>ACTB|NM_001101|3'UTR
   1 GCGGACTATGACTTAGTTGCGTTACACCCTTTCTTGACAAAACCTAACTTGCGCAGAAAACAAGATGAGATTGGCATGGC
  81 TTTATTTGTTTTTTTTGTTTTGTTTTGGTTTTTTTTTTTTTTTTGGCTTGACTCAGGATTTAAAAACTGGAACGGTGAAG
 161 GTGACAGCAGTCGGTTGGAGCGAGCATCCCCCAAAGTTCACAATGTGGCCGAGGACTTTGATTGCACATTGTTGTTTTTT
 241 TAATAGTCATTCCAAATATGAGATGCGTTGTTACAGGAAGTCCCTTGCCATCCTAAAAGCCACCCCACTTCTCTCTAAGG
 321 AGAATGGCCCAGTCCTCTCCCAAGTCCACACAGGGGAGGTGATAGCATTGCTTTCGTGTAAATTATGTAATGCAAAATTT
 401 TTTTAATCTTCGCCTTAATACTTTTTTATTTTGTTTTATTTTGAATGATGAGCCTTCGTGCCCCCCCTTCCCCCTTTTTT
 481 GTCCCCCAACTTGAGATGTATGAAGGCTTTTGGTCTCCCTGGGAGTGGGTGGAGGCAGCCAGGGCTTACCTGTACACTGA
 561 CTTGAGACCAGTTGAATAAAAGTGCACACCTTAAAAATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' accacguuuucAUUAACACCAAAAa 5' | :|| ||||||| Target 5' ttttttttgttTTGTTTTGGTTTTt 3'	89 - 113	150.00	-6.00
2	miRNA 3' accacGUUUU-CAUUAAC---ACCAAAAa 5' |||:| | :|||| ||| ||| Target 5' gaaaaCAAGATGAGATTGGCATGGCTTTa 3'	56 - 84	132.00	-5.90
3	miRNA 3' accACGUUUUCAU-UAACACCAAAAa 5' | ::| | | ||||| ||||| Target 5' gacTTTGATTGCACATTGTTGTTTTt 3'	214 - 239	130.00	-6.00

Mutant ID	Mutant Position	Mutant Source
987424	53	ClinVar
1185839	260	ClinVar
COSN30497777	3	COSMIC
COSN30155279	10	COSMIC
COSN26964933	20	COSMIC
COSN30116509	25	COSMIC
COSN17076391	33	COSMIC
COSN30168920	36	COSMIC
COSN26964932	52	COSMIC
COSN8029202	56	COSMIC
COSN31611836	79	COSMIC
COSN20091509	97	COSMIC
COSN19613139	102	COSMIC
COSN30118120	103	COSMIC
COSN28668341	107	COSMIC
COSN28634376	108	COSMIC
COSN30477025	109	COSMIC
COSN31596208	126	COSMIC
COSN30181322	130	COSMIC
COSN30521459	130	COSMIC
COSN30515650	136	COSMIC
COSN32072241	138	COSMIC
COSN26645243	149	COSMIC
COSN26506839	153	COSMIC
COSN31564331	154	COSMIC
COSN30147903	157	COSMIC
COSN30545321	168	COSMIC
COSN31578487	172	COSMIC
COSN1351348	175	COSMIC
COSN30169044	178	COSMIC
COSN14295355	181	COSMIC
COSN16131555	182	COSMIC
COSN30490357	189	COSMIC
COSN31532685	210	COSMIC
COSN23017038	229	COSMIC
COSN26645824	234	COSMIC
COSN32057770	260	COSMIC
COSN23017037	267	COSMIC
COSN19487471	270	COSMIC
COSN32057769	280	COSMIC
COSN26641503	284	COSMIC
COSN26578067	306	COSMIC
COSN26668784	375	COSMIC
COSN26577770	376	COSMIC
COSN26668503	398	COSMIC
COSN26668214	399	COSMIC
COSN31575879	399	COSMIC
COSN26633479	412	COSMIC
COSN26585290	461	COSMIC
COSN26643539	475	COSMIC
COSN26676283	481	COSMIC
COSN8516794	493	COSMIC
COSN16129816	495	COSMIC

Mutant ID	Mutant Position	Mutant Source
rs774719514	1	dbSNP
rs200011987	2	dbSNP
rs769620514	3	dbSNP
rs1390956841	6	dbSNP
rs1164221670	7	dbSNP
rs759456782	8	dbSNP
rs1214743779	11	dbSNP
rs776416632	12	dbSNP
rs770822774	17	dbSNP
rs546596340	18	dbSNP
rs1249982839	19	dbSNP
rs777620729	20	dbSNP
rs771806128	21	dbSNP
rs747696590	24	dbSNP
rs768197623	24	dbSNP
rs528042634	25	dbSNP
rs775082663	27	dbSNP
rs1201609614	28	dbSNP
rs370911789	29	dbSNP
rs754429468	32	dbSNP
rs780422687	35	dbSNP
rs1229072545	36	dbSNP
rs1367192300	37	dbSNP
rs756549406	38	dbSNP
rs750735339	42	dbSNP
rs748905451	43	dbSNP
rs767758078	44	dbSNP
rs761955678	46	dbSNP
rs1389039238	47	dbSNP
rs1163260391	48	dbSNP
rs751647886	49	dbSNP
rs1392514270	50	dbSNP
