 homolog C 2 2
MIRT095408 UBE2D2 ubiquitin conjugating enzyme E2 D2 2 2
MIRT096514 BRIX1 BRX1, biogenesis of ribosomes 2 2
MIRT101306 FAM135A family with sequence similarity 135 member A 2 2
MIRT103369 CBX3 chromobox 3 2 2
MIRT103887 FOXK1 forkhead box K1 2 2
MIRT104347 CLDN12 claudin 12 2 2
MIRT104511 PEG10 paternally expressed 10 2 6
MIRT111811 MPZL1 myelin protein zero like 1 2 2
MIRT177250 BMI1 BMI1 proto-oncogene, polycomb ring finger 2 2
MIRT177285 COMMD3-BMI1 COMMD3-BMI1 readthrough 2 2
MIRT177635 UBE2D1 ubiquitin conjugating enzyme E2 D1 2 6
MIRT178051 SAMD8 sterile alpha motif domain containing 8 2 2
MIRT179111 PAFAH1B2 platelet activating factor acetylhydrolase 1b catalytic subunit 2 2 6
MIRT179598 CAPZA1 capping actin protein of muscle Z-line alpha subunit 1 2 6
MIRT195309 LEPROT leptin receptor overlapping transcript 2 2
MIRT203155 BACH1 BTB domain and CNC homolog 1 2 2
MIRT208439 ZBTB38 zinc finger and BTB domain containing 38 2 2
MIRT214587 SMAD5 SMAD family member 5 2 4
MIRT216114 IL6ST interleukin 6 signal transducer 2 2
MIRT216366 CCNB1 cyclin B1 2 4
MIRT220062 MDFIC MyoD family inhibitor domain containing 2 2
MIRT226739 ANP32B acidic nuclear phosphoprotein 32 family member B 2 4
MIRT227708 TBC1D13 TBC1 domain family member 13 2 2
MIRT230083 SH3BGRL SH3 domain binding glutamate rich protein like 2 2
MIRT248647 HMGN2 high mobility group nucleosomal binding domain 2 2 4
MIRT254803 XRCC6 X-ray repair cross complementing 6 2 6
MIRT264390 YAP1 Yes associated protein 1 2 2
MIRT266985 LRRC55 leucine rich repeat containing 55 2 4
MIRT273960 SPRYD4 SPRY domain containing 4 2 2
MIRT281812 MAP2K1 mitogen-activated protein kinase kinase 1 2 2
MIRT293265 DR1 down-regulator of transcription 1 2 2
MIRT297107 RGPD4 RANBP2-like and GRIP domain containing 4 2 2
MIRT308184 PDE12 phosphodiesterase 12 2 2
MIRT309027 USP53 ubiquitin specific peptidase 53 2 2
MIRT311481 PRRC1 proline rich coiled-coil 1 2 2
MIRT312599 G3BP1 G3BP stress granule assembly factor 1 2 4
MIRT328139 ZNF711 zinc finger protein 711 2 2
MIRT329324 FAM53C family with sequence similarity 53 member C 2 2
MIRT334652 NEK7 NIMA related kinase 7 2 2
MIRT340683 THRAP3 thyroid hormone receptor associated protein 3 2 2
MIRT378867 ITGB8 integrin subunit beta 8 2 2
MIRT395804 SPCS3 signal peptidase complex subunit 3 2 2
MIRT405650 WBP4 WW domain binding protein 4 2 4
MIRT408296 GRPEL2 GrpE like 2, mitochondrial 2 2
MIRT442110 ZNRF2 zinc and ring finger 2 2 8
MIRT442853 GTF2H5 general transcription factor IIH subunit 5 2 2
MIRT443129 VLDLR very low density lipoprotein receptor 2 2
MIRT443160 ZDHHC21 zinc finger DHHC-type containing 21 2 2
MIRT443311 PRPS1L1 phosphoribosyl pyrophosphate synthetase 1-like 1 2 2
MIRT445093 ZNF207 zinc finger protein 207 2 2
MIRT445397 PTCHD1 patched domain containing 1 2 4
MIRT447083 MCC mutated in colorectal cancers 2 2
MIRT447313 ZNF562 zinc finger protein 562 2 2
MIRT447526 MRPS5 mitochondrial ribosomal protein S5 2 2
MIRT449524 TM6SF1 transmembrane 6 superfamily member 1 2 2
MIRT449915 C11orf34 placenta expressed transcript 1 1 2
MIRT450564 SHFM1 SEM1, 26S proteasome complex subunit 2 2
MIRT450732 PVRL3 nectin cell adhesion molecule 3 2 2
MIRT454936 ANKEF1 ankyrin repeat and EF-hand domain containing 1 2 12
MIRT455905 KIF2C kinesin family member 2C 2 2
MIRT463745 YWHAE tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein epsilon 2 8
MIRT471195 PHB2 prohibitin 2 2 2
MIRT472777 MTMR6 myotubularin related protein 6 2 8
