>SERPINH1|NM_001235|3'UTR
   1 GGCCTCAGGGTGCACACAGGATGGCAGGAGGCATCCAAAGGCTCCTGAGACACATGGGTGCTATTGGGGTTGGGGGGGAG
  81 GTGAGGTACCAGCCTTGGATACTCCATGGGGTGGGGGTGGAAAAACAGACCGGGGTTCCCGTGTGCCTGAGCGGACCTTC
 161 CCAGCTAGAATTCACTCCACTTGGACATGGGCCCCAGATACCATGATGCTGAGCCCGGAAACTCCACATCCTGTGGGACC
 241 TGGGCCATAGTCATTCTGCCTGCCCTGAAAGTCCCAGATCAAGCCTGCCTCAATCAGTATTCATATTTATAGCCAGGTAC
 321 CTTCTCACCTGTGAGACCAAATTGAGCTAGGGGGGTCAGCCAGCCCTCTTCTGACACTAAAACACCTCAGCTGCCTCCCC
 401 AGCTCTATCCCAACCTCTCCCAACTATAAAACTAGGTGCTGCAGCCCCTGGGACCAGGCACCCCCAGAATGACCTGGCCG
 481 CAGTGAGGCGGATTGAGAAGGAGCTCCCAGGAGGGGCTTCTGGGCAGACTCTGGTCAAGAAGCATCGTGTCTGGCGTTGT
 561 GGGGATGAACTTTTTGTTTTGTTTCTTCCTTTTTTAGTTCTTCAAAGATAGGGAGGGAAGGGGGAACATGAGCCTTTGTT
 641 GCTATCAATCCAAGAACTTATTTGTACATTTTTTTTTTCAATAAAACTTTTCCAATGACATTTTGTTGGAGCGTGGAAGA
 721 AAAAAAAAAAAAAA

ID	Duplex structure	Position	Score	MFE
1	miRNA 3' uaagCUACUGAGUC-AGAGAAGAa 5' |:| | ||| ||||||| Target 5' ggggGGTCAGCCAGCCCTCTTCTg 3'	350 - 373	151.00	-12.50
2	miRNA 3' uaagcuACUGAGUCAGAGAAGaa 5' | ::|: ||:||||| Target 5' aactttTTGTTTTGTTTCTTCct 3'	568 - 590	121.00	-8.20
3	miRNA 3' uaAG-CUACUGA---GUCAGAGA-AGaa 5' || | || || ||| |||| || Target 5' ccTCAGCTGCCTCCCCAG-CTCTATCcc 3'	385 - 411	104.00	-8.10

Mutant ID	Mutant Position	Mutant Source
306114	5	ClinVar
880607	74	ClinVar
882023	75	ClinVar
882024	118	ClinVar
306115	126	ClinVar
882025	154	ClinVar
306116	180	ClinVar
306117	229	ClinVar
306118	355	ClinVar
306119	491	ClinVar
306120	512	ClinVar
306121	526	ClinVar
306122	532	ClinVar
883183	537	ClinVar
306123	557	ClinVar
306124	581	ClinVar
306125	669	ClinVar
306126	669	ClinVar
883184	669	ClinVar
COSN30494996	14	COSMIC
COSN30151571	39	COSMIC
COSN28840279	79	COSMIC
COSN1137932	115	COSMIC
COSN32062668	172	COSMIC
COSN8690844	181	COSMIC
COSN8283690	244	COSMIC
COSN32056058	307	COSMIC
COSN31960657	327	COSMIC
COSN22542414	552	COSMIC
COSN30249920	648	COSMIC
COSN23125193	679	COSMIC
COSN19045438	682	COSMIC
rs6704	526	GWAS