rs1323353767	51	dbSNP
rs1329812538	52	dbSNP
rs560972961	53	dbSNP
rs1304184912	54	dbSNP
rs1376263999	55	dbSNP
rs1238152783	56	dbSNP
rs1449805065	57	dbSNP
rs1252496544	60	dbSNP
rs1351737318	61	dbSNP
rs1208988844	62	dbSNP
rs1195943298	64	dbSNP
rs1287508131	66	dbSNP
rs186180658	69	dbSNP
rs147293109	72	dbSNP
rs1237563102	84	dbSNP
rs1437260482	86	dbSNP
rs1065094	87	dbSNP
rs1224931127	88	dbSNP
rs1363984622	88	dbSNP
rs1472277297	89	dbSNP
rs1323750711	90	dbSNP
rs1283072370	91	dbSNP
rs1463417131	92	dbSNP
rs917362860	93	dbSNP
rs563132910	95	dbSNP
rs1244361677	97	dbSNP
rs1309294137	97	dbSNP
rs1400289944	97	dbSNP
rs1444630341	97	dbSNP
rs1491056445	97	dbSNP
rs372205322	97	dbSNP
rs574890214	97	dbSNP
rs879017430	97	dbSNP
rs1257318833	98	dbSNP
rs13447410	100	dbSNP
rs1250637610	101	dbSNP
rs17136418	102	dbSNP
rs544447349	103	dbSNP
rs1419667621	106	dbSNP
rs1423500579	108	dbSNP
rs1476385178	108	dbSNP
rs11546928	109	dbSNP
rs1390952187	109	dbSNP
rs1299915880	110	dbSNP
rs1397306623	111	dbSNP
rs1395592443	112	dbSNP
rs1398178477	112	dbSNP
rs1338991392	113	dbSNP
rs577490709	116	dbSNP
rs1428784991	118	dbSNP
rs1315931997	122	dbSNP
rs950871994	124	dbSNP
rs1198291101	125	dbSNP
rs1251319696	125	dbSNP
rs1421339928	125	dbSNP
rs370106412	125	dbSNP
rs879140023	125	dbSNP
rs920724265	125	dbSNP
rs1476915649	126	dbSNP
rs1173157860	127	dbSNP
rs1427198023	127	dbSNP
rs879167389	130	dbSNP
rs1377460785	142	dbSNP
rs1415648094	150	dbSNP
rs1182403729	153	dbSNP
rs1456959390	154	dbSNP
rs887488041	156	dbSNP
rs1204961617	162	dbSNP
rs1461503730	164	dbSNP
rs1296196209	165	dbSNP
rs1330503473	167	dbSNP
rs1277399124	172	dbSNP
rs1281885085	173	dbSNP
rs1348096429	176	dbSNP
rs1215463616	179	dbSNP
rs1214000017	180	dbSNP
rs1285674310	182	dbSNP
rs1485089976	185	dbSNP
rs1188706944	186	dbSNP
rs1199171727	191	dbSNP
rs1263003433	193	dbSNP
rs1433144206	199	dbSNP
rs11546911	201	dbSNP
rs558941094	202	dbSNP
rs973656749	203	dbSNP
rs13447411	210	dbSNP
rs1343718957	211	dbSNP
rs1317283627	214	dbSNP
rs1289275268	215	dbSNP
rs76543773	218	dbSNP
rs760087387	219	dbSNP
rs1366772845	220	dbSNP
rs11546941	223	dbSNP
rs1438654612	225	dbSNP
rs1018267990	226	dbSNP
rs1238866353	230	dbSNP
rs11546919	232	dbSNP
rs1306601475	233	dbSNP
rs11546918	235	dbSNP
rs1332419197	237	dbSNP
rs770392180	237	dbSNP
rs1212367802	242	dbSNP
rs1412593854	242	dbSNP
rs1488406240	242	dbSNP
rs372590587	242	dbSNP
rs1454756008	244	dbSNP
rs1386825162	246	dbSNP
rs1406027299	248	dbSNP
rs1421144321	250	dbSNP
rs1158885555	253	dbSNP
rs11546890	257	dbSNP
rs1008593723	258	dbSNP
rs11546906	260	dbSNP
rs1159504972	260	dbSNP
rs1378342106	262	dbSNP
rs11546935	263	dbSNP
rs1459749757	266	dbSNP
rs7612	267	dbSNP
rs11546927	271	dbSNP
rs1395191241	274	dbSNP
rs182601851	274	dbSNP
rs1295975440	275	dbSNP
rs1375000450	275	dbSNP
rs11546905	280	dbSNP
rs1308065009	281	dbSNP
rs1334603322	282	dbSNP
rs773005303	288	dbSNP
rs1207559049	289	dbSNP
rs1053587255	292	dbSNP
rs1469339893	301	dbSNP
rs1285432459	304	dbSNP
rs1481708901	306	dbSNP
rs1216285434	307	dbSNP
rs1413430605	309	dbSNP
rs1065729	315	dbSNP
rs1166878564	317	dbSNP
rs1352152786	317	dbSNP
rs531156306	317	dbSNP