MIRT474470 KLHL11 kelch like family member 11 2 8
MIRT475998 GTPBP2 GTP binding protein 2 2 2
MIRT482290 AGO2 argonaute 2, RISC catalytic component 2 4
MIRT485871 ALG9 ALG9, alpha-1,2-mannosyltransferase 2 2
MIRT486205 ERH ERH, mRNA splicing and mitosis factor 2 4
MIRT488622 FAM3C family with sequence similarity 3 member C 2 6
MIRT489997 DDB1 damage specific DNA binding protein 1 2 2
MIRT493489 IPMK inositol polyphosphate multikinase 2 2
MIRT494293 CEP120 centrosomal protein 120 2 2
MIRT498005 ZBTB20 zinc finger and BTB domain containing 20 2 2
MIRT498486 PTBP2 polypyrimidine tract binding protein 2 2 10
MIRT498572 TMEM30B transmembrane protein 30B 2 2
MIRT499880 SVOP SV2 related protein 2 10
MIRT500233 INHBA inhibin beta A subunit 2 10
MIRT500707 TRIM37 tripartite motif containing 37 2 2
MIRT501001 SPPL2A signal peptide peptidase like 2A 2 4
MIRT501036 SMG1 SMG1, nonsense mediated mRNA decay associated PI3K related kinase 2 6
MIRT502749 CLIP1 CAP-Gly domain containing linker protein 1 2 8
MIRT502811 CELSR3 cadherin EGF LAG seven-pass G-type receptor 3 2 6
MIRT502900 CDK4 cyclin dependent kinase 4 2 8
MIRT503496 ZNF154 zinc finger protein 154 2 6
MIRT503730 GRM5 glutamate metabotropic receptor 5 2 2
MIRT505150 YOD1 YOD1 deubiquitinase 2 2
MIRT505815 RSBN1 round spermatid basic protein 1 2 8
MIRT505854 POLR1B RNA polymerase I subunit B 2 4
MIRT509297 NPM3 nucleophosmin/nucleoplasmin 3 2 6
MIRT516842 CYP20A1 cytochrome P450 family 20 subfamily A member 1 2 2
MIRT520532 TRA2B transformer 2 beta homolog 2 2
MIRT520736 TM9SF3 transmembrane 9 superfamily member 3 2 6
MIRT525416 SHISA9 shisa family member 9 2 4
MIRT525880 ARL13B ADP ribosylation factor like GTPase 13B 2 2
MIRT526026 RBM4B RNA binding motif protein 4B 2 2
MIRT526097 TMEM41B transmembrane protein 41B 2 2
MIRT527944 FRY FRY microtubule binding protein 2 2
MIRT528831 RAB32 RAB32, member RAS oncogene family 2 2
MIRT531075 SLC9A4 solute carrier family 9 member A4 2 4
MIRT535508 PANX1 pannexin 1 2 2
MIRT536695 IKZF5 IKAROS family zinc finger 5 2 2
MIRT536848 HMBOX1 homeobox containing 1 2 2
MIRT537215 GDE1 glycerophosphodiester phosphodiesterase 1 2 4
MIRT537847 EFNA5 ephrin A5 2 2
MIRT538358 CSE1L chromosome segregation 1 like 2 4
MIRT541255 GPC4 glypican 4 2 2
MIRT543248 PEX7 peroxisomal biogenesis factor 7 2 2
MIRT543463 PARP15 poly(ADP-ribose) polymerase family member 15 2 2
MIRT543724 XKR9 XK related 9 2 2
MIRT543920 ESYT1 extended synaptotagmin 1 2 2
MIRT544012 KLRC3 killer cell lectin like receptor C3 2 2
MIRT544083 METTL8 methyltransferase like 8 2 2
MIRT544200 ANGPTL3 angiopoietin like 3 2 2
MIRT544821 ACSM2B acyl-CoA synthetase medium chain family member 2B 2 2
MIRT545059 PRELID1 PRELI domain containing 1 2 2
MIRT545227 HIST1H2BD histone cluster 1 H2B family member d 2 2
MIRT545302 SPC25 SPC25, NDC80 kinetochore complex component 2 2
MIRT545563 GIMAP4 GTPase, IMAP family member 4 2 2
MIRT546510 SIK1 salt inducible kinase 1 2 2
MIRT546927 PTP4A1 protein tyrosine phosphatase type IVA, member 1 2 2
MIRT547688 KPNA1 karyopherin subunit alpha 1 2 4
MIRT547781 KATNAL1 katanin catalytic subunit A1 like 1 2 2
MIRT548700 CRNKL1 crooked neck pre-mRNA splicing factor 1 2 2
MIRT548914 CHEK2 checkpoint kinase 2 2 4
MIRT549970 RPL7L1 ribosomal protein L7 like 1 2 4
MIRT550502 TMEM241 transmembrane protein 241 2 2
MIRT551062 MKLN1 muskelin 1 2 2
MIRT552824 XIAP X-linked inhibitor of apoptosis 2 4