Mutant ID	Mutant Position	Mutant Source
rs377537840	4	dbSNP
rs550152153	5	dbSNP
rs1007224540	7	dbSNP
rs1487663409	7	dbSNP
rs1288700654	10	dbSNP
rs746898179	13	dbSNP
rs757075129	19	dbSNP
rs779187142	19	dbSNP
rs1268504806	25	dbSNP
rs767339248	32	dbSNP
rs569709941	36	dbSNP
rs756132470	37	dbSNP
rs1205522748	41	dbSNP
rs779366928	42	dbSNP
rs1170614629	44	dbSNP
rs1348777348	45	dbSNP
rs768715142	65	dbSNP
rs1226644495	67	dbSNP
rs1328648462	72	dbSNP
rs770329618	72	dbSNP
rs1235609513	73	dbSNP
rs1018656928	74	dbSNP
rs116470636	75	dbSNP
rs958073489	77	dbSNP
rs915709248	78	dbSNP
rs1010753984	107	dbSNP
rs948544048	107	dbSNP
rs1021023309	111	dbSNP
rs1430155701	114	dbSNP
rs1250118590	115	dbSNP
rs184623179	118	dbSNP
rs1360843200	120	dbSNP
rs1464617770	121	dbSNP
rs9175	126	dbSNP
rs911870586	131	dbSNP
rs1354838140	132	dbSNP
rs1284168876	133	dbSNP
rs964778897	136	dbSNP
rs1433846540	141	dbSNP
rs1394787793	142	dbSNP
rs568431961	147	dbSNP
rs1403136792	149	dbSNP
rs920863843	150	dbSNP
rs930783668	153	dbSNP
rs146501145	154	dbSNP
rs889248139	157	dbSNP
rs1388019332	158	dbSNP
rs908073484	165	dbSNP
rs939761643	171	dbSNP
rs1253923538	173	dbSNP
rs1201055770	178	dbSNP
rs557446600	180	dbSNP
rs1289780437	187	dbSNP
rs1196816769	189	dbSNP
rs577079784	193	dbSNP
rs1405829848	195	dbSNP
rs1166865706	200	dbSNP
rs1228188508	200	dbSNP
rs1371235783	202	dbSNP
rs906190495	205	dbSNP
rs1040097164	208	dbSNP
rs1453159973	215	dbSNP
rs111736118	217	dbSNP
rs1242443847	217	dbSNP
rs376814949	218	dbSNP
rs1031312994	222	dbSNP
rs189882479	229	dbSNP
rs1010723094	244	dbSNP
rs1314851609	258	dbSNP
rs1380379742	263	dbSNP
rs1011459464	288	dbSNP
rs1435149694	294	dbSNP
rs1230489232	297	dbSNP
rs1020784427	304	dbSNP
rs1174596959	306	dbSNP
rs34952121	306	dbSNP
rs1477172373	313	dbSNP
rs1246157626	315	dbSNP
rs1182644905	319	dbSNP
rs558945241	332	dbSNP
rs758995272	349	dbSNP
rs1250294423	352	dbSNP
rs1314557192	353	dbSNP
rs541972599	355	dbSNP
rs1281184625	356	dbSNP
rs966565372	357	dbSNP
rs1217046586	362	dbSNP
rs1343894051	373	dbSNP
rs1279583483	374	dbSNP
rs1268369812	385	dbSNP
rs1466009513	396	dbSNP
rs1307419582	397	dbSNP
rs1009392489	403	dbSNP
rs1019030025	410	dbSNP
rs965036323	415	dbSNP
rs561786704	416	dbSNP
rs920820736	418	dbSNP
rs1331981815	427	dbSNP
rs1412930222	429	dbSNP
rs1473004773	436	dbSNP
rs1022924131	437	dbSNP
rs1159185448	442	dbSNP
rs1473651008	444	dbSNP
rs767821286	445	dbSNP
rs868701658	447	dbSNP
rs969878465	449	dbSNP
rs952279549	454	dbSNP
rs1182017527	455	dbSNP
rs1486286992	461	dbSNP
rs981298851	461	dbSNP
rs1208493560	462	dbSNP
rs1441463263	479	dbSNP
rs1160050769	480	dbSNP
rs572134792	481	dbSNP
rs908042374	490	dbSNP
rs12978	491	dbSNP
rs141134744	496	dbSNP
rs886048662	512	dbSNP
rs533727421	515	dbSNP
rs1044610	521	dbSNP
rs1336359455	524	dbSNP
rs6704	526	dbSNP
rs1381273822	529	dbSNP
rs1450653108	530	dbSNP
rs374355309	532	dbSNP
rs1054819973	537	dbSNP
rs893502548	539	dbSNP
rs1044695	540	dbSNP
rs764676785	547	dbSNP
rs1049293058	548	dbSNP
rs529229750	552	dbSNP
rs1431311487	556	dbSNP
rs180685772	557	dbSNP
rs943521524	561	dbSNP
rs754383946	562	dbSNP
rs1416652330	571	dbSNP
rs1288371277	574	dbSNP
rs756861113	575	dbSNP
rs1803253	577	dbSNP
rs145619367	581	dbSNP
rs998577134	586	dbSNP
rs1221232554	590	dbSNP
rs1266880651	594	dbSNP
rs1213821001	596	dbSNP
rs900601467	598	dbSNP
rs1323396560	599	dbSNP
rs1287720669	601	dbSNP
rs764769645	612	dbSNP
rs762478451	617	dbSNP
rs534768780	623	dbSNP
rs1027599054	625	dbSNP
rs1299548857	630	dbSNP
rs1437497451	631	dbSNP
rs78709417	633	dbSNP
rs1011288803	645	dbSNP
rs1163363615	655	dbSNP
rs1022871934	660	dbSNP
rs1231100016	668	dbSNP
rs1177229108	669	dbSNP
rs1190949023	669	dbSNP
rs1489207454	669	dbSNP
rs185499724	669	dbSNP
rs397761622	669	dbSNP
rs1263180385	673	dbSNP
rs1480301819	682	dbSNP
rs1308037685	684	dbSNP
rs1182828572	687	dbSNP
rs1276449394	696	dbSNP
rs1414188708	699	dbSNP