rs1294581020	319	dbSNP
rs1418433502	320	dbSNP
rs1465059281	322	dbSNP
rs1326212173	324	dbSNP
rs1246877167	329	dbSNP
rs796517564	336	dbSNP
rs1282679917	337	dbSNP
rs1442383329	339	dbSNP
rs1433190076	340	dbSNP
rs1353236339	341	dbSNP
rs1413294962	345	dbSNP
rs538427751	346	dbSNP
rs1336045127	348	dbSNP
rs1214514648	349	dbSNP
rs778199310	352	dbSNP
rs1309330127	354	dbSNP
rs11546891	356	dbSNP
rs138738998	359	dbSNP
rs546534519	362	dbSNP
rs528382886	365	dbSNP
rs550708657	366	dbSNP
rs11546923	369	dbSNP
rs1257978054	371	dbSNP
rs1166080296	375	dbSNP
rs1477415007	375	dbSNP
rs780886103	376	dbSNP
rs3210647	382	dbSNP
rs548986521	386	dbSNP
rs1174797620	387	dbSNP
rs1373201598	391	dbSNP
rs1436227118	392	dbSNP
rs1315110265	394	dbSNP
rs530641101	395	dbSNP
rs1424805862	397	dbSNP
rs1364746361	400	dbSNP
rs563211915	404	dbSNP
rs1213294634	405	dbSNP
rs1345921149	405	dbSNP
rs1179569553	408	dbSNP
rs1281392831	411	dbSNP
rs544796945	412	dbSNP
rs1243748726	413	dbSNP
rs1190076386	415	dbSNP
rs1475721434	415	dbSNP
rs1392741997	417	dbSNP
rs11266786	419	dbSNP
rs1271861507	420	dbSNP
rs1193478938	421	dbSNP
rs11546889	422	dbSNP
rs1400470192	424	dbSNP
rs758823620	426	dbSNP
rs1223837262	428	dbSNP
rs565468236	432	dbSNP
rs1302673020	433	dbSNP
rs3206243	433	dbSNP
rs779086394	437	dbSNP
rs1350285937	438	dbSNP
rs1203119170	439	dbSNP
rs1286117977	442	dbSNP
rs548056688	443	dbSNP
rs1340326828	444	dbSNP
rs1251137521	446	dbSNP
rs1455185502	450	dbSNP
rs3210032	453	dbSNP
rs1399234893	454	dbSNP
rs1338127216	457	dbSNP
rs1410626253	458	dbSNP
rs1401716393	460	dbSNP
rs1325804677	461	dbSNP
rs1304922621	462	dbSNP
rs1443152937	465	dbSNP
rs1405518168	466	dbSNP
rs1335349700	467	dbSNP
rs567790396	468	dbSNP
rs772866040	468	dbSNP
rs1162109016	470	dbSNP
rs1232516423	472	dbSNP
rs3210108	474	dbSNP
rs1271173581	475	dbSNP
rs1469799895	478	dbSNP
rs562224012	481	dbSNP
rs1419858229	483	dbSNP
rs1169487830	484	dbSNP
rs1477069512	487	dbSNP
rs1364070285	489	dbSNP
rs1473109039	493	dbSNP
rs1164704706	495	dbSNP
rs764321317	498	dbSNP
rs1463498459	499	dbSNP
rs756378543	500	dbSNP
rs13447412	505	dbSNP
rs1200531020	506	dbSNP
rs11546892	508	dbSNP
rs11546924	511	dbSNP
rs1336630061	515	dbSNP
rs1291233650	519	dbSNP
rs1488446442	521	dbSNP
rs1233828277	522	dbSNP
rs781397464	530	dbSNP
rs1336860683	538	dbSNP
rs1245419031	541	dbSNP
rs1250750285	547	dbSNP
rs368246302	548	dbSNP
rs1187624251	550	dbSNP
rs1206800541	553	dbSNP
rs1476437418	554	dbSNP
rs1188854298	558	dbSNP
rs1438455019	568	dbSNP
rs1373068575	571	dbSNP
rs1169767986	574	dbSNP
rs1257725315	576	dbSNP
rs1434350658	578	dbSNP
rs1310776599	579	dbSNP
rs1217001391	581	dbSNP
rs1415229667	582	dbSNP
rs1294738995	583	dbSNP
rs1324656054	584	dbSNP
rs1228916854	587	dbSNP
rs920676756	601	dbSNP

- Nature methods, 2011