MIRT553158 UBE2H ubiquitin conjugating enzyme E2 H 2 2
MIRT553843 SYNCRIP synaptotagmin binding cytoplasmic RNA interacting protein 2 2
MIRT554271 SIX4 SIX homeobox 4 2 2
MIRT555794 PCMTD1 protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1 2 2
MIRT556331 MAP2K4 mitogen-activated protein kinase kinase 4 2 2
MIRT556512 LIPA lipase A, lysosomal acid type 2 2
MIRT556706 KLHL28 kelch like family member 28 2 2
MIRT556765 KLF7 Kruppel like factor 7 2 2
MIRT557003 HPRT1 hypoxanthine phosphoribosyltransferase 1 2 2
MIRT557159 HOXA13 homeobox A13 2 2
MIRT557500 GPR27 G protein-coupled receptor 27 2 4
MIRT558115 ENPP5 ectonucleotide pyrophosphatase/phosphodiesterase 5 (putative) 2 2
MIRT559357 ATP5G3 ATP synthase, H+ transporting, mitochondrial Fo complex subunit C3 (subunit 9) 2 2
MIRT560348 ZWINT ZW10 interacting kinetochore protein 2 2
MIRT561312 ZBTB43 zinc finger and BTB domain containing 43 2 2
MIRT561896 MSANTD4 Myb/SANT DNA binding domain containing 4 with coiled-coils 2 2
MIRT561940 MFSD9 major facilitator superfamily domain containing 9 2 2
MIRT562948 TNIP2 TNFAIP3 interacting protein 2 2 2
MIRT563304 BBS10 Bardet-Biedl syndrome 10 2 2
MIRT563418 KIF3A kinesin family member 3A 2 2
MIRT563575 KIAA1586 KIAA1586 2 2
MIRT565888 NHS NHS actin remodeling regulator 2 2
MIRT566094 RCC2 regulator of chromosome condensation 2 2 2
MIRT566409 PLAGL2 PLAG1 like zinc finger 2 2 2
MIRT567272 HSP90AA1 heat shock protein 90 alpha family class A member 1 2 2
MIRT571481 CCDC80 coiled-coil domain containing 80 2 2
MIRT572952 VDAC2 voltage dependent anion channel 2 2 2
MIRT573641 ZNF724P zinc finger protein 724 2 2
MIRT573730 KHSRP KH-type splicing regulatory protein 2 2
MIRT609101 SMIM15 small integral membrane protein 15 2 6
MIRT617949 EBNA1BP2 EBNA1 binding protein 2 2 2
MIRT618392 PRKG2 protein kinase, cGMP-dependent, type II 2 2
MIRT619640 PLEKHG7 pleckstrin homology and RhoGEF domain containing G7 2 2
MIRT623468 KDM5A lysine demethylase 5A 2 2
MIRT629158 CTCFL CCCTC-binding factor like 2 2
MIRT638534 LYRM2 LYR motif containing 2 2 2
MIRT649496 CLDN16 claudin 16 2 2
MIRT683161 MTHFD1 methylenetetrahydrofolate dehydrogenase, cyclohydrolase and formyltetrahydrofolate synthetase 1 2 2
MIRT691673 SLC43A3 solute carrier family 43 member 3 2 2
MIRT693214 MKI67 marker of proliferation Ki-67 2 2
MIRT695347 AQP3 aquaporin 3 (Gill blood group) 2 2
MIRT701036 PCGF5 polycomb group ring finger 5 2 2
MIRT708766 RYBP RING1 and YY1 binding protein 2 2
MIRT717571 ZBTB37 zinc finger and BTB domain containing 37 2 2
MIRT719299 SETD7 SET domain containing lysine methyltransferase 7 2 2
MIRT725185 SDAD1 SDA1 domain containing 1 2 2
miRNA-Drug Resistance Associations
miRNA Drug Name CID NSC FDA Effect/Pattern Detection Method Level Phenotype Condition
hsa-mir-548aq Paclitaxel 36314 NSC125973 approved resistant cell line (BAS)
hsa-miR-548aq-5p Gefitinib 123631 NSC715055 approved sensitive High Non-Small Cell Lung Cancer tissue
hsa-miR-548aq-5p Erlotinib 176870 NSC718781 approved sensitive High Non-Small Cell Lung Cancer tissue
hsa-miR-548aq-5p Gefitinib 123631 NSC715055 approved sensitive cell line (PC9)
hsa-miR-548aq-5p Gefitinib 123631 NSC715055 approved sensitive cell line (HCC827)
hsa-miR-548aq-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (PC9)
hsa-miR-548aq-5p Osimertinib 71496458 NSC779217 approved sensitive cell line (HCC827)
hsa-miR-548aq-5p Gefitinib 123631 NSC715055 approved resistant cell line (HCC827)

Error report submission