- Cell, 2013

The induction of pluripotency or trans-differentiation of one cell type to another can be accomplished with cell-lineage-specific transcription factors. Here, we report that repression of a single RNA binding polypyrimidine-tract-binding (PTB) protein, which occurs during normal brain development via the action of miR-124, is sufficient to induce trans-differentiation of fibroblasts into functional neurons. Besides its traditional role in regulated splicing, we show that PTB has a previously undocumented function in the regulation of microRNA functions, suppressing or enhancing microRNA targeting by competitive binding on target mRNA or altering local RNA secondary structure. A key event during neuronal induction is the relief of PTB-mediated blockage of microRNA action on multiple components of the REST complex, thereby derepressing a large array of neuronal genes, including miR-124 and multiple neuronal-specific transcription factors, in nonneuronal cells. This converts a negative feedback loop to a positive one to elicit cellular reprogramming to the neuronal lineage.

- Genome research, 2016

DNA damage activates TP53-regulated surveillance mechanisms that are crucial in suppressing tumorigenesis. TP53 orchestrates these responses directly by transcriptionally modulating genes, including microRNAs (miRNAs), and by regulating miRNA biogenesis through interacting with the DROSHA complex. However, whether the association between miRNAs and AGO2 is regulated following DNA damage is not yet known. Here, we show that, following DNA damage, TP53 interacts with AGO2 to induce or reduce AGO2's association of a subset of miRNAs, including multiple let-7 family members. Furthermore, we show that specific mutations in TP53 decrease rather than increase the association of let-7 family miRNAs, reducing their activity without preventing TP53 from interacting with AGO2. This is consistent with the oncogenic properties of these mutants. Using AGO2 RIP-seq and PAR-CLIP-seq, we show that the DNA damage-induced increase in binding of let-7 family members to the RISC complex is functional. We unambiguously determine the global miRNA-mRNA interaction networks involved in the DNA damage response, validating them through the identification of miRNA-target chimeras formed by endogenous ligation reactions. We find that the target complementary region of the let-7 seed tends to have highly fixed positions and more variable ones. Additionally, we observe that miRNAs, whose cellular abundance or differential association with AGO2 is regulated by TP53, are involved in an intricate network of regulatory feedback and feedforward circuits. TP53-mediated regulation of AGO2-miRNA interaction represents a new mechanism of miRNA regulation in carcinogenesis.