Cross-linking and immunoprecipitation (CLIP) is increasingly used to map transcriptome-wide binding sites of RNA-binding proteins. We developed a method for CLIP data analysis, and applied it to compare CLIP with photoactivatable ribonucleoside-enhanced CLIP (PAR-CLIP) and to uncover how differences in cross-linking and ribonuclease digestion affect the identified sites. We found only small differences in accuracies of these methods in identifying binding sites of HuR, which binds low-complexity sequences, and Argonaute 2, which has a complex binding specificity. We found that cross-link-induced mutations led to single-nucleotide resolution for both PAR-CLIP and CLIP. Our results confirm the expectation from original CLIP publications that RNA-binding proteins do not protect their binding sites sufficiently under the denaturing conditions used during the CLIP procedure, and we show that extensive digestion with sequence-specific RNases strongly biases the recovered binding sites. This bias can be substantially reduced by milder nuclease digestion conditions.

- mBio, 2013

UNLABELLED: The question of how HIV-1 interfaces with cellular microRNA (miRNA) biogenesis and effector mechanisms has been highly controversial. Here, we first used deep sequencing of small RNAs present in two different infected cell lines (TZM-bl and C8166) and two types of primary human cells (CD4(+) peripheral blood mononuclear cells [PBMCs] and macrophages) to unequivocally demonstrate that HIV-1 does not encode any viral miRNAs. Perhaps surprisingly, we also observed that infection of T cells by HIV-1 has only a modest effect on the expression of cellular miRNAs at early times after infection. Comprehensive analysis of miRNA binding to the HIV-1 genome using the photoactivatable ribonucleoside-induced cross-linking and immunoprecipitation (PAR-CLIP) technique revealed several binding sites for cellular miRNAs, a subset of which were shown to be capable of mediating miRNA-mediated repression of gene expression. However, the main finding from this analysis is that HIV-1 transcripts are largely refractory to miRNA binding, most probably due to extensive viral RNA secondary structure. Together, these data demonstrate that HIV-1 neither encodes viral miRNAs nor strongly influences cellular miRNA expression, at least early after infection, and imply that HIV-1 transcripts have evolved to avoid inhibition by preexisting cellular miRNAs by adopting extensive RNA secondary structures that occlude most potential miRNA binding sites. IMPORTANCE: MicroRNAs (miRNAs) are a ubiquitous class of small regulatory RNAs that serve as posttranscriptional regulators of gene expression. Previous work has suggested that HIV-1 might subvert the function of the cellular miRNA machinery by expressing viral miRNAs or by dramatically altering the level of cellular miRNA expression. Using very sensitive approaches, we now demonstrate that neither of these ideas is in fact correct. Moreover, HIV-1 transcripts appear to largely avoid regulation by cellular miRNAs by adopting an extensive RNA secondary structure that occludes the ability of cellular miRNAs to interact with viral mRNAs. Together, these data suggest that HIV-1, rather than seeking to control miRNA function in infected cells, has instead evolved a mechanism to become largely invisible to cellular miRNA effector mechanisms.